Riemerella anatipestifer Type IX Secretion System

ORIGINAL RESEARCH published: 19 December 2017 doi: 10.3389/fmicb.2017.02553

Riemerella anatipestifer Type IX Secretion System Is Required for Virulence and Gelatinase Secretion Yunqing Guo 1,2,3† , Di Hu 1,2,3† , Jie Guo 1,2,3 , Tao Wang 1,2,3 , Yuncai Xiao 1,2,3 , Xiliang Wang 1,2,3 , Shaowen Li 1,2,3 , Mei Liu 1,2,3 , Zili Li 1,2,3 , Dingren Bi 1,2,3 and Zutao Zhou 1,2,3* 1

College of Veterinary Medicine, Huazhong Agricultural University, Wuhan, China, 2 State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan, China, 3 Key Laboratory of Preventive Veterinary Medicine in Hubei Province, Huazhong Agricultural University, Wuhan, China

Edited by: George Tsiamis, University of Patras, Greece Reviewed by: Yongtao Zhu, University of Wisconsin–Milwaukee, United States Panagiotis F. Sarris, Institute of Molecular Biology and Biotechnology (IMBB), Foundation of Research and Technology (FORTH), Greece *Correspondence: Zutao Zhou [email protected] † These

authors have contributed equally to this work.

Specialty section: This article was submitted to Systems Microbiology, a section of the journal Frontiers in Microbiology Received: 30 September 2017 Accepted: 08 December 2017 Published: 19 December 2017 Citation: Guo Y, Hu D, Guo J, Wang T, Xiao Y, Wang X, Li S, Liu M, Li Z, Bi D and Zhou Z (2017) Riemerella anatipestifer Type IX Secretion System Is Required for Virulence and Gelatinase Secretion. Front. Microbiol. 8:2553. doi: 10.3389/fmicb.2017.02553

Riemerella anatipestifer (RA), a major causative agent of septicemia anserum exsudativa in domesticated ducklings, has a protein secretion system known as the type IX secretion system (T9SS). It is unknown whether the T9SS contributes to the virulence of RA through secretion of factors associated with pathogenesis. To answer this question, we constructed an RA mutant deficient in sprT, which encodes a core protein of the T9SS. Deletion of sprT yielded cells that failed to digest gelatin, an effect that was rescued via complementation by a plasmid encoding wild-type sprT. Complementmediated killing was significantly increased in the deletion mutant, suggesting that proteins secreted by the T9SS are necessary for complement evasion in RA. Liquid chromatography-tandem mass spectrometry analysis revealed that RAYM_01812 and RAYM_04099 proteins containing a subtilisin-like serine protease domain and exhibiting extracellular gelatinase activity were secreted by the T9SS. Animal experiments demonstrated that the virulence of mutant strain 1sprT strain was attenuated by 42,000-fold relative to wild-type RA-YM. Immunization with the 1sprT protected ducks from challenge with RA-YM, suggesting that the former can be used as a live attenuated vaccine. These results indicate that the T9SS is functional in RA and contributes to its virulence by exporting key proteins. In addition, subtilisin-like serine proteases which are important virulence factors that interact with complement proteins may enable RA to evade immune surveillance in the avian innate immune system. Keywords: Riemerella anatipestifer, T9SS, sprT, virulence, gelatinase secretion

INTRODUCTION Riemerella anatipestifer (RA) is a Gram-negative, non-spore-forming, rod-shaped bacterium belonging to the genus Riemerella and family Flavobacteriaceae of the phylum Bacteroidetes (Segers et al., 1993). It usually causes septicemia and serum exudate in ducks, geese, turkeys, and various other domestic and wild birds, resulting in serious economic losses worldwide (Sandhu, 2008). To date, 21 serotypes of RA have been identified and no significant cross-protection has been reported Abbreviations: CFU, Colony-forming units; CTD, C-terminal domain; HBSS, Hank’s balanced salt solution; LC-MS/MS, liquid chromatography electrospray ionization tandem mass spectrometry; LD50 , median lethal dose; RA, Riemerella anatipestifer; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; T9SS, type IX secretion system; TSA, tryptic soy agar; TSB, tryptic soy broth.

