Rickettsial agents in Egyptian ticks collected from ... - Springer Link

Exp Appl Acarol (2006) 40:67–81 DOI 10.1007/s10493-006-9025-2

Rickettsial agents in Egyptian ticks collected from domestic animals Amanda D. Loftis Æ Will K. Reeves Æ Daniel E. Szumlas Æ Magda M. Abbassy Æ Ibrahim M. Helmy Æ John R. Moriarity Æ Gregory A. Dasch

Received: 12 April 2006 / Accepted: 6 August 2006 / Published online: 27 September 2006 Springer Science+Business Media B.V. 2006

Abstract To assess the presence of rickettsial pathogens in ticks from Egypt, we collected ticks from domestic and peridomestic animals between June 2002 and July 2003. DNA extracts from 1019 ticks were tested, using PCR and sequencing, for Anaplasma spp., Bartonella spp., Coxiella burnetii, Ehrlichia spp., and Rickettsia spp. Ticks included: 29 Argas persicus, 10 Hyalomma anatolicum anatolicum, 55 Hyalomma anatolicum excavatum, 174 Hyalomma dromedarii, 2 Hyalomma impeltatum, 3 Hyalomma marginatum rufipes, 55 unidentified nymphal Hyalomma, 625 Rhipicephalus (Boophilus) annulatus, 49 Rhipicephalus sanguineus, and 17 Rhipicephalus turanicus. Ticks were collected predominantly (>80%) from buffalo, cattle, and camels, with smaller numbers from chicken and rabbit sheds, sheep, foxes, a domestic dog, a hedgehog, and a black rat. We detected Anaplasma marginale, Coxiella burnetii, Rickettsia aeschlimannii, and four novel genotypes similar to: ‘‘Anaplasma platys,’’ Ehrlichia canis, Ehrlichia spp. reported from Asian ticks, and a Rickettsiales endosymbiont of Ixodes ricinus. Keywords Acari Æ PCR Æ Rickettsiales Æ Zoonotic diseases Æ Veterinary Æ Egypt

A. D. Loftis (&) Æ W. K. Reeves Æ J. R. Moriarity Æ G. A. Dasch Viral and Rickettsial Zoonoses Branch, Centers for Disease Control and Prevention, 1600 Clifton Rd., MS G-13, Atlanta, GA 30333, USA e-mail: [email protected] D. E. Szumlas Navy Disease Vector Ecology and Control Center, Box 43, NAS, Jacksonville, FL 3212-0043, USA M. M. Abbassy Æ I. M. Helmy Vector Biology Research Program, U.S. Naval Medical Research Unit No. 3, FPO, AE 09835-0007, USA

123

68

Exp Appl Acarol (2006) 40:67–81

Introduction Ixodid and argasid ticks, including Amblyomma spp., Argas persicus, Hyalomma spp., Ornithodoros spp., and Rhipicephalus spp., infest Egyptian animals. Camels are primarily infested by H. dromedarii, followed by H. impeltatum, H. anatolicum excavatum, and H. anatolicum anatolicum (Diab et al. 2001; El Kady 1998; El Kammah et al. 2001; Shoukry et al. 1993; Van Straten and Jongejan 1993). Rhipicephalus (Boophilus) annulatus is a common tick infesting cattle, followed by Hyalomma spp. Rhipicephalus and Hyalomma spp. infest sheep and goats (El Kammah et al. 2001; Mazyad and Khalaf 2002; Shoukry et al. 1993). Rhipicephalus sanguineus and R. turanicus infest dogs, and Argas persicus feeds on poultry (Amin and Madbouly 1973; El Kammah et al. 2001; Shoukry et al. 1993). Tick-transmitted pathogens have also been reported in Egypt, including Babesia and Theileria spp. (El Kady 1998; El Kammah et al. 2001; Mazyad and Khalaf 2002), relapsing fever Borrelia spp. (Helmy 2000; Shanbaky and Helmy 2000), and arboviruses (Awad et al. 1981; Moussa et al. 1974; Williams et al. 1973). There is evidence for the tick transmission of trypanosomes among Egyptian livestock (Morzaria et al. 1986). Serologic evidence indicates animals and people in Egypt are exposed to tick-borne rickettsial agents, including Coxiella burnetii, Ehrlichia canis, and spotted-fever group Rickettsia spp. (Botros et al. 1989, 1995; Corwin et al. 1993; McDade et al. 1973; Sixl et al. 1989), but few data are available regarding the presence of these agents in specific vectors. Coxiella burnetii was isolated from Egyptian ticks in the mid-twentieth century (Kaplan and Bertagna 1955). There is one report of a putative Anaplasma sp. in Egypt, identified solely on the basis of its microscopic appearance in tick midguts and hemolymph (El Kady 1998). Spottedfever group Rickettsia spp. were identified in R. sanguineus and Hyalomma spp. from the Sinai Peninsula using immunostaining and PCR (Lange et al. 1992). DNA from agents similar to ‘‘Anaplasma platys’’, A. phagocytophilum, and agents in the Ehrlichia canis genogroup was detected in ticks from Tunisia and Morocco (Sarih et al. 2005). To assess the presence and identity of tick-borne rickettsial agents in Egypt, we collected ticks from medium and large mammals, extracted DNA from the ticks, and tested the DNAs for Anaplasmataceae, Bartonella spp., Coxiella burnetii, Ehrlichia spp., and Rickettsia spp.

