Surg Endosc (2013) 27:1310–1314 DOI 10.1007/s00464-012-2603-y
and Other Interventional Techniques
Resistin expression correlates with steatohepatitis in morbidly obese patients Claire R. Edwards • A. Katharine Hindle Patricia S. Latham • Sidney W. Fu • Fred J. Brody
•
Received: 19 August 2012 / Accepted: 17 September 2012 / Published online: 12 December 2012 Ó Springer Science+Business Media New York 2012
Abstract Background Morbidly obese patients are at risk for nonalcoholic steatohepatitis (NASH) even in the absence of risk factors for liver disease. Unfortunately, NASH is usually not clinically evident, and a definitive, noninvasive test for NASH does not exist. Resistin, a cytokine originating from adipose tissue, is involved in insulin resistance and also initiates proinflammatory signaling from hepatic stellate cells. This study explores the relationship between resistin expression and liver pathology in bariatric surgery patients. Methods Blood samples from 30 patients undergoing bariatric surgery were collected. Total RNA was extracted and cDNA was synthesized. Quantitative RT-PCR was used to quantify relative gene expression using 18s rRNA gene as an internal control. Wedge liver biopsies from these patients were sectioned and stained. Based on a
previously published scoring method, biopsies were assigned an overall NASH severity score and subscores for steatosis, inflammation, and fibrosis. Results were analyzed by using Student’s t test. Results Resistin mRNA levels ranged from 0.5 to 9.7. A group of five patients with very high resistin expression ([4) was identified. These patients had a significantly higher average NASH score compared with the rest of the group (7.9 vs. 4.48, p = 0.019). Steatosis and inflammation scores were significantly higher in the high-resistin group (p \ 0.05 for both comparisons). There also was a trend toward higher fibrosis score in this group, which approached statistical significance (p = 0.051). Conclusions In morbidly obese patients, high resistin expression in serum is associated with hepatic steatosis, inflammation, and fibrosis. The development of elevated resistin expression may represent a link between obesity and the onset of steatohepatitis.
Funded by grants from the SAGES Foundation and a McCormick Center Genomics Pilot Grant.
Keywords Bariatric surgery Nonalcoholic steatohepatitis Genomics Resistin Adipokines
C. R. Edwards A. K. Hindle F. J. Brody (&) Department of Surgery, The George Washington University Medical Center, 2150 Pennsylvania Ave., NW, Suite 6B, Washington, DC 20037, USA e-mail:
[email protected] C. R. Edwards e-mail:
[email protected] P. S. Latham Department of Pathology, The George Washington University Medical Center, Washington, DC, USA S. W. Fu F. J. Brody Department of Molecular Biology and Biochemistry, The George Washington University Medical Center, Washington, DC, USA
123
Nonalcoholic steatohepatitis (NASH) is associated with progressive fatty and inflammatory changes of the liver parenchyma [1]. Approximately 33 % of patients with NASH will progress to cirrhosis within 10 years, and the disease is believed to account for up to 10 % of liver transplants [2]. Morbidly obese patients are at a disproportionate risk, even in the absence of any other risk factors for liver disease. Furthermore, NASH may be the hepatic manifestation of the metabolic syndrome. Unfortunately, NASH is usually not clinically evident, because the majority of patients diagnosed with NASH do not have any physical signs or laboratory abnormalities. A further
Surg Endosc (2013) 27:1310–1314
challenge is that a definitive, noninvasive test for NASH does not exist. Currently, the most accurate test for NASH is an invasive liver biopsy [3]. Many noninvasive tests for NASH have been developed, but so far none has proven to be sensitive or specific [2, 4, 5]. The role of adipose tissue in hormone signaling to regulate metabolic processes is increasingly evident. Resistin, a cytokine that originates from adipose tissue, is involved in insulin resistance. Because resistin promotes insulin resistance in mouse models of obesity, resistin may represent a link between obesity and type 2 diabetes. Previous data have demonstrated that resistin levels decrease in peripheral blood after bariatric surgery [6]. However, resistin also is involved in proinflammatory signaling within the liver via hepatic stellate cells. Therefore, resistin may be involved in the development of NASH in morbidly obese patients. This study explores the relationship between resistin expression and liver pathology in bariatric surgery patients.
