Rinaldi, page 1, Plant Physiology

Plant Physiology Preview. Published on March 30, 2007, as DOI:10.1104/pp.106.094987

Rinaldi, page 1, Plant Physiology Running Head: Transcriptomics of Poplar-Rust Interactions Research category: Plants Interacting With Other Organisms

Corresponding Author, Duplessis Sébastien UMR1136 INRA /Nancy Université Interactions Arbres/Micro-organismes Centre INRA de Nancy 54280 Champenoux, France

Tel, +33 383 39 40 13 Fax, +33 383 39 40 69 e-mail, [email protected]

Copyright 2007 by the American Society of Plant Biologists

Rinaldi, page 2, Plant Physiology

Transcript Profiling of Poplar Leaves upon Infection with Compatible and Incompatible Strains of the Foliar Rust Melampsora larici-populina Cécile Rinaldi1†, Annegret Kohler1†, Pascal Frey1, Frédéric Duchaussoy1, Nathalie Ningre2, Arnaud Couloux3, Patrick Wincker3, Didier Le Thiec2, Silvia Fluch4, Francis Martin1 and Sébastien Duplessis1* 1

UMR1136 INRA /Nancy Université Interactions Arbres/Micro-organismes, Centre INRA de

Nancy, F-54280 Champenoux, France; 2UMR1137 INRA /Nancy Université Ecophysiologie et Ecologie Forestières, Centre INRA de Nancy, F-54280 Champenoux, France; 3

GENOSCOPE CNRS UMR 8030, Centre National de Séquençage, 2 rue Gaston Crémieux,

F-91057 EVRY Cedex, France; 4PICME, ARC Seibersdorf research GmbH Biogenetics, A2444 Seibersdorf

†

These authors contributed equally to this work

Financial source: CR was supported by a Région Lorraine-INRA doctoral scholarship and AK by a INRA postdoctoral fellowship. SD was supported by a junior scientist support grant from the Région Lorraine. Sequencing of SSH cDNA clones was supported by CNRG (Génoscope) within the framework of the ForEST project. The present work was partly supported by INRA Innovating Grant ‘Durabilité des résistances’ and Action Incitative Programmée ‘Sequencing 2005-2006’ to FM, the european project POPYOMICS (contract No.QLK5-CT-2002-00953), and the Institut Fédérateur de Recherche 110 ‘Génomique, Ecophysiologie et Ecologie Fonctionnelles’ and Région Lorraine for the DNA sequencing and functional genomics facilities. The ESTs printed on the PICME arrays were produced by INRA-Nancy (Martin et al.), INRA-Orléans (Leplé et al.), and University of Helsinki (Kängasjärvi et al.) within the framework of the INRA LIGNOME and European ESTABLISH programmes respectively.

*Corresponding Author, Dr Sébastien Duplessis Fax, +33 383 39 40 69 e-mail, [email protected]

Rinaldi, page 3, Plant Physiology Abstract To understand key processes governing defense mechanisms in poplar upon infection with the rust fungus Melampsora larici-populina, we used combined histological and molecular techniques to describe the infection of Populus trichocarpa x Populus deltoides ‘Beaupré’ leaves by compatible and incompatible fungal strains. Striking differences in host-tissue infection were observed after 48 hours post inoculation (hpi) between compatible and incompatible interactions. No ROS production could be detected at infection sites while a strong accumulation of monolignols occurred in the incompatible interaction after 48 hpi indicating a late plant response once the fungus already penetrated host cells to form haustorial infection structures. P. trichocarpa whole genome expression oligoarrays and sequencing of cDNAs were used to determine changes in gene expression in both interactions at 48 hpi. Temporal expression profiling of infection-regulated transcripts were further compared by cDNA arrays and RT-qPCR. Among 1730 significantly differentially expressed transcripts in the incompatible interaction, 150 showed an increase in concentration ≥ 3-fold, whereas 62 were decreased by ≥ 3-fold. Regulated transcripts corresponded to known genes targeted by R-genes in plant pathosystems, such as inositol3-phosphate synthase, glutathione S-transferases and pathogenesis-related proteins. However, the transcript showing the highest rust-induced up-regulation encodes a putative secreted protein with no known function. In contrast, only a few transcripts showed an altered expression in the compatible interaction, suggesting a delay in defense response between incompatible and compatible interactions in poplar. This comprehensive analysis of early molecular responses of poplar to M. larici-populina infection identified key genes that likely contain the fungus proliferation in planta.