Materials and methods Mammal and tick collection Between June 2002 and July 2003, animals from 12 locations in Egypt (rural towns and oases, Fig. 1) were examined for ticks. All aspects involving animal use were conducted in accordance with the U.S. Animal Welfare Act (9 CFR, Subchapter A, Parts 1–3), Department of Defense regulations, and recognized standards for the care and use of laboratory animals (NAMRU-3 Animal Protocol Number 02-05). Animals were restrained, ticks were collected using forceps and pooled in ventilated tubes with a layer of damp gypsum in the bottom, and animals were released. Ticks were identified using the key by Hoogstraal and Kaiser (1958), sorted by species, and placed in 70% ethanol. Prior to DNA extraction, the species, life stage, gender of

123


69

Fig. 1 Map of Egypt showing the collection sites for ticks, June 2002–July 2003

adult ticks, and host animal for each tick were recorded. Voucher specimens were deposited in the U.S. National Tick Collection, Georgia Southern University, Statesboro, GA. DNA extraction and pooling strategy Extraction of DNA from individual adult ticks, or from pools of 1–3 nymphs from the same host animal, was performed as described by Moriarity et al. (2005); 50– 60 ll of eluted DNA was obtained from each sample. Ten microliter aliquots from each sample were combined to yield pools representing three DNAs each. All DNA samples were stored at 4C in sterile, nuclease-free polypropylene 96-well plates. Real-time PCR assays Pooled samples were tested for DNA from Anaplasma, Bartonella, Coxiella burnetii, Ehrlichia, and Rickettsia spp. using real-time PCR assays. The assays have sensitivities of ~10 gene copies per microliter of DNA extract (Jiang et al. 2004; Li et al. 2001; Loftis et al. 2006); the assay for the multicopy IS1111 element of Coxiella burnetii has a sensitivity of approximately one organism per microliter. Individual DNA samples from positive pools were then tested in duplicate using the same

123

70


assays. Primers and oligonucleotide probes for each assay are summarized in Table 1. Brilliant qPCR Core Reagents (Stratagene, La Jolla, CA) were used for probe-based assays. SYBR Green PCR Core Reagents (Applied Biosystems, Foster City, CA) were used for assays using SYBR Green dye, and melt curve analysis (45–95C) was performed after amplification to determine the melting temperature (Tm) of each product. Amplification and data analysis were performed using a 7900 HT thermocycler (Applied Biosystems, Foster City, CA) with the following amplification conditions: 95C for 10 min, followed by 40 cycles at 95C for 15 s and 60C for 60 s. Conventional PCR and RFLP Conventional PCR was used to confirm real-time PCR results and provide DNA fragments for sequencing. Individual DNA extracts that were positive using the realtime Anaplasma/Ehrlichia assay were tested using two conventional assays for the 16S rRNA gene [EC12a/HE3 (Anderson et al. 1992) and EHR16SR/EHR16SD (Parola et al. 2000)], a conventional assay for the msp5 gene of A. marginale (Shimada et al. 2004), and a nested assay for the P30 protein-coding gene of E. canis (Stich et al. 2002). A fragment of the gltA gene was amplified from a tick with a 16S rDNA sequence similar to A. platys using published primers (Inokuma et al. 2005). Extracts from R. sanguineus and R. turanicus were tested for the presence of Hepatozoon spp. using primers that amplify the 18S rRNA gene (Inokuma et al. 2002b). The superoxide dismutase gene and IS1111 transposable element of C. burnetii were amplified using previously described primers (Stein and Raoult 1992; Willems et al. 1994). DNA from Rickettsia spp. was detected using primers that amplify fragments of the 17 kD (Carl et al. 1990) and rOmpA antigenic genes (Roux et al. 1996). Sequencing and GenBank accession numbers PCR amplicons were sequenced as previously described (Loftis et al. 2006). Fragments were assembled with SeqMerge (Accelrys, San Diego, CA) and primer sequences were removed. The resulting sequences were compared with published sequences using Blast 2.0 (National Center for Biotechnology Information 2004). Sequences submitted to GenBank: A. marginale 16S rDNA #DQ379963 and msp5 #DQ379973, Rickettsiales genotype B 16S rDNA #DQ379964–65, Ehrlichia genotype C 16S rDNA #DQ379966–69, Ehrlichia genotype D 16S rDNA #DQ379970–71, Anaplasmataceae genotype E 16S rDNA #DQ379972 and gltA #D379974, C. burnetii sod #DQ379975 and IS1111 transposase #DQ379976, and R. aeschlimanii 17 kD #DQ379977–79 and rOmpA #DQ379980–82.