Frontiers in Microbiology | www.frontiersin.org

1

December 2017 | Volume 8 | Article 2553

Guo et al.

Role of SprT in Riemerella anatipestifer

(Sandhu and Leister, 1991; Pathanasophon et al., 2002; Sandhu, 2008). Inactivated bacterins have been used in ducks to prevent RA infection. Live avirulent strains induce longerlasting protection and are more convenient; however, there are few reports on attenuated live vaccines (Sandhu, 1991; Higgins et al., 2000; Liu et al., 2013). Chemotherapy is the most widely used approach for treating RA infection, but the increasing incidence of drug resistance (Yang et al., 2012; Li et al., 2016) compels the search for new strategies for controlling this disease. Recently, a novel protein secretion system known as the T9SS or Por secretion system associated with gliding motility and secretion of virulence factors was discovered in many species of Bacteroidetes (Sato et al., 2010; Mcbride and Zhu, 2013; Ksiazek et al., 2015b; Abby et al., 2016; Lasica et al., 2017). The T9SS has been studied in the motile Flavobacterium johnsoniae as well as in the non-motile Porphyromonas gingivalis and Tannerella forsythia, the latter being the major causative agents of periodontitis. The core set of T9SS genes includes gldK, gldL, gldM, gldN, sprA, sprE, and sprT in F. johnsoniae and their orthologs porK, porL, porM, porN, sov, porW, and porT in P. gingivalis. Deletion of some components of the T9SS resulted in protein secretion defects (Rhodes et al., 2010, 2011; Sato et al., 2010; Shrivastava et al., 2013; Veith et al., 2013). Proteins secreted by the T9SS have an N-terminal signal peptide that enables transit across the cytoplasmic membrane via the Sec system, as well as a conserved CTD that is thought to target the proteins to the T9SS (Sato et al., 2010; Slakeski et al., 2011; Glew et al., 2012; Mcbride and Zhu, 2013). Genes encoding T9SS protein orthologs to those in F. johnsoniae and in P. gingivalis have been identified in the genome of RA strain RA-YM (RAYM_04711, RAYM_04706, RAYM_04701, RAYM_04696, RAYM_09602, RAYM_03704, and RAYM_03924) (Zhou et al., 2011). Although the pathogenicity of bacteria is closely related to protein secretion systems, it is unknown whether the T9SS contributes to RA virulence through the secretion of factors associated with pathogenesis or the stress response. The T9SS component SprT is predicted to be a membraneassociated protein (Sato et al., 2005; Nguyen et al., 2009; Shrivastava et al., 2013). SprT is involved in gliding motility, extracellular chitinase activity, and localization of SprB adhesin in F. johnsoniae (Rhodes et al., 2010; Sato et al., 2010). PorT, orthologs to SprT, is essential for the secretion of gingipains in P. gingivalis (Sato et al., 2005, 2010; Nguyen et al., 2009). A previous study reported that sprT expression was regulated by the iron and ferric uptake regulator Fur, suggesting that the role of SprT protein is to ensure cell survival and fitness by providing transportation to proteins under iron-restricted conditions (Guo et al., 2017). To date, there have been no reports on the T9SS of RA. In this study, we constructed the sprT (RAYM_03924) gene deletion mutant 1sprT and the complemented strain C1sprT to investigate the relationship between the T9SS and the biological characteristics and virulence of RA.


MATERIALS AND METHODS Bacterial Strains, Plasmids, and Culture Conditions Bacterial strains and plasmids used in this study are listed in Table 1. RA-YM was isolated and deposited at the Department of Veterinary Microbiology and Immunology of Huazhong Agricultural University. RA strains were grown on TSA (Difco, Detroit, MI, United States) or TSB (Difco) at 37◦ C in 5% CO2 . Escherichia coli was grown at 37◦ C on a Luria-Bertani plate or in Luria-Bertani broth. Antibiotic concentrations were as follows: ampicillin, 100 µg/mL; chloramphenicol, 50 µg/mL; spectinomycin (Spc), 100 µg/mL; and diaminopimelic acid, 50 µg/mL.

