Requirement of Active Human Immunodeficiency ... - Journal of Virology

Vol. 66, No. 12

JOURNAL OF VIROLOGY, Dec. 1992, p. 7414-7419

0022-538X/92/127414-06$02.00/0 Copyright X) 1992, American Society for Microbiology

Requirement of Active Human Immunodeficiency Virus Type 1 Integrase Enzyme for Productive Infection of Human T-Lymphoid Cells ROBERT L. LAFEMINA,* CHRISTINE L. SCHNEIDER, HELEN L. ROBBINS, PIA L. CALLAHAN, KATHLEEN LEGROW, ELIZABETH ROTH, WILLIAM A. SCHLEIF, AND EMILIO A. EMINI Merck Research Laboratories, West Point, Pennsylvania 19486 Received 1 July 1992/Accepted 22 September 1992

The human immunodeficiency virus type 1 (HIV-1) integrase enzyme exhibits significant amino acid sequence conservation with integrase proteins of other retroviruses. We introduced specific amino acid substitutions at a number of the conserved residue positions of recombinant HIV-1 integrase. Some of these substitutions resulted in proteins which were not able to be purified in the same manner as the wild-type enzyme, and these were not studied further. The remaining mutant enzymes were assessed for their abilities to perform functions characteristic of the integrase protein. These included specific removal of the terminal dinucleotides from oligonucleotide substrates representative of the viral U5-long terminal repeat, nonspecific cleavage of oligonucleotide substrates, and mediation of the strand transfer (integration) reaction. Substitution at position 43, within the protein's zinc finger motif region, resulted in an enzyme with reduced specificity for cleavage of the terminal dinucleotide. In addition, a double substitution of aspartic acid and glutamine for valine and glutamic acid, respectively, at positions 151 and 152 within the D,D(35)E motif region rendered the integrase protein inactive for all of its functions. The introduction of this double substitution into an infectious HIV-1 provirus yielded a mutant virus that was incapable of productively infecting human T-lymphoid cells in culture.

The genome of human immunodeficiency virus type 1 (HIV-1), a member of the Lentivirinae subfamily of retroviruses, encodes three primary enzymes that mediate the virus replication cycle. The reverse transcriptase converts the viral RNA genome into a double-stranded DNA provirus, the integrase nonspecifically inserts this proviral copy into the host cell genome, and the protease cleaves the virus structural and nonstructural proteins to their mature forms. These enzymes are obvious targets for specific HIV-1 antiviral therapeutic agents. The studies reported in this communication assessed the usefulness of the integrase enzyme as such a target by determining its absolute requirement for productive HIV-1 infection. The integrase protein is derived from the processed carboxy-terminal portion of the viral Gag-Pol polyprotein and is apparently transported into the host cell by the virion core particle. The enzyme is the only viral protein necessary for integration (6a, 14). It reacts with the linear double-stranded

cleavage of a dinucleotide from the oligonucleotide terminus, most likely by a nucleophilic attack (8, 30). The integrase also mediates the nonspecific cleavage of a second copy of the oligonucleotide, and the two cleaved species are then joined in a strand transfer reaction. Oligonucleotide substrate specificity studies have noted the importance of the CA dinucleotide preceding the cleavage site (6, 18, 25, 26, 29). Precleaved oligonucleotides from which the terminal dinucleotide has been removed can also serve as substrates for the nonspecific cleavage and can participate in strand transfer reactions with other precleaved oligonucleotides (4, 5, 18). Analyses of the amino acid sequences of a number of retroviral integrases and evolutionarily related retrotransposases have demonstrated the presence of conserved residues and motifs that may be important for integrase activity (9, lla, 12, 14, 23, 23a). These include a zinc finger motif near the protein's amino terminus (12). A 55-amino-acid peptide representing the integrase sequence that contains this motif binds zinc in a tetrahedrally coordinated fashion (3). However, the functional significance of this putative zinc finger is unknown. Also, a conserved motif of two aspartate residues and a glutamate residue [the D,D(35)E motif] has been identified elsewhere (12, 16). It has been suggested that this motif is essential for DNA binding and/or cleavage. It is unclear whether integration of the HIV-1 provirus into the host cell genome is absolutely required for productive infection. Previous studies have demonstrated that the avian sarcoma and murine leukemia retroviruses require an intact integrase gene for the spread of virus infection in cell culture (7, 11, 24). Among the lentiviruses, however, the simian immunodeficiency virus does not appear to require a functional integrase enzyme for virus infection (21) and the visna virus seems to replicate efficiently in the absence of integration (10). Stevenson et al. have reported that deletions within the integrase gene of HIV-1 yield a virus that is unable to