Results Tick collection Ticks were collected from 100 animals, including water buffalo (Bubalus arnee), camels (Camelus dromedarius), cattle (Bos taurus), a dog (Canis lupus), a long-eared hedgehog (Hemichinus auritus libycus), a black rat (Rattus rattus), sheep (Ovis

123

Primer name

a

1,600 800 200 800 800 100

ATGAATAAACAAGGKACNGGHACAC AAGTAATGCRCCTACACCTACTC TTGGTTCTCAATTCGGTAAGGGTAAAGG

600 800

TGCTTCGACATCCACTGTACGTC CACCTGCTGCAATACATGCAAATG CCGATCATTTGGGCGCT CGGCGGTGTTTAGGC TTAACACGCCAAGAAACGTATCGCTGTG

75 75

[oligo] (nM)

AACACATGCAAGTCGAACGG CCCCCGCAGGGATTATACA

Sequence of primer or probe (5¢–3¢)

Fluorescent oligonucleotide probe labeled with 5¢ FAM and a 3¢ fluorescence quencher (BHQ)

Anaplasma/Ehrlichia 16S rRNA gene SYBR EchSYBR-F EchSYBR-R Bartonella spp. gltA gene SYBR BARH-CIT-F BARH-CIT-R Coxiella burnetii IS1111 transposon Probe-based IS1111F IS1111R IS1111Pa Rickettsia spp. 17 kD antigenic gene Probe-based R17K135F R17K249R R17K-Ca

Assay type

Table 1 PCR primers and fluorescent probes used for real-time PCR testing of Egyptian ticks collected June 2002–July 2003

Jiang et al. (2004) Jiang et al. (2004) Loftis et al. (2006)

H. Thompson and R. Priestley (unpublished)

Loftis et al. (2006)

Li et al. (2001)

Reference

Exp Appl Acarol (2006) 40:67–81 71

123

72


aries), red foxes (Vulpes vulpes), and Ru¨ppel’s foxes (Vulpes rueppelli) (Table 2). In Siwa, ticks were also collected from chicken sheds, rabbit sheds, and the ground. The majority of the 1019 ticks were Rhipicephalus (Boophilus) annulatus (625 ticks, 61.3%) from 22 cattle, 3 buffalo, and 1 hedgehog. The second most common tick was H. dromedarii (174 ticks, 17.1%), predominantly from 25 camels and three cows. There were fewer than 60 ticks each of: A. persicus, H. anatolicum anatolicum, H. anatolicum excavatum, H. impeltatum, H. marginatum rufipes, unspeciated Hyalomma nymphs, R. sanguineus, and R. turanicus. Most of the ticks were collected in Alexandria and Siwa (Table 3).

Anaplasma/Ehrlichia spp. Using real-time PCR for the 16S rRNA gene, 35 ticks (3.4%) produced amplicons. The melting temperature (Tm) of the products ranged from 76.8C to 81.7C (Table 4). Of these ticks, 15 yielded amplicons using conventional PCR assays for the 16S rRNA gene. One tick also produced an amplicon for the msp5 gene of Anaplasma marginale. No amplicons were obtained using a nested assay for the P30 antigenic gene of E. canis. Five genotypes were identified by sequencing the 16S rDNA and msp5 amplicons (Table 4). Genotype A was identified as Anaplasma marginale, based on the 16S rRNA (57/ 58 bp similar to A. marginale, AJ633048) and the msp5 gene, which was 98% similar to A. marginale (449/457 bp, M93392) and had a predicted amino acid sequence identical to A. marginale. Anaplasma marginale was detected in two ticks removed from cattle (one H. anatolicum excavatum from Siwa and one R. annulatus from Wadi el Natroun), and the Tm of the real-time PCR products were 80.4–81.4C. Genotype B (Tm 78.8C and 79.5C), was identified in one pool of three Hyalomma spp. nymphs from a sheep and a H. anatolicum excavatum from a cow in Siwa. This genotype is not an Anaplasma or Ehrlichia but is a Rickettsiales bacterium with 98–99% similarity to symbionts described from I. ricinus from Italy (912/ 923 bp, AJ566640 (Beninati et al. 2004)) and Haemaphysalis wellingtoni from Thailand (868/889 bp, AF497582 (Parola et al. 2003)). These symbionts are not known to be pathogenic to vertebrates. The most similar agent that might be pathogenic to vertebrates is the ‘‘Montezuma’’ agent from eastern Russia (835/ 920 bp similar to AF493952) (Medyannikov et al. 2004). The remaining three genotypes were previously undescribed Anaplasmataceae. Genotype C was identified in H. anatolicum excavatum from cattle, Hyalomma spp. nymphs from a sheep, R. annulatus from a buffalo and from cattle, and R. sanguineus from a red fox. The partial sequence of the 16S rRNA gene was 98% similar to Ehrlichia canis and ‘‘Ehrlichia ovina’’ (729/739 bp, CP000107, AF318946), and the Tm for amplicons from Genotype C ranged from 78.0C to 78.8C. Genotype D (Tm 77.7C) was identified as part of a mixed ehrlichial infection in one tick and as a single infection in another tick; both ticks were collected from cattle. The partial sequence of the 16S rRNA gene from this genotype was 99% similar to uncultured ehrlichiae from Rhipicephalus (Boophilus) microplus from Tibet (732/737 bp, AF414399) (Wen et al. 2002) and Thailand (719/723 bp, AF497581) (Parola et al. 2003) and from Rhipicephalus muhsamae from Mali (711/718 bp, AF311967) (Parola et al. 2001). Genotype E (Tm 77.3C) was identified in one female R. annulatus from a cow; the partial 16S rRNA gene sequence was 99% similar to Ehrlichia sp.