Materials and methods Patient recruitment and clinical information This study was approved by the George Washington University Institutional Review Board (IRB #070701). A total of 30 consecutive patients referred to the George Washington University Medical Center for bariatric surgery were recruited. All patients were morbidly obese as defined by the 1991 NIH consensus guidelines with a body mass index (BMI) greater than 40 or a BMI greater than 35 with at least one obesity-related comorbidity. Demographic data (including weight, height, and BMI) and laboratory results were obtained by review of patient charts. Blood samples were drawn immediately before the patient’s operation. All patients underwent laparoscopic bariatric surgery with a Roux-en-Y gastric bypass (RYGB), a sleeve gastrectomy, or an adjustable gastric band. During each surgical procedure, a wedge biopsy of liver was obtained and placed in formalin for pathologic analysis.
1311
Synthesis of cDNA cDNA was synthesized from RNA using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA). Each reaction contained 200 ng of total RNA, 4 ll of 5X iScript Reaction Mix, 1 ll iScript Reverse Transcriptase, and nuclease-free water to a reaction volume of 20 ll and was incubated at 25 °C for 5 min, 42 °C for 30 min, and 85 °C for 5 min. Then, cDNA was stored at -20 °C. Real-time PCR analysis Real-time quantitative PCR was used to quantify relative gene expression of resistin (primer sequence: forward: cgcctgtggctcgtgggatg, reverse: cgacctcagggctgcacacg). One microliter of each cDNA sample was mixed with 1 ll of 20 pM forward primer, 1 ll of 20 pM reverse primer, 12.5 ll of 2x SYBR Green reagent (SA Biosciences, Frederick, MD), and nuclease-free water to a total volume of 25 ll. Quantitative PCR was then performed by using an Applied Biosystems 7300 System (Applied Biosystems, Foster City, CA). Data were analyzed using the accompanying SDS 7700 software. Cycle threshold (Ct) was defined as the cycle number at which a significant increase in the fluorescence signal was first detected. A standard curve was generated using serial dilutions of cDNA. Quantity of unknown samples was calculated from Ct values using the standard curve. Relative expression of resistin was calculated for each sample by dividing the calculated quantity of the gene of interest by the calculated quantity of 18s ribosomal RNA for the same sample. Results were analyzed by using Student’s t test with a p \ 0.05 significance. Liver biopsy and scoring Wedge liver biopsies were sectioned and stained with hematoxylin/eosin and Picro stains. Biopsy slides were examined by one of the authors, an experienced liver pathologist. Slides were labeled only with a number, so that the pathologist was blinded to any patient characteristics or identity. Each slide was assigned an overall NASH severity score and subscores for steatosis, inflammation, and fibrosis. The scoring system (Table 1) was based on a previously published scoring method [7]. Results were analyzed by using Student’s t test.
RNA purification Blood samples were collected and incubated in PAXgene tubes (Preanalytix/Qiagen, Valencia, CA) to stabilize mRNA expression. Total RNA was isolated using the PAXgene Blood RNA kit according to the manufacturer’s instructions. RNA was then purified using the Qiagen RNeasy Mini kit cleanup procedure.