DNA product of reverse transcription and specifically cleaves a dinucleotide from the termini, yielding two-nucleotide 5' extensions at both ends. Integrase also mediates the staggered nonspecific cleavage of host cell target DNA and subsequently joins the free 3'-hydroxyl groups of the viralDNA termini to the 5'-phosphoryl groups of the cleaved host DNA. This reaction results in the loss of two nucleotides from the viral-DNA ends. It has been suggested that host cell enzymes then repair the gap between the newly integrated provirus and the host DNA (for a review, see reference 17). The expression of recombinant integrase protein and the in vitro use of oligonucleotide substrates that represent the viral long terminal repeat (LTR) have allowed for analysis of the interaction of the integrase with the DNA (4, 5, 13a, 18, 26, 28). In this system, the enzyme mediates the specific

*

Corresponding author. 7414

VOL. 66, 1992

INTEGRASE REQUIREMENT FOR HIV-1 INFECTIVITY

spread in cell culture but that viral-antigen production continues to occur from circular, unintegrated viral DNA (27). We sought to directly address the requirement of the integrase protein for HIV-1 infection by introducing specific amino acid substitutions into recombinant integrase and assessing the ability of the mutant proteins to properly mediate specific and nonspecific cleavage as well as integration. A 2-amino-acid substitution that proved to be completely deleterious to integrase function was then introduced into HIV-1, and we established that this mutant virus was unable to productively infect human T-lymphoid cells in culture and to support expression of viral antigens. MATERIAILS AND METHODS Cloning and expression of wild-type and mutant integrase proteins. Cloning of the wild-type HIV-1 integrase (from the HXB2 virus molecular clone) into the T7 expression vector pET3C (22), yielding the expression vector pT7In5, has been described previously (18). Mutation of the integrase gene was achieved by cloning the gene into pGEM3Zf(-) (Promega, Madison, Wis.) and by using the resulting plasmid as the template for phagemid mutagenesis according to the protocols described by the manufacturer. The mutated integrase genes were then cloned back into pET3C and introduced into Escherichia coli BL21DE3 for expression. Expression was induced by isopropyl-o-D-thiogalactopyranoside (IPTG). Cells were then pelleted, lysed by passage through a Stanstedt press, and purified according to the procedure of Sherman and Fyfe (26). Integrase cleavage and strand transfer assays. The cleavage and strand transfer reactions were performed as previously described (18). A 20-base oligonucleotide (5'TGTGGAA AATCTCTAGCAGT3') representing the positive strand of the viral U5-LTR terminus served as the substrate for the cleavage assay. An 18-base oligonucleotide (5'TGTGGA AAATCTCTAGCA3'), lacking two nucleotides at the 3' end, served as the precleaved substrate for the strand transfer assay. Both oligonucleotides were 5' end labelled with [32PJATP by polynucleotide kinase, and both were annealed to a threefold excess of the complementary-strand oligonucleotide (5'ACTGCTAGAGAlTTTCCACA3'). The reaction products of the cleavage and strand transfer reactions were analyzed by electrophoresis in 20% acrylamide7.0 M urea sequencing gels. Preparation of mutant provirus. The infectious NL4-3 HIV-1 provirus (1), cloned as plasmid pwtN2-6, was used (15). A PstI-NdeI subclone in pGEM5Zf(-) was used as the substrate for phagemid mutagenesis. The oligonucleotide used for mutagenesis was 5'C`7ITATJJ7CATAGATI2.QA TCTACTCCTTGAC3'. The underlined nucleotides represent the changes responsible for the Asp and Gln substitutions at integrase residue positions 151 and 152. The resulting plasmid, containing both mutations, was then digested with PstI and NdeI. The appropriate fragment was gel purified and ligated into an NL4-3 SphI-EcoRI subclone that had also been digested with PstI and NdeI. The SphI-EcoRI fragment carrying the mutations was subsequently introduced into pwtN2-6 that had been digested with SphI and EcoRI. DNA sequence analysis confirmed that the only differences between the integrase coding regions of the mutant and wild-type proviruses were the two introduced mutations. Proviral transfection and analysis of mutant virus. A 10-,ug sample of proviral plasmid DNA was introduced into 70% confluent monolayers of HeLa cells in 100-mm-diameter