Rinaldi, page 4, Plant Physiology INTRODUCTION Plants respond to microbial invasion by activating an array of inducible defense mechanisms (Nimchuk et al., 2003). After specific recognition of a pathogen, the hypersensitive response (HR) is a rapid and efficient plant resistance mechanism leading to cell death at the site of infection (Heath, 2000). Among the rapid defense mechanisms triggered in plant tissues are generation of reactive oxygen species (ROS) at the site of infection, cell-wall thickening and production of anti-microbial compounds and enzyme inhibitors (Glazebrook, 2005). Genes encoding pathogenesis-related (PR) proteins such as glucanases and chitinases, are primary target genes triggered during the early-response to pathogen attack (Van Loon and Van Strien, 1999) and are considered as a signature of the HR. Their expression could be directly targeted by pathogen-sensing systems through highly complex and interconnected networks of transduction pathways driving plant resistance (Katagiri, 2004). Several signal molecules, such as ethylene, salicylic acid or jasmonic acid, play an important role in these defense reaction signaling networks (Shah, 2003) and recently a central role for the NPR1 protein has been highlighted (Dong, 2004). Considerable advances have been made in understanding plant resistance processes in the model plant Arabidopsis thaliana, particularly through extensive mutant analyses. It is now clear that the plant response to pathogen infection is associated with massive changes in gene expression (Schenk et al., 2000). Large-scale mRNA expression profilings have revealed that plants express similar sets of defense mechanisms in response to different pathogens (Tao et al., 2003; Eulgem, 2004). Dissection of the defense response at the molecular level have greatly helped in drawing a general model for pathogen resistance in plant (Tao et al., 2003; Nimchuk et al., 2003). However, it is not known whether such a model applies for long-term adaptation of resistance mechanisms in perennial plant species like trees. Such long-lived species are more prone to attacks by pathogens before reproduction and their long generation time makes it impossible for them to match the evolutionary rates of a pathogen that goes through several generations every year. Annotation of the P. trichocarpa genome has revealed an expansion of the NBS-LRR resistance gene families (Tuskan et al., 2006) suggesting a possible adaptation to long-term exposure to pathogens.

The basidiomycete Melampsora larici-populina is responsible for the leaf rust disease in Populus species (Frey et al., 2005; Pinon and Frey, 2005). Urediniospore germlings of this obligate biotrophic fungus usually penetrate the host plant through stomatal openings, differentiate a series of infection structures in the intercellular space, and exhibit highly localized penetration of the host cell wall to establish a haustorium (Laurans and Pilate, 1999). Hyphae then proliferate in the leaf parenchyma and produce golden pustules filled with masses of urediniospores on the lower leaf surface. M. larici-populina causes severe

Rinaldi, page 5, Plant Physiology economic losses in European poplar plantations and has been recently detected in North America (Newcombe and Chastagner, 1993). Selection for resistance to this biotrophic pathogen is thus an important challenge for poplar breeders (Dowkiw and Bastien, 2004). Severe damages occur through decreased photosynthesis efficiency, early defoliation and increased susceptibility to other pests and diseases (Gérard et al., 2006). To date, no resistant poplar cultivars are available as new virulent strains of M. larici-populina are developing regularly. Sustainability of new selected resistance requires a better understanding of the molecular mechanisms underlying Populus-Melampsora interactions. Most of the