Results The patient population included 24 women and 6 men. Eight were diabetic, and 22 were nondiabetic. None of the morbidly obese patients had any clinical evidence of liver disease or abnormal liver function tests. On histologic
123
1312
Surg Endosc (2013) 27:1310–1314
Table 1 Scoring system for NASH severity Score
Fat
Inflammation (lobular)
Inflammation (portal)
Mallory bodies
Balloon degeneration
Fibrosis
Central vein fibrosis
0
None
Rare
Minimal
None
None
None
None
1
\5 %
\2 foci (at 20 X) in some lobules
Mild, \25 % of portal tracts overall
Rare (1–3)
Few
Mild, perisinusoidal at Zone 1, or Zone 3
Present
2
5–33 %
2-4 foci (at 20 X) in most lobules
Moderate to severe
Several
Many
Zone 3 fibrotic bridges, collapsed central vein in most lobules
–
3
33–66 % [4 foci (at 20X) in most lobules
–
Many
–
Bridging fibrosis
–
4
[66 %
–
–
–
Cirrhosis
–
Confluent areas of inflammation
Fig. 1 On histologic examination of intraoperative liver biopsies, NASH was found in a small number of asymptomatic obese patients undergoing bariatric surgery. A Intraoperative liver biopsy with H & E stain from obese patient shows normal liver. B Biopsy from a second obese patient shows steatosis, inflammation, and balloon
degeneration of hepatocytes. C Biopsy from same individual as in (A), now Picro stained to demonstrate collagen, shows normal amount of collagen, concentrated around portal triads. D Biopsy from same individual as (B) with Picro stain shows fibrotic bridges between hepatic lobules
examination, however, several patients showed evidence of NASH (Fig. 1). The highest NASH score assigned was 14, and the lowest was zero. Demographics were compared between morbidly obese patients with low NASH scores (0–5), middle NASH scores (5–10), and high NASH scores ([10). The groups did not significantly differ in terms of average BMI (47.3
vs. 51.3 vs. 49.7). However, patients with high NASH scores were significantly older, on average, than the rest of the group (57.5 years vs. 40.4 years, p = 0.02). Patients with high NASH scores also were more likely to have diabetes (50% vs. 25%, p = 0.02). Conversely, average NASH score among diabetic patients was higher than among nondiabetics (7.19 vs. 4.27, p \ 0.01).
123
Surg Endosc (2013) 27:1310–1314
Fig. 2 Patients with high resistin expression have higher overall NASH scores. A small group of patients with very high resistin expression was identified. Within this group of five patients, the average NASH score was significantly higher compared with the remainder of the group (7.9 vs. 4.48, p = 0.02), indicating worse histology
Severe NASH changes on histology correlated with a small group of patients with very high resistin expression ([4). Within this group of five patients, the average NASH score was significantly higher versus the remainder of the group (7.9 vs. 4.48, p = 0.019; Fig. 2). In addition, overall steatosis score was significantly higher within this group (2.6 vs. 1.56, p = 0.02; Fig. 3). Average scores for inflammation and fibrosis also were higher in the group of patients with elevated resistin expression. For inflammation, average score in the highresistin group was 2.2 vs. 1.14 for the low-resistin group (p = 0.029). For fibrosis, average score in the high-resistin group also was higher (1.9 vs. 1.18, p = 0.051). Conversely, patients with high NASH scores had higher resistin expression than the remainder of the group (5.63 vs. 2.23, p = 0.025). Patients with middle NASH scores had slightly higher resistin expression than patients with low NASH scores (2.32 vs. 2.16), but this trend was not statistically significant.
Discussion Obesity increases the risk of NASH, but the molecular mechanisms underlying this are unknown. Based on this study, elevated resistin expression may represent one of the links between obesity and the onset of steatohepatitis. Previous findings document that resistin appears to be pivotal in the development of insulin resistance in obesity. Resistin levels are increased in obese mice relative to normal weight animals, and administration of exogenous resistin to normal mice results in impaired glucose tolerance. Conversely, administrating antiresistin antibody increases insulin sensitivity in mice on a high-fat diet: these
1313