7415

culture plates by standard calcium phosphate precipitation techniques as described elsewhere (19). The cells were cultured in Dulbecco's minimal essential medium (GIBCO, Grand Island, N.Y.) with 10% fetal bovine serum at 37°C in a 5.0% CO2 atmosphere. Four hours following transfection, the cells were washed and treated with 15% glycerol in Dulbecco's minimal essential medium and were fed with fresh culture medium. The transfected cells were examined for production of viral proteins 48 to 72 h later by HIV-1specific immunofluorescence. At 72 h, the medium from the transfected cultures was harvested and, following dilution in RPMI 1640 (Whittaker Bioproducts, Walkersville, Md.), was used to infect MT-4 human T-lymphoid cells. These cells were incubated at 37°C, 5.0% CO2, in medium composed of RPMI 1640 containing 10% fetal bovine serum. At 48 h postinfection, the medium containing the inoculum virus was removed and the MT-4 cells were fed with fresh medium. Progeny virus production was assessed by testing the culture medium for viral p24 core antigen with a commercial assay kit (Coulter Immunology, Hialeah, Fla.). Virus spread in the culture was assessed by specific immunofluorescence of cells with serum from an HIV-1-infected human as described previously (15). Viral DNAs from MT-4 cells infected with both wild-type and mutant virus were obtained by harvesting the cells 24 h after infection and isolating total DNA. The DNA was treated with RNase, extracted again with phenol-chloroform-isoamyl alcohol, and precipitated with ethanol. The DNA was resuspended, and equal amounts from each of the infected as well as mock-infected MT-4 cell cultures were subjected to amplification by the polymerase chain reaction (PCR). PCR analysis for detection of the viral-LTR circle junctions was performed with primers 5'CAGCTGTAG ATC`I`TAGCCAC3' and 5'GTCGAGATCTCCTCTGGC3'. The identities of the circle junctions were confirmed by hybridization to a riboprobe containing the viral transactivation response element. A second set of PCR primers (5'AA GAGTGAATCAGAGTTAGTCAGTC3' and 5'CTAGTGG GATGTGTACFTCTGAAC3') was used to amplify the integrase-coding region. This amplified DNA was hybridized with a riboprobe made from the PstI-NdeI subclone described above to confirm its identity. RESULTS The amino acid sequence of the HIV-1 integrase was compared with the primary sequences of other retroviral integrase proteins. Residues that are possibly essential for integrase function were identified by noting patterns of conservation. Two patterns were of particular interest. The first was an amino-terminal putative zinc finger motif composed of two His and two Cys residues at positions 12, 16, 40, and 43, respectively. The second was the so-called D,D(35)E motif described by Kahn et al. and Kulkosky et al. (12, 16). This motif is characterized by two conserved Asp residues at positions 64 and 121 and a conserved Glu residue at position 152. It has been suggested that these residues play a role in DNA binding and/or cleavage. We introduced a number of amino acid substitutions into both conserved patterns of recombinantly expressed integrase (Fig. 1). Some of the resulting mutant proteins were poorly expressed by bacteria, whereas others did not partition in the particulate fraction upon lysis, compared with the wild-type protein (results not shown). These mutant proteins were not studied further. We reasoned that any observed change in integrase function would simply reflect improper