123

b

a

145 – – – 145 – – – – – –

610 – 10 39 20 2 3 – 535 – 1

24 – – – – – – – – 24 –

7 – – 6 – – – – 1 – –

Ticks were collected from a chicken shed, two rabbit sheds, and the ground

Animal host species was not recorded

All tick species 94 Argas persicus – Hyalomma anatolicum anatolicum – Hyalomma anatolicum excavatum 5 Hyalomma dromedarii – Hyalomma impeltatum – Hyalomma marginatum rufipes – Hyalomma spp. (nymphs) – Rhipicephalus (Boophilus) annulatus 89 Rhipicephalus sanguineus – Rhipicephalus turanicus –

1 – – – – – – – – – 1

56 – – – – – – 55 – – 1

7 – – – – – – – – 7

32 – – – – – – – – 18 14

6 – – 5 1 – – – – – –

37 29 – – 8 – – – – – –

Buffalo Camel Cow Dog Hedgehog Black rat Sheep Ru¨ppel’s fox Red fox N/R Off host (n = 4) (n = 25) (n = 48) (n = 1) (n = 1) (n = 1) (n = 2) (n = 5) (n = 10) (n = 3) (n = 4)

b

Number of hosts

a

Number of ticks collected from each host species

Source of ticks: host species

Table 2 Summary of ticks collected in Egypt, June 2002–July 2003, by tick and animal host species

1,019 29 10 55 174 2 3 55 625 49 17

Sum

Exp Appl Acarol (2006) 40:67–81 73

123

123

a

47 – 7 – 4 2 – – – 19 15

4 – – – 4 – – – –

– –

– 1

5 – – – 1 – 3 – – – –

14 – – – – – – – 14

The collection site was not recorded for 1 Hyalomma dromedarii (not shown in table)

Sum: all tick species 627 Argas persicus – Hyalomma anatolicum anatolicum – Hyalomma anatolicum excavatum 6 Hyalomma dromedarii 76 Hyalomma impeltatum – Hyalomma marginatum rufipes – Hyalomma spp. (nymphs) – Rhipicephalus 545 (Boophilus) annulatus Rhipicephalus sanguineus – Rhipicephalus turanicus – – –

7 – – – 7 – – – – – –

15 – – – – – – – 15 6 –

6 – – – – – – – –

– 1

176 29 3 49 39 – – 55 –

– –

42 – – – 42 – – – –

24 –

72 – – – – – – – 48

– –

3 – – – – – – – 3

Alexandria Aswan El Kharga Oasis Ismailia Mansoura Matrouh Port Said Qara Siwa St. Catherine Wadi el Zagazig Natroun

Number of ticks collected from each sitea

Table 3 Summary of ticks collected in Egypt, June 2002–July 2003, by collection site

74 Exp Appl Acarol (2006) 40:67–81

Bahi el Din Dakror Dakror Siwa Siwa Siwa Siwa Bahig Bahig Bahig Bahig Bahig Bahig Bahig Bahig Bahig Bahig Bahig Bahig Bahig Bahig Bahig Bahig Bahig Bahig Bahig Bahig Bahig Bahig

Siwa Siwa Siwa Siwa Siwa Siwa Siwa Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria Alexandria

Hyalomma anatolicum excavatum

Rhipicephalus (Boophilus) annulatus

Hyalomma spp.

Collection locality

Collection governorate

Species of tick

16–20 Jun 2002 16–20 Jun 2002 16–20 Jun 2002 16–20 Jun 2002 16–20 Jun 2002 16–20 Jun 2002 16–20 Jun 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002 14 Nov 2002

Collection date Cow Cow Cow Cow Cow Sheep Sheep Buffalo Buffalo Buffalo Buffalo Buffalo Buffalo Cow Cow Cow Cow Cow Cow Cow Cow Cow Cow Cow Cow Cow Cow Cow Cow

Host species

36 31 31 23 23 18 18 243 243 245 245 245 245 247 247 248 248 248 248 248 248 249 249 249 249 249 251 252 253

Host ID #

1/F 1/F 1/F 1/M 1/M 2/NN 3/NN 1/F 1/F 1/F 1/F 1/F 1/F 1/F 1/F 1/F 1/F 1/F 1/F 1/F 1/F 1/F 1/F 1/F 1/F 1/F 1/F 1/F 1/F

#/Stagea

77.8 80.4 78.8 78.5 79.0 78.8 79.5 77.5 78.9 78.8 78.3 81.7 78.1 77.8 78.5 77.7 77.5 77.5 77.0 77.0 80.2 78.5 77.3 78.8 76.8 78.2 78.2 77.7 78.5

Tbm

Unknown A B C C+D C B Unknown Unknown C Unknown Unknown Unknown Unknown C D Unknown Unknown Unknown Unknown Unknown Unknown Unknown C Unknown C Unknown Unknown Unknown

Genotypec

Table 4 Summary of Egyptian ticks, collected June 2002–July 2003, positive for Anaplasma and/or Ehrlichia spp. DNA using a real-time PCR (SYBR) assay

Exp Appl Acarol (2006) 40:67–81 75

123

123

c

b

a

Collection locality Bahig Bahig Shirbeen Wadi el Natroun Wadi el Natroun Kharga camp