Fig. 3 Patients with high resistin expression have greater degrees of steatosis, inflammation, and fibrosis. Within the group of patients with high resistin expression, overall steatosis score was significantly higher (2.6 vs. 1.56, p = 0.02). Average scores for inflammation and fibrosis also were significantly higher. For inflammation, average score in the high-resistin group was 2.2 vs. 1.14 for the low-resistin group (p = 0.029). For fibrosis, average score in the high-resistin group also was higher (1.9 vs. 1.18, p = 0.051)
mice showed an improved trend in blood glucose level after an insulin injection. Moreover, resistin levels are modulated in vitro by antidiabetic thiazolidinedione drugs [8]. Insulin resistance is a key risk factor for NASH [9], and the presence of insulin resistance worsens liver fibrosis [10]. The results from this study support this finding by demonstrating that the average NASH score is higher in the presence of diabetes. Resistin, therefore, may worsen NASH indirectly by promoting insulin resistance. Evidence indicates, however, that resistin also plays a more direct role in the development of steatohepatitis. Pagano et al. [11] showed that resistin expression (measured in adipose tissue by RT-PCR) is increased in patients with biopsy-proven, nonalcoholic, fatty liver disease. This correlation is independent of traditional biochemical measurements of insulin resistance, including serum insulin and glucose levels. Moreover, obese resistin knock-out mice do not develop hepatic steatosis as readily as control mice with normal levels of resistin [12]. Fibrosis is required for cirrhosis to develop, and resistin seems to play a role in hepatic fibrogenesis. In studies of whole liver tissue, resistin staining was strongest in areas of inflammation and fibrosis. The staining localized to collagen and a-smooth muscle actin from active fibroblasts [10]. The development of fibrosis after liver injury requires activated hepatic stellate cells, which take on a myofibroblast-like phenotype and secrete extracellular matrix components. Resistin appears to directly activate stellate cells, as cultured stellate cells release pro-inflammatory cytokines (MCP-1 and IL-8) in the presence of resistin [10]. Whereas the exact molecular mechanism of this is unknown, resistin
123
1314
appears to act through binding to toll-like receptor 4 (TLR4), a cell-surface receptor and key component of the inflammatory response to bacterial lipopolysaccharide [13]. Interestingly, TLR4 is found on stellate cells and is involved in hepatic fibrogenesis [14, 15]. The correlation between serum levels of resistin and steatosis/NASH has been studied in several groups with mixed results. The majority of studies illustrate that serum resistin levels are higher in patients with hepatic steatosis compared with healthy controls [11, 16, 17]. However, some studies show a negative correlation [18] or no correlation [4] between serum resistin level and severity of steatohepatitis. Due to extensive posttranslational modification [19], however, serum assays for resistin may not be a precise reflection of hormone activity. Therefore, this study used the novel approach of quantifying mRNA directly to examine gene expression specifically. This technique may more accurately reflect resistin activity. Recent data document that bariatric surgery improves liver histology in terms of steatosis, inflammation, and fibrosis when pre- and postoperative liver biopsies are compared [20–22]. Although we do not have follow-up liver biopsies, our results show that average resistin expression significantly decreases after bariatric surgery [6]. The data presented demonstrate that resistin expression correlates with histological changes. Therefore, we believe that measurement of resistin expression may be used potentially as a noninvasive means not only to identify patients with NASH, but also for monitoring morbidly obese patients over time. Based on these current results, our patients will be followed for the next several years to ascertain future resistin levels. Acknowledgement Disclosures Drs. Claire R. Edwards, A. Katharine Hindle, Patricia S. Latham, Sidney W. Fu, and Fred J. Brody have no conflict of interest or financial ties to disclose.