7416

LAFEMINA ET AL. 1

J. VIROL.

FLDGIDKAQD EHEKYHSNWR AMASDFNLPP

Q 31

2ES

C

A

VVAKEIVASC DKCQLKGEAM HGQVDCSPGI S

U5LTR-PC

U5LTR

Q

S

61

WQLDCTHLEG KVILVAVHVA SGYIEAEVIP T T2 y

91

AETGQETAYF LLKLAGRWPV KTIHTDNGSN

_

EOA

121

FTGATVRAAC WWAGIKQEFG IPYNPQSQGV

151

VESMNKELKK IIGQVRDQAE HLKTAVQMAV

20

Q 181

FIHNFKRKGG IGGYSAGERI VDIIATDIQT

211

KELQKQITKI QNFRVYYRDS RNPLWKGPAK YKAG

241

LLWKGEGAVV IQDNSDIKVV PRRKAKIIRD

271

YGKQMAGDDC VASRQDED

FIG. 1. Amino acid sequence of the HIV-1 HXB2 integrase. The single-letter amino acid code is used. All of the amino acid substitutions that were explored in our studies are noted beneath the complete sequence. Multiple substitutions are underlined. The substitutions at residue 43 and at residues 151 and 152, which were characterized in detail, are represented in boldface type.

folding of the mutant integrase and would not reflect specific functional differences between the wild-type and substituted enzymes. In any case, two mutant proteins were expressed to levels comparable to those of wild-type integrase, and they were able to be purified comparably to wild-type integrase as well (data not shown). One mutant contained a Ser substitution for the Cys residue at position 43 within the zinc finger motif. The second mutant contained an Asp and Gln double substitution for the Val and Glu residues at positions 151 and 152. These substitutions altered the carboxy-terminal end of the D,D(35)E motif. The Asp residue was introduced into the mutant so as to maintain the substituted region's overall charge. The phenotypes of both mutant enzymes were established for the in vitro cleavage and strand transfer (integration) reactions. The results are presented in Fig. 2. The substitution of Ser for Cys at position 43 resulted in an enzyme that was competent for both cleavage and integration but that yielded a substantially reduced quantity of the two-nucleotide-shortened cleavage product compared with the yield of the product produced by the wild-type integrase. However, when presented with the precleaved oligonucleotide substrate, the mutant protein was as active as the wild-type enzyme in its mediation of the integration reaction. By contrast, the D,D(35)E motif mutant exhibited no activity for specific or nonspecific cleavage (Fig. 2). The use of precleaved substrate (18 nucleotides with a 3' terminal CA) did not result in strand transfer to yield a 36-nucleotide product or any other strand transfer products. Thus, this mutated integrase was inactive for both its endonuclease function and its integration function. Given this result, we attempted to assess the requirement of active integrase for productive HIV-1 infection by introducing the identical D,D(35)E motif double mutation into an infectious provirus. The wild-type and mutant proviruses were transfected into HeLa cells. These cells exhibited a significant level of production of viral proteins. At 48 to 72 h posttransfection, greater than 10% of the cells stained positive for HIV-1-specific immunofluorescence. Wild-type and mutant viruses harvested at this time were used to infect

1

2

_~~~~~~~~~~~ , 3

4

5

B

-4 18

JEI1

2

3

4

5

D

20 ..

I18

10

_

-4

18

1 2 3 4 5 1 2 3 4 5 FIG. 2. Cleavage and integration analyses of wild-type and amino acid-substituted integrase proteins. The assay is described in detail in Materials and Methods. The 20-base U5-LTR oligonucleotide substrate (A and B) and the 18-base precleaved U5-LTR-PC substrate (C and D) were used. Panels A and C are overexposures showing integration products within the lanes of panels B and D, respectively. The latter panels depict the reaction cleavage products. The locations of the 20- and 18-nucleotide species are indicated. In panel B, the 18-nucleotide species is the product of the specific terminal-dinucleotide cleavage of the 20-nucleotide substrate. The strand transfer (integration) products are bracketed. Lanes: 1, oligonucleotide substrate alone; 2, substrate incubated with nonexpressing E. coli extract; 3, substrate incubated with position 43-substituted integrase; 4, substrate incubated with wildtype integrase; 5, substrate incubated with positions 151- and 152-substituted integrase.