Collection governorate

Alexandria Alexandria Mansoura Wadi el Natroun Wadi el Natroun El Kharga Oasis

14 Nov 2002 14 Nov 2002 1–3 Dec 2002 13–15 Aug 2002 13–15 Aug 2002 Mar 2003

Collection date Cow Cow Cow Cow Cow Red fox

Host species

254 254 312 96 96 495

Host ID #

1/F 1/F 1/F 1/F 1/M 1/M

#/Stagea

77.3 78.9 78.2 81.4 81.4 78.0

Tbm

E Unknown C A Unknown C

Genotypec

Genotypes are based on sequencing of conventional PCR amplicons, when available, or are listed as ‘‘unknown’’ if conventional PCR was unsuccessful

PCR product melting temperature using the real-time PCR (SYBR) assay

F, Female; M, male; NN, nymphs

Rhipicephalus sanguineus

Species of tick

Table 4 continued

76 Exp Appl Acarol (2006) 40:67–81


77

‘‘Omatjenne’’ (729/734 bp, U54806) (Allsopp et al. 1997), Ehrlichia sp. ‘‘Bom Pastor’’ (729/734 bp, AF318023) (Bekker et al. 2001), and ‘‘Anaplasma platys’’ (727/ 734 bp, AF303467) (Inokuma et al. 2002a). A fragment of the gltA (citrate synthase) gene from Genotype E was 78% similar (299/384 bp) to ‘‘Anaplasma platys’’ (AY530807), and the predicted protein sequence was 92% similar to ‘‘Anaplasma platys’’. Sequences of the gltA genes from Ehrlichia spp. Omatjenne and Bom Pastor are not available. There were 20 ticks for which conventional PCR amplicons were not obtained, with Tm values ranging from 76.8C to 81.7C. The Tm values of three of these ticks were >80C, suggesting the presence of DNA from A. marginale or a closely related species; the Tm values of the remaining 17 ticks were compatible with Ehrlichia spp. or the Rickettsiales symbiont. Bartonella spp. and Hepatozoon spp. DNA from Bartonella spp. was not detected in any of the 1019 Egyptian ticks. DNA from Hepatozoon spp. was not detected in the 49 R. sanguineus or 17 R. turanicus; other ticks were not tested for Hepatozoon spp. Coxiella burnetii Using real-time PCR, DNA from C. burnetii was detected in 17/29 A. persicus from chicken and rabbit sheds in Bahi el Din, Siwa, one H. dromedarii from a camel from St. Catherine, three Hyalomma spp. ticks from three cows from Siwa, two H. anatolicum excavatum from a hedgehog from Alexandria, and one R. sanguineus from a dog from Wadi el Natroun. Six of these 24 ticks produced amplicons using conventional PCR assays. Amplicons for the IS1111 transposon were obtained from five A. persicus, and the sequences were identical to each other and 99% similar to C. burnetii (600/602 bp, AE016828). One A. persicus yielded an amplicon for the superoxide dismutase gene; the DNA sequence was 97% similar to C. burnetii (251/ 257 bp, AE016828) and the predicted amino acid sequence was identical to C. burnetii. DNA from Anaplasma, Ehrlichia, or Rickettsia were not detected in any Coxiella-positive ticks. Rickettsia spp. We detected DNA from Rickettsia in five ticks: a female and a male H. dromedarii from two camels in Siwa Governorate, two female H. impeltatum from a cow from El Kharga Oasis, and a male H. marginatum rufipes from a cow in Farghal village (Ismailia Governorate). DNA from Anaplasma spp., Coxiella burnetii, or Ehrlichia spp. were not detected in these ticks. Conventional PCR amplicons for the 17 kD antigenic gene were obtained from all five ticks, and these amplicons were identical to each other and to Rickettsia HymargITA13 (366/366 bp, AJ781420) from H. marginatum from Italy. The rOmpA gene amplified from three of these five ticks (one from each species), and the amplicons were identical to each other and 99% similar to the MC19 strain of Rickettsia aeschlimannii (589/590 bp, U43800) from H. marginatum marginatum from Morocco. The 17 kD antigenic gene sequence for R. aeschlimanii or the rOmpA gene sequence for HymargITA13 were not available on

123

78


GenBank. Both sequences are probably derived from R. aeschlimannii, and all five ticks contained this agent.