Construction of Mutant Strain 1sprT and Complemented Strain C1sprT The mutant strain 1sprT was constructed by allelic exchange using the recombinant suicide plasmid pRE112. Briefly, a 585-bp left flanking region of the sprT gene (Leftarm) was amplified from RA-YM genomic DNA using primers SprT-F1 (introducing a KpnI site) and SprT-R1. A 1086-bp SpcR cassette was amplified from plasmid pIC333 using primers Spc-F and Spc-R. A 867-bp right flanking region of sprT gene (Rightarm) was amplified from RA-YM genomic DNA using primers SprT-F2 and SprT-R2 (introducing a SacI site). The left flanking region, SpcR cassette, and right flanking region were fused by overlap extension PCR using SprT-F1 and SprT-R2. The fused DNA fragment was inserted into pMD18-T to generate pMD18T-LeftarmSpc-Rightarm, which was digested along with the pRE112 plasmid with KpnI and SacI to obtain the recombinant suicide plasmid pRE112-Leftarm-Spc-Rightarm (pRE112-LSR). This was transformed into E. coli X 7213. The transformants were used as the donor strain in conjugal transfer. The mutant strain was selected on TSA containing 100 µg/mL Spc. The sprT gene deletion mutant strain (1sprT) was confirmed by PCR. The shuttle plasmid pRES-JX-bla was constructed as previously described (Guo et al., 2017) by adding the putative replication region of the RA plasmid RA-JX to the suicide vector. The promoter and coding sequences of sprT were amplified using primers Promoter-sprT1 (introducing a KpnI site) and Promoter-sprT2, SprT-CF, and SprT-CR (introducing a SphI site). The promoter and coding fragments were joined by overlap extension PCR. The product was digested with KpnI and SphI and inserted into pRES-JX-bla to generate plasmid pRES-JXbla-sprT, which was transferred by conjugation into the mutant strain RA-YM1sprT. Transconjugants were screened on TSA supplemented with ampicillin and verified by PCR.

Biochemical Characterization of Mutant Strain 1sprT and Complemented Strain C1sprT Growth curves were generated for mutant strain 1sprT, complemented strain C1sprT, and wild-type strain RA-YM to determine whether sprT deletion influenced bacterial growth.

2


Guo et al.


TABLE 1 | Strains, plasmids, and primers used in this study. Strains, plasmids, and primers

Descriptions

Source

Strains RA-YM

Riemerella anatipestifer wild-type strain, serotype 1

Preserved in the laboratory

1sprT

sprT gene deletion mutant strain, SpcR

This study

C1sprT

Complemented RA-YM MsprT strain, SpcR , AmpR

This study

E. coli DH5α

Competent cell

Transgen

E. coli X7213

Competent cell

This study

pMD18-T

TA cloning vector

Takara

pRE112

Suicide vector


pRE112-LSR

Suicide vector

This study

pRES-JX-bla

Shuttle vector


RA-JX

Wild type plasmid of RA


pRES-JX-bla-sprT

Shuttle vector

This study

pGEX-6P-1

Expression vector


pGEX-6P-1_01812

Expression vector

This study

Spc-F1

CAGTGGAACGAAAACTCACGTT

This study

Spc-R1

CAGTAGTTTTAAAAGTAAGCACCTG

This study

SprT-F1

ACGGGTACCAGGTACTAAAGCCGAAAT

This study

SprT-R1

ACGTGAGTTTTCGTTCCACTGCATGG CAGAAATACTAATG

This study

SprT-F2

TGCTTACTTTTAAAACTACTATACAC GCTGATAGATGG

This study

SprT-R2

CGAGCTCCAAACCTCGGTAAACAAA

This study

SprT-IS

ATGGACAGAATGGAAGGC

This study

SprT-IR

TTTTGGAGTGAATGGAGC

This study

Promoter-sprT1

GGGTACCAAGTATTTTGGATAAATTAGACT

This study

Promoter-sprT2

TATCTTTTTCATTAATCTTAAAAATTTACAGCCAC

This study

SprT-CF

TTTTTAAGATTAATGAAAAAGATATTTTTTTTAAC

This study

SprT-CR

GGCATGCTTATTCAAATTTTAGCACAAACA

This study

P01812-1

CGGGATCCATGGCTCAAAACCAAAACACATC

This study

P01812-2

CCCTCGAGCTTCTTGATAAATTTCTTAGTAA

This study

Plasmids

Primers (50 –30 )

R Resistance.