MT-4 human T-lymphoid cells. This cell line is particularly sensitive to infection by HIV-1. Infection was monitored by viral p24 core antigen production and by specific immunofluorescence. As shown in Fig. 3, infection of the MT-4 cells by wild-type virus resulted in rapid spread of the infection through the culture. The medium contained greater than 500 ng of viral p24 antigen per ml by 5 days postinfection. The culture had totally succumbed to virus-mediated cytopathic effect by 7 days. Cells infected with mutant virus, however, did not express virus-specific immunofluorescence, did not yield virus, and remained healthy during the 35-day observation period. We demonstrated that the lack of productive virus infection exhibited by the mutant virus was due only to the lack of active integrase. Following removal of the culture supernatant from the transfected cells for MT-4 cell infection, the transfected cells were fed with serum-free culture medium. Following an additional 24 h of incubation, the medium was removed and concentrated and the viral proteins were visualized by Western blotting (Fig. 4A). The blot exhibited

VOL. 66, 1992

INTEGRASE REQUIREMENT FOR HIV-1 INFECTIVITY

1u0.

obtained from the mutant virus-infected cells was found to contain the expected double mutation (data not shown).

90

z 80U

5

70 60 40

U

30_ 20

10 0 oC_

es en 'W uz D N GO O CD

N en

LO

urDN X0 a,

O

N

£sYc -ES sN e 4 cne ensrun c 4ee

DAYS POST INFECTION

FIG. 3. Spread of virus infection in MT-4 T-lymphoid cells as assessed by specific immunofluorescence. Cells were infected with virus produced by transfected HeLa cells (see text). *, wild-type virus; *, integrase mutant virus.

identical patterns of mature viral proteins and polyprotein precursors for both the wild-type and the mutant viruses. Hence, protein processing by the viral protease and the production of the mature viral enzymes were not impeded by the mutations in the integrase-coding region. We also demonstrated that the mutant virus maintained an active reverse transcriptase activity. DNA recovered by PCR from MT-4 cells that had been infected either with mutant or with wild-type virus was found to contain viralDNA circle junction fragments that are indicative of reverse transcriptase function (Fig. 4B). The integrase-coding regions of both viruses were also recovered by PCR from the infected MT-4 cells and, by sequencing, the coding region

A

B M

-

97

-

69

"A'C A

,-I*

.

I 1

C

Moo.

p55

p24

7417

-

-

46

-

30

9

14

_

--

1

2

3

FIG. 4. (A) Western blot analysis of expressed virus collected from the culture medium of HeLa cells 72 h posttransfection. Virus was harvested and processed, and the viral proteins were blotted as described previously (15). The immunoreactive proteins are noted by their sizes relative to molecular weight markers (M). The presence of the p24 protein indicated proper processing by the viral protease. Lanes: 1, integrase mutant virus; 2, wild-type virus; 3, HIV-1 viral-protein standards. (B) PCR analysis for detection of the viral LTR circle junctions. MT-4 cells were infected, at a high multiplicity of infection, with expressed virus from the HeLa cell transfection. DNA was extracted and subjected to PCR amplification as described in Materials and Methods. Input DNA was 1, 3, or 10 ,ug. The DNA was prepared from integrase mutant virus-infected cells (IN-), mock-infected cells, and wild-type virus-infected cells (WT). Product DNA was processed by electrophoresis in a 1.2% agarose gel, transferred to a nylon membrane, and hybridized with a riboprobe containing the HIV-1 transactivation response sequence. Lane C, LTR circle junction PCR marker product.