Discussion We detected rickettsial agents in Egyptian ticks, including economically significant veterinary pathogens and novel genotypes with similarity to known pathogens. DNA was obtained from pathogens that cause bovine anaplasmosis and Q fever. Bovine anaplasmosis is endemic in the Mediterranean and causes significant economic losses due to the death of cattle, abortions, decreased body condition, and decreased milk production (Kocan 2001). Q fever, caused by Coxiella burnetii, can be transmitted by aerosol, by unpasteurized dairy products, or by tick bite (Willems et al. 1994). The agent was detected predominantly in A. persicus from animal sheds; sequences from two different genes confirmed the identity of the agent. There are reports of A. persicus infected with C. burnetii, based on the physiologic and ultrastructural characteristics of the pathogen (Hoogstraal 1985). DNA from Coxiella burnetii has also been detected in fleas and lice from Egypt (Loftis et al. 2006; Reeves et al. 2006). We detected R. aeschlimanii, a tick-transmitted agent that can cause febrile illness in people (Pretorius and Birtles 2002; Raoult et al. 2002), in three species of Hyalomma. The pathogenicity of this agent in animals has not been evaluated. We did not detect R. conorii, the agent of Mediterranean spotted fever, which is believed to be enzootic in Egypt (Brown et al. 2005). Lack of detection might reflect a sampling bias; R. sanguineus is the primary vector of R. conorii, and we tested only 49 ticks. The serologic reactivity to spotted-fever group Rickettsia previously reported in animals and people from Egypt could also result from unrecognized infections with R. aeschlimanii or other Rickettsia spp., such as those detected in Egyptian fleas (Loftis et al. 2006). Further research is needed to evaluate this possibility. We detected two novel agents that are genetically similar to veterinary pathogens. Genotype C is similar to E. canis and ‘‘Ehrlichia ovinia,’’ a tick-borne disease of sheep in Africa (Neitz 1968); thus, genotype C might cause ehrlichiosis in canids or ruminants in Egypt. Because serologic cross-reactions can occur between Ehrlichia spp. (Jongejan et al. 1993), this agent could contribute to the high level (41%) of seropositivity to E. canis reported in Egyptian dogs (Botros et al. 1995). Genotype E was most similar to ‘‘Anaplasma platys’’, which causes infectious canine cyclic thrombocytopenia (Rikihisa 1991), but was also homologous to two Ehrlichia (Omatjenne and Bom Pastor) from ruminants exhibiting symptoms and pathology similar to heartwater (Allsopp et al. 1997; Bekker et al. 2001). Finally, we detected two agents with unknown pathogenicity: Rickettsiales genotype B and Ehrlichia genotype D. Both genotypes have high homology of the 16S rRNA gene to uncultured bacteria detected in ticks by PCR (Beninati et al. 2004; Parola et al. 2001, 2003; Wen et al. 2002). These genotypes might cause disease in vertebrates, or they might be non-pathogenic endosymbionts of ticks. Although we identified seven different rickettsial agents in the Egyptian ticks, the identification was limited by our ability to obtain amplicons using conventional PCR. Twenty of 35 extracts that were positive using the real-time PCR assay for Anaplasmataceae and 18/24 extracts that were positive using the real-time PCR assay for C. burnetii did not produce amplicons using conventional PCR assays. This might be

123


79

due to the superior sensitivity of real-time PCR; the assays we used detect as few as 10 genomes of Anaplasmataceae (500–600 per arthropod) or one genome of C. burnetii (50–60 per arthropod). Further research is needed to evaluate the extent to which Egyptian livestock are exposed to rickettsial pathogens and the economic impact of these infections. Additionally, people who work with livestock or in tick-infested areas might be at risk of infection with one or more zoonotic rickettsiae. Acknowledgements The authors would like to thank Maria Badra, Hanafi A. Hanafi, Alaa Taher, Emad El Din Yehia, and Ahmed Fawzi for invaluable support provided in Egypt; Herbert Thompson and Rachel Priestley, CDC, Atlanta, GA, for providing the real-time PCR assay for Coxiella burnetii; and Robert Massung, CDC, Atlanta, GA, for designing the EC12a primer. Special thanks are extended to the team members from the Vector Biology Department at the Egyptian Ministry of Health for their great support in the field work for this study. This work was supported by GEIS, Work Unit Number No. 847705.82000.25 GB.E0018. The opinions and assertions contained herein are the private views of the authors and are not to be construed as official or reflecting the views of the Department of the Navy, Department of Defense, Department of Health and Human Services, or the United States Government.

References Allsopp MTEP, Visser ES, du Plessis JL, Vogel SW, Allsopp BA (1997) Different organisms associated with heartwater as shown by analysis of 16S ribosomal RNA gene sequences. Vet Parasitol 71:283–300 Amin OM, Madbouly MH (1973) Distribution and seasonal dynamics of a tick, a louse fly, and a louse infesting dogs in the Nile Valley and Delta of Egypt. J Med Entomol 10:295–298 Anderson BE, Sumner JW, Dawson JE, Tzianabos T, Greene CR, Olson JG, Fishbein DB, OlsenRasmussen M, Holloway BP, George EH (1992) Detection of the etiologic agent of human ehrlichiosis by polymerase chain reaction. J Clin Microbiol 30:775–780 Awad FI, Amin MM, Salama SA, Khide S (1981) The role played by Hyalomma dromedarii in the transmission of African horse sickness virus in Egypt. Bull Anim Health Prod Afr 29:337–340 Bekker CP, Vink D, Lopes Pereira CM, Wapenaar W, Langa A, Jongejan F (2001) Heartwater (Cowdria ruminantium infection) as a cause of postrestocking mortality of goats in Mozambique. Clin Diagn Lab Immunol 8:843–846 Beninati T, Lo N, Sacchi L, Genchi C, Noda H, Bandi C (2004) A novel alpha-Proteobacterium resides in the mitochondria of ovarian cells of the tick Ixodes ricinus. Appl Environ Microbiol 70:2596–2602 Botros BA, Elmolla MS, Salib AW, Calamaio CA, Dasch GA, Arthur RR (1995) Canine ehrlichiosis in Egypt: sero-epidemiological survey. Onderstepoort J Vet Res 62:41–43 Botros BA, Soliman AK, Darwish M, El Said S, Morrill JC, Ksiazek TG (1989) Seroprevalence of murine typhus and fievre boutonneuse in certain human populations in Egypt. J Trop Med Hyg 92:373–378 Brown RB, Lane RS, Dennis DT (2005) Geographic distributions of tick-borne diseses and their vectors. In: Goodman JL, Dennis DT, Sonenshine DE (eds) Tick-borne disease of humans. ASM Press, Washington, D.C., pp 363–391 Carl M, Tibbs CW, Dobson ME, Paparello S, Dasch GA (1990) Diagnosis of acute typhus infection using the polymerase chain reaction. J Infect Dis 161:791–793 Corwin A, Habib M, Watts D, Darwish M, Olson J, Botros B, Hibbs R, Kleinosky M, Lee HW, Shope R, Kilpatrick M (1993) Community-based prevalence profile of arboviral, rickettsial, and Hantaan-like viral antibody in the Nile River Delta of Egypt. Am J Trop Med Hyg 48:776–783 Diab FM, El Kady GA, Shoukry A (2001) Bionomics of ticks collected from Sinai Peninsula: 2 – abundance, attachment sites, and density estimators of ticks infesting Arabian camels. J Egypt Soc Parasitol 31:479–489 El Kady GA (1998) Protozoal parasites in tick species infesting camels in Sinai Peninsula. J Egypt Soc Parasitol 28:765–776