References 1. Younossi ZM (2008) Review article: current management of nonalcoholic fatty liver disease and non-alcoholic steatohepatitis. Aliment Pharmacol Ther 28:2–12 2. Diehl AM (2010) Hepatic complications of obesity. Gastroenterol Clin N Am 39:57–68 3. Baranova A, Younossi ZM (2008) The future is around the corner: noninvasive diagnosis of progressive nonalcoholic steatohepatitis. Hepatology 47:373–375 4. Younossi ZM, Jarrar M, Nugent C, Randhawa M, Afendy M, Stepanova M, Rafiq N, Goodman Z, Chandhoke V, Baranova A (2008) A novel diagnostic biomarker panel for obesity-related nonalcoholic steatohepatitis (NASH). Obes Surg 18:1430–1437 5. Cheung O, Sanyal AJ (2010) Recent advances in nonalcoholic fatty liver disease. Curr 26:202–208
123
Surg Endosc (2013) 27:1310–1314 6. Edwards C, Hindle AK, Fu S, Brody F (2011) Downregulation of leptin and resistin expression in blood following bariatric surgery. Surg Endosc 25:1962–1968 7. Kleiner DE, Brunt EM, Van Natta M, Behling C, Contos MJ, Cummings OW, Ferrell LD, Liu Y-C, Torbenson MS, UnalpArida A, Yeh M, McCullough AJ, Sanyal AJ (2005) Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 41:1313–1321 8. Steppan CM, Bailey ST, Bhat S, Brown EJ, Banerjee RR, Wright CM, Patel HR, Ahima RS, Lazar MA (2001) The hormone resistin links obesity to diabetes. Nature 409:307–312 9. Marchesini G, Brizi M, Morselli-Labate AM, Bianchi G, Bugianesi E, McCullough AJ, Forlani G, Melchionda N (1999) Association of nonalcoholic fatty liver disease with insulin resistance. Am J Med 107:450–455 10. Bertolani C, Sancho-Bru P, Failli P, Bataller R, Aleffi S, DeFranco R, Mazzinghi B, Romagnani P, Milani S, Gines P, Colmenero J, Parola M, Gelmini S, Tarquini R, Laffi G, Pinzani M, Marra F (2006) Resistin as an intrahepatic cytokine: overexpression during chronic injury and induction of proinflammatory actions in hepatic stellate cells. Am J Pathol 169:2042–2053 11. Pagano C, Soardo G, Pilon C, Milocco C, Basan L, Milan G, Donnini D, Faggian D, Mussap M, Plebani M, Avellini C, Federspil G, Sechi LA, Vettor R (2006) Increased serum resistin in nonalcoholic fatty liver disease is related to liver disease severity and not to insulin resistance. J Clin Endocrinol Metab 91:1081–1086 12. Singhal NS, Patel RT, Qi Y, Lee Y-S, Ahima RS (2008) Loss of resistin ameliorates hyperlipidemia and hepatic steatosis in leptindeficient mice. Am J Physiol Endocrinol Metab 295:E331–E338 13. Tarkowski A, Bjersing J, Shestakov A, Bokarewa MI (2010) Resistin competes with lipopolysaccharide for binding to toll-like receptor 4. J Cell Mol Med 14:1419–1431 14. Pradere J-P, Troeger JS, Dapito DH, Mencin AA, Schwabe RF (2010) Toll-like receptor 4 and hepatic fibrogenesis. Semin Liver Dis 30:232–244 15. Testro AG, Visvanathan K (2009) Toll-like receptors and their role in gastrointestinal disease. J Gastroenterol Hepatol 24:943–954 16. Jiang L-L, Li L, Hong X-F, Li Y-M, Zhang B-L (2009) Patients with nonalcoholic fatty liver disease display increased serum resistin levels and decreased adiponectin levels. Eur J Gastroenterol Hepatol 21:662–666 17. Bajaj M, Suraamornkul S, Hardies LJ, Pratipanawatr T, DeFronzo RA (2004) Plasma resistin concentration, hepatic fat content, and hepatic and peripheral insulin resistance in pioglitazone-treated type II diabetic patients. Int J Obes Relat Metab Disord 28:783–789 18. Perseghin G, Lattuada G, De Cobelli F, Ntali G, Esposito A, Burska A, Belloni E, Canu T, Ragogna F, Scifo P, Del Maschio A, Luzi L (2006) Serum resistin and hepatic fat content in nondiabetic individuals. J Clin Endocrinol Metab 91:5122–5125 19. McTernan PG, Kusminski CM, Kumar S (2006) Resistin. Curr Opin Lipidol 17:170–175 20. Mattar SG, Velcu LM, Rabinovitz M, Barinas-Mitchell E, Eid GM, Ramanathan R, Taylor DS, Schauer PR (2005) Surgicallyinduced weight loss significantly improves nonalcoholic fatty liver disease and the metabolic syndrome. Ann Surg 242:610–617 discussion 618–620 21. Moschen AR, Molnar C, Wolf AM, Weiss H, Graziadei I, Kaser S, Ebenbichler CF, Stadlmann S, Moser PL, Tilg H (2009) Effects of weight loss induced by bariatric surgery on hepatic adipocytokine expression. J Hepatol 51:765–777 22. Kral JG, Thung SN, Biron S, Hould F-S, Lebel S, Marceau S, Simard S, Marceau P (2004) Effects of surgical treatment of the metabolic syndrome on liver fibrosis and cirrhosis. Surgery 135:48–58