DISCUSSION Successful chemotherapeutic treatment of HIV-1 infection will eventually involve the use of combination therapies directed against a number of distinct viral targets. One such possible target is the viral integrase enzyme which mediates the integration of the HIV-1 DNA provirus into the host cell genome. However, the absolute requirement of integration for productive HIV-1 infection has not yet been unequivocally established. Analogies with other retroviruses cannot easily be made. Integrase-defective mutants of Moloney murine leukemia virus and of Rous sarcoma virus that are totally defective for virus replication have been reported elsewhere (7, 11, 24). In contrast, integration-defective mutants of spleen necrosis virus can still undergo productive virus infection, albeit at less efficiency than that of wild-type virus (20). Studies by Harris et al. (10) suggest that, in cell culture, the visna lentivirus can produce progeny virus from unintegrated extrachromosomal viral DNA. Similarly, Prakash et al. (21) introduced deletions into the integrasecoding region of the related simian immunodeficiency virus and also demonstrated that the unintegrated viral DNA mediates the efficient production of virus. However, Stevenson et al. (27), also using deletion mutants, showed that lack of HIV-1 provirus integration results in the absence of viable progeny virus production but not in a lack of virus antigen elaboration. These contrasting results have led us to independently investigate the requirement of the HIV-1 integrase for the virus reproductive cycle. We and others (9, lla, 12, 14, 23, 23a) compared the available sequences of retroviral integrase proteins and of related retrotransposases. Specific amino acid substitutions, mediated by point mutations, were introduced at a number of conserved residue positions and motifs. Two of the recombinant mutant integrases were able to be purified in a manner identical to that of the wild-type enzyme, and both exhibited a defect in enzyme activity. The first mutant contained a Ser residue substituted for Cys at position 43. This mutant enzyme had an apparently reduced ability to mediate the specific removal of the terminal dinucleotide from the U5-LTR substrate. However, overall endonucleolytic function was not reduced, and the enzyme was fully capable of mediating the integration reaction. The substitution was introduced into a putative zinc finger motif and the mutant enzyme's phenotype suggests that this motif plays a role in the specificity of the enzyme's interaction with the proviral terminus. The second mutant contained two substitutions: an Aspfor-Val residue at position 151 to maintain the proper local charge and a Gln-for-Glu residue at position 152. This mutant enzyme exhibited no specific or nonspecific endonuclease activity and was incapable of mediating the strand transfer reaction. The substitutions are within the so-called D,D(35)E motif that was first described by Kahn et al. (12) as possibly participating in the enzyme's interaction with substrate DNA. We have not established whether the mutant enzyme is indeed altered in its ability to bind DNA or whether it is deficient solely in the DNA cleavage reaction, and we have not tested the effects of separate substitutions at position 151 or 152. Recent studies reported after the completion of our experiments also implicate the D,D(35)E motif in the enzyme's cleavage activity (7a, 16). The identical substitutions within this motif were intro-

7418

LAFEMINA ET AL.

duced into an infectious HIV-1 provirus. Mutant virions, produced upon transfection of the altered provirus, were found to be incapable of establishing productive infection of highly susceptible MT-4 human T-lymphoid cells. The mutant virions expressed active protease and reverse transcriptase activities. Functional in vitro analyses of the recombinant mutant integrase enzyme strongly suggest that the mutant virus was deficient in integrase activity. We confirmed the presence of the mutant integrase-coding region in viral-DNA reverse transcripts from cells infected with the mutant. The lack of progeny virus production was accompanied by a complete lack of virus antigen production. This latter observation is in contrast to that of Stevenson et al. (27) discussed previously. However, this discrepancy cannot be reconciled at present. In conclusion, it seems that inhibition of the integrase enzyme through use of specific chemical inhibitors would result in the inhibition of HIV-1 productive infection. Of course, our studies were limited to an assessment of mutant HIV-1 infection of cultured T-lymphoid cells. This system only begins.to approximate the extreme complexity of HIV-1 infection in vivo. Experiments are planned to expand our assessment of integrase requirements to infection of primary monocytes, macrophages, and T-lymphocytes (2, 31). Nonetheless, the present results provide initial support for an active endeavor to discover and develop inhibitors of the HIV-1 integrase. ACKNOWLEDGMENTS We thank Jon Condra and Michael Cordingley for helpful discussions. We also thank Dolores Wilson for manuscript preparation.