123

80


El Kammah KM, Oyoun LM, El Kady GA, Shafy SA (2001) Investigation of blood parasites in livestock infested with argasid and ixodid ticks in Egypt. J Egypt Soc Parasitol 31:365–371 Helmy N (2000) Seasonal abundance of Ornithodoros (O.) savignyi and prevalence of infection with Borrelia spirochetes in Egypt. J Egypt Soc Parasitol 30:607–619 Hoogstraal H (1985) Argasid and nuttalliellid ticks as parasites and vectors. Adv Parasitol 24:135– 238 Hoogstraal H, Kaiser MN (1958) The ticks (Ixodoidea) of Egypt: a brief review and keys. J Egypt Public Health Assoc 33:51–85 Inokuma H, Fujii K, Matsumoto K, Okuda M, Nakagome K, Kosugi R, Hirakawa M, Onishi T (2002a) Demonstration of Anaplasma (Ehrlichia) platys inclusions in peripheral blood platelets of a dog in Japan. Vet Parasitol 110:145–152 Inokuma H, Okuda M, Ohno K, Shimoda K, Onishi T (2002b) Analysis of the 18S rRNA gene sequence of a Hepatozoon detected in two Japanese dogs. Vet Parasitol 106:265–271 Inokuma H, Oyamada M, Kelly PJ, Jacobson LA, Fournier PE, Itamoto K, Okuda M, Brouqui P (2005) Molecular detection of a new Anaplasma species closely related to Anaplasma phagocytophilum in canine blood from South Africa. J Clin Microbiol 43:2934–2937 Jiang J, Chan TC, Temenak JJ, Dasch GA, Ching WM, Richards AL (2004) Development of a quantitative real-time polymerase chain reaction assay specific for Orientia tsutsugamushi. Am J Trop Med Hyg 70:351–356 Jongejan F, de Vries N, Nieuwenhuijs J, Van Vliet AHM, Wassink LA (1993) The immunodominant 32-kilodalton protein of Cowdria ruminantium is conserved within the genus Ehrlichia. Rev Elev Med Vet Pays Trop 46:145–152 Kaplan MM, Bertagna P (1955) The geographical distribution of Q fever. Bull World Health Organ 13:829–860 Kocan KM (2001) Anaplasmosis. In: Service MW (ed) The encyclopedia of arthropod-transmitted infections. CABI Publishing, Wallingford, UK, pp 28–33 Lange JV, El Dessouky AG, Manor E, Merdan AI, Azad AF (1992) Spotted fever rickettsiae in ticks from the northern Sinai Governate, Egypt. Am J Trop Med Hyg 46:546–551 Li JSY, Yager E, Reilly M, Freeman C, Reddy GR, Reilly AA, Chu FK, Winslow GM (2001) Outer membrane protein-specific monoclonal antibodies protect SCID mice from fatal infection by the obligate intracellular bacterial pathogen Ehrlichia chaffeensis. J Immunol 166:1855–1862 Loftis AD, Reeves WK, Szumlas DE, Abbassy MM, Helmy IM, Moriarity JR, Dasch GA (2006) Surveillance of Egyptian fleas for agents of public health significance: Anaplasma, Bartonella, Coxiella, Ehrlichia, Rickettsia, and Yersinia pestis. Am J Trop Med Hyg 75(1):41–48 Mazyad SA, Khalaf SA (2002) Studies on theileria and babesia infecting live and slaughtered animals in Al Arish and El Hasanah, North Sinai Governorate, Egypt. J Egypt Soc Parasitol 32:601– 610 McDade JE, Zaklama NS, Imam IZ, Wanees M (1973) Serological survey for Q fever in Egyptian domestic animals. J Egypt Public Health Assoc 48:101–108 Medyannikov OY, Ivanov L, Nishikawa M, Saito R, Sidelnikov YN, Zdanoskaya NI, Mokretsova EV, Tarasivech IV, Suzuki K (2004) Microorganism ‘‘Montezuma’’ of the order Rickettsiales: the potential causative agent of a tick-borne disease in the far east of the Russian Federation. Zh Mikrobiol (Moscow) 1:7–13 Moriarity JR, Loftis AD, Dasch GA (2005) High-throughput molecular testing of ticks using a liquid-handling robot. J Med Entomol 42:1063–1067 Morzaria SP, Latif AA, Jongejan F, Walker AR (1986) Transmission of a Trypanosoma sp. to cattle by the tick Hyalomma anatolicum anatolicum. Vet Parasitol 19:13–21 Moussa MI, Imam IZ, Converse JD, El Karamany RM (1974) Isolation of Matruh virus from Hyalomma marginatum ticks in Egypt. J Egypt Public Health Assoc 49:341–348 National Center for Biotechnology Information (2004) BLAST, version 2.2.10. National Library of Medicine, National Institutes of Health, Bethesda, MD, USA Neitz WO (1968) Ehrlichia ovina infection. Bull Off Int Epizoot 70:337–340 Parola P, Cornet JP, Sanogo YO, Miller RS, Thien HV, Gonzalez JP, Raoult D, Telford III Sr, Wongsrichanalai C (2003) Detection of Ehrlichia spp., Anaplasma spp., Rickettsia spp., and other eubacteria in ticks from the Thai-Myanmar border and Vietnam. J Clin Microbiol 41:1600– 1608 Parola P, Inokuma H, Camicas JL, Brouqui P, Raoult D (2001) Detection and identification of spotted fever group Rickettsiae and Ehrlichiae in African ticks. Emerg Infect Dis 7:1014–1017 Parola P, Roux V, Camicas JL, Baradji I, Brouqui P, Raoult D (2000) Detection of ehrlichiae in African ticks by polymerase chain reaction. Trans R Soc Trop Med Hyg 94:707–708