The three strains were grown for about 48 h at 37◦ C in 5% CO2 on TSA plates and were inoculated into TSB. At midexponential phase, the culture was diluted with fresh medium to an optical density at 600 nm (OD600 ) of 1.0, and equal amounts of each bacterial culture were transferred to fresh TSB medium at a ratio of 1:1000 (v/v) and cultured at 37◦ C with shaking at 200 rpm. OD600 was measured at 1 h intervals for 20 h using a spectrophotometer (Bio-Rad, Hercules, CA, United States). Biochemical testing of the three strains was carried out using bacterial biochemical tubes (Hope Bio, Qingdao, China) with glucose, arabinose, sucrose, citrate, hydrogen sulfide, nitrate, carbamide, and gelatin. To visually characterize the presence of liquefied gelatin, RA-YM, 1sprT, and C1sprT cells were inoculated into TSB overnight. Cultures (5 µL) were spotted on nutrient gelatin plates and cultivated at 37◦ C for 24 h. Then, 2–3 mL acid mercuric chloride was added to the plates and color development was assessed after 5 min. Cells capable of liquefying gelatin, were identified by a transparent halo around the bacterial lawn (Frazier, 1926; Mcdade and Weaver, 1959; Thomas et al., 2014).


Serum Survival Assay Blood was drawn from 12 healthy 30-day-old Cherry Valley ducks without anti-RA antibody and immediately placed on ice. After 2 h, the clotted blood was centrifuged at 2000 × g and 4◦ C for 10 min. The serum was collected as normal duck serum and stored at −80◦ C until use. For the serum survival assay, mutant strain 1sprT, complemented strain C1sprT, and wild-type strain RA-YM were cultured in TSB to an OD600 of 0.8. The cells were washed and resuspended to 106 CFU/mL in HBSS (Gibco, Grand Island, NY, United States) with 0.15 mM calcium and 1 mM magnesium (HBSS++ ). After incubation at 37◦ C for 30 min with or without duck serum, 10-fold serial dilutions of the mixture were spread onto TSA plates. Colonies were counted after incubation for 48 h. The serum survival assay was performed with bacteria resuspended in HBSS++ to prevent replication so that the viability of all strains could be evaluated (Rosadini et al., 2013). The reaction was also performed in the presence or absence of 10 mM Mg2+ EGTA to block the classical complement and lectin pathways and selectively activate the alternative complement pathway.

3


Guo et al.


abundant precursor ions from the survey scan (300–1800 m/z) for higher-energy collisional dissociation fragmentation. Determination of the target value was based on predictive Automatic Gain Control. The duration of dynamic exclusion was 60 s. Survey scans were acquired at a resolution of 70,000 at m/z 200, and the resolution for HCD spectra was set to 17,500 at m/z 200. Normalized collision energy was 30 eV and the underfill ratio, which specifies the minimum percentage of the target value likely to be reached at maximum fill time, was defined as 0.1%. The instrument was run with peptide recognition mode enabled. MS/MS spectra were searched using MASCOT engine v.2.2 (Matrix Science, London, United Kingdom) against the non-redundant International Protein Index Arabidopsis sequence database v.3.85 (released September 2011; 39,679 sequences) from the European Bioinformatics Institute1 . The following options were used for protein identification: peptide mass tolerance = 20 ppm, MS/MS tolerance = 0.1 Da, enzyme = trypsin, missed cleavage = 2, fixed modification: carbamidomethyl (C); and variable modification: oxidation (M).

Heat-inactivated serum used in this assay was generated by incubating normal duck serum at 56◦ C for 30 min. The survival rate was calculated as follows: (number of cells that survived serum treatment/number of cells that survived control treatment) × 100%. Differences among groups were evaluated by analysis of variance using SPSS v.18.0 software (SPSS Inc., Chicago, IL, United States). Data are presented as mean ± standard error of the mean, and statistical significance was determined with the Student’s t-test. A P-value of