REFERENCES 1. Adachi, A., H. E. Gendelman, S. Koenig, T. Folks, R. Willey, A. Rabson, and M. A. Martin. 1986. Production of acquired immu-

nodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J. Virol. 59:284-291. 2. Bukrinsky, M. I., T. L. Stanwick, M. P. Dempsey, and M. Stevenson. 1991. Quiescent T lymphocytes as an inducible virus reservoir in HIV-1 infection. Science 254:423-427. 3. Burke, C. J., G. Sanyal, M. W. Bruner, J. A. Ryan, R. L.

LaFemina, H. L. Robbins, A. S. Zeft, C. R. Middaugh, and M. C. Cordingley. 1992. Structural implications of spectroscopic characterization of a putative zinc finger peptide from HIV-1 integrase. J. Biol. Chem. 267:9639-9644. 4. Bushman, F. D., and R. Craigie. 1991. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc. Natl. Acad. Sci. USA 88:1339-1343. 5. Bushman, F. D., T. Fujiwara, and R. Craigie. 1990. Retroviral DNA integration directed by HIV integration protein in vitro. Science 249:1555-1558. 6. Chow, S. A., K. A. Vincent, V. Ellison, and P. 0. Brown. 1992. Reversal of integration and DNA splicing mediated by integrase of human immunodeficiency virus. Science 255:723-726. 6a.Craigie, R., T. Fujiwara, and F. Bushman. 1990. The IN protein of Moloney murine leukemia virus processes the viral DNA ends and accomplishes their integration in vitro. Cell 62:829837. 7. Donehower, L. A., and H. E. Varmus. 1984. A mutant murine leukemia virus with a single missense codon in pol is defective in a function affecting integration. Proc. Natl. Acad. Sci. USA 81:6461-6465. 7a.Drelich, M., R. Wilhelm, and J. Mous. 1992. Identification of amino acid residues critical for endonuclease and integration activities of HIV-1 IN protein in vitro. Virology 188:459-468. 8. Engelman, A., K. Mizuuchi, and R. Craigie. 1991. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand

J. VIROL. transfer. Cell 67:1211-1221. 9. Fayet, O., P. Ramond, P. Polard, M. F. Prere, and M. Chandler. 1990. Functional similarities between retroviruses and the IS3 family of bacterial insertion sequences? Mol. Microbiol. 4:17711777. 10. Harris, J. D., H. Blum, J. Scott, B. Traynor, P. Ventura, and A. Haase. 1984. Slow virus visna: reproduction in vitro of virus from extrachromosomal DNA. Proc. Natl. Acad. Sci. USA