123


81

Pretorius AM, Birtles RJ (2002) Rickettsia aeschlimannii: a new pathogenic spotted fever group rickettsia, South Africa. Emerg Infect Dis 8:874 Raoult D, Fournier PE, Abboud P, Caron F (2002) First documented human Rickettsia aeschlimannii infection. Emerg Infect Dis 8:748–749 Reeves WK, Szumlas DE, Moriarity JR, Loftis AD, Abbassy MM, Helmy IM, Dasch GA (2006) Louse borne pathogens in lice (Phthiraptera) of rodents and cattle from Egypt. J Parasitol 92:313–318 Rikihisa Y (1991) The tribe Ehrlichieae and ehrlichial diseases. Clin Microbiol Rev 4:286–308 Roux V, Fournier PE, Raoult D (1996) Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J Clin Microbiol 34:2058–2065 Sarih M, M’Ghirbi Y, Bouattour A, Gern L, Baranton G, Postic D (2005) Detection and identification of Ehrlichia spp. in ticks collected in Tunisia and Morocco. J Clin Microbiol 43:1127–1132 Shanbaky NM, Helmy N (2000) First record of natural infection with Borrelia in Ornithodoros (Ornithodoros) savignyi. Reservoir potential and specificity of the tick to Borrelia. J Egypt Soc Parasitol 30:765–780 Shimada MK, Yamamura MH, Kawasaki PM, Tamekuni K, Igarashi M, Vidotto O, Vidotto MC (2004) Detection of Anaplasma marginale DNA in larvae of Boophilus microplus ticks by polymerase chain reaction. Ann NY Acad Sci 1026:95–102 Shoukry A, El Kady GA, Merdan AI, El Said S (1993) Distribution and host-relationship of ticks (Ixodoidea) infesting domestic animals and rodents in Sinai Peninsula. J Egypt Soc Parasitol 23:459–469 Sixl W, Sebek Z, Kock M, Marth E, Withalm H (1989) Serologic studies of domestic animals for listeriosis, Q-fever, and brucellosis in Cairo. Geogr Med Suppl 3:127–128 Stein A, Raoult D (1992) Detection of Coxiella burnetii by DNA amplification using polymerase chain reaction. J Clin Microbiol 30:2462–2466 Stich RW, Rikihisa Y, Ewing SA, Needham GR, Grover DL, Jittapalapong S (2002) Detection of Ehrlichia canis in canine carrier blood and in individual experimentally infected ticks with a p30based PCR assay. J Clin Microbiol 40:540–546 Van Straten M, Jongejan F (1993) Ticks (Acari: Ixodidae) infesting the Arabian camel (Camelus dromedarius) in the Sinai, Egypt with a note on the acaricidal efficacy of ivermectin. Exp Appl Acarol 17:605–616 Wen B, Jian R, Zhang Y, Chen R (2002) Simultaneous detection of Anaplasma marginale and a new Ehrlichia species closely related to Ehrlichia chaffeensis by sequence analyses of 16S ribosomal DNA in Boophilus microplus ticks from Tibet. J Clin Microbiol 40:3286–3290 Willems H, Thiele D, Frolich-Ritter R, Krauss H (1994) Detection of Coxiella burnetii in cow’s milk using the polymerase chain reaction (PCR). Zentralbl Veterinarmed B 41:580–587 Williams RE, Hoogstraal H, Casals J, Kaiser MN, Moussa MI (1973) Isolation of Wanowrie, Thogoto, and Dhori viruses from Hyalomma ticks infesting camels in Egypt. J Med Entomol 10:143–146

123