81:7212-7215. 11. Hippenmeyer, P. J., and D. P. Grandgenett. 1984. Requirement of the avian retrovirus pp32 DNA binding protein domain for replication. Virology 137:358-370. 11a.Johnson, M. S., M. A. McClure, D.-F. Feng, J. Gray, and R. F. Doolittle. 1986. Computer analysis of retroviral pol genes: assignment of enzymatic functions to specific sequences and homologies with nonviral enzymes. Proc. Natl. Acad. Sci. USA 83:7648-7652. 12. Kahn, E., J. P. G. Mack, R. A. Katz, J. Kulkosky, and A. M. Skalka. 1991. Retroviral integrase domains: DNA binding and the recognition of LTR sequences. Nucleic Acids Res. 19:851860. 13. Katz, R. A., G. Merkel, J. Kulkosky, J. Leis, and A. M. Skalka. 1990. The avian retroviral IN protein is both necessary and sufficient for integrative recombination in vitro. Cell 63:87-95. 13a.Katzman, M., R. A. Katz, A. M. Skalka, and J. Leis. 1989. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J. Virol. 63:5319-5327. 14. Katzman, M., J. P. G. Mack, A. M. Skalka, and J. Leis. 1991. A covalent complex between retroviral integrase and nicked substrate DNA. Proc. Natl. Acad. Sci. USA 88:4695-4699. 15. Kohl, N. E., E. A. Emini, W. A. Schleif, L. J. Davis, J. C. Heimbach, R. A. F. Dixon, E. M. Scolnick, and I. S. Sigal. 1988. Active human immunodeficiency virus protease is required for viral infectivity. Proc. Natl. Acad. Sci. USA 85:4686-4690. 16. Kulkosky, J., K. S. Jones, R. A. Katz, J. P. G. Mack, and A. M. Skalka. 1992. Residues critical for retroviral integrative recombination in a region that is highly conserved among retroviralV retrotransposon integrases and bacterial insertion sequence transposases. Mol. Cell. Biol. 12:2331-2338. 17. Kulkosky, J., and A. M. Skalka. 1990. HIV DNA integration: observations and inferences. J. Acquired Immune Defic. Syndr. 3:839-851. 18. LaFemina, R. L., P. L. Callahan, and M. G. Cordingley. 1991. Substrate specificity of recombinant human immunodeficiency virus integrase protein. J. Virol. 65:5624-5630. 19. O'Hare, P., and G. S. Hayward. 1984. Expression of recombinant genes containing herpes simplex virus delayed-early and immediate-early regulatory regions and trans activation by herpesvirus infection. J. Virol. 52:522-531. 20. Panganiban, A. T., and H. M. Temin. 1983. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature (London) 306:155-160. 21. Prakash, K., P. N. Ranganathan, R Mettus, P. Reddy, A. Spinivasan, and S. Plotkin. 1992. Generation of deletion mutants of simian immunodeficiency virus incapable of proviral integration. J. Virol. 66:167-171. 22. Rosenberg, A. H., B. N. Lade, D.-S. Chui, S.-W. Lin, J. J. Dunn, and F. W. Studier. 1987. Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene 6:125-135. 23. Roth, M. J., P. Schwartzberg, N. Tanese, and S. P. Goff. 1990. Analysis of mutations in the integration function of Moloney murine leukemia virus: effects on DNA binding and cutting. J. Virol. 64:4709-4717. 23a.Rowland, S. J., and K. G. H. Dyke. 1990. Tn552, a novel transposable element from Staphylococcus aureus. Mol. Microbiol. 4:961-975. 24. Schwartzberg, P., J. Colicelli, and S. P. Goff. 1984. Construction and analysis of deletion mutations in the pol gene of Moloney murine leukemia virus: a new viral function required for productive infection. Cell 37:1043-1052. 25. Sherman, P. A., M. L. Dickson, and J. A. Fyfe. 1992. Human immunodeficiency virus type 1 integration protein: DNA se-

VOL. 66, 1992

INTEGRASE REQUIREMENT FOR HIV-1 INFECITIVITY

requirements for cleaving and joining reactions. J. Virol. 66:3593-3601. 26. Sherman, P. A., and J. A. Fyfe. 1990. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc. Natl. Acad. Sci. USA 87:5119-5123. 27. Stevenson, M., S. Haggerty, C. A. Lamonica, C. M. Meier, S.-K. Welch, and A. J. Wasiak 1990. Integration is not necessary for expression of human immunodeficiency virus type 1 protein products. J. Virol. 64:2421-2425. 28. van Gent, D. C., Y. Elgersma, M. W. J. Bolk, C. Vink, and R. H. A. Plasterk 1991. DNA binding properties of the integrase proteins of human immunodeficiency viruses types 1 and 2. Nucleic Acids Res. 19:3821-3827. quence

7419

29. Vink, C., D. C. van Gent, Y. Elgersma, and R. H. A. Plasterk. 1991. Human immunodeficiency virus integrase protein requires a subterminal position of its viral DNA recognition sequence for efficient cleavage. J. Virol. 65:4636-4644. 30. Vink, C., E. Yeheskiely, G. A. van der Marel, J. H. van Boom, and R. H. A. Plasterk. 1991. Site-specific hydrolysis and alcoholysis of human immunodeficiency virus DNA termini mediated by the viral integrase protein. Nucleic Acids Res. 19:66916698. 31. Weinberg, J. B., T. J. Matthews, B. R. Cullen, and M. H. Malim. 1991. Productive human immunodeficiency virus type 1 (HIV-1) infection of nonproliferating human monocytes. J. Exp. Med. 174:1477-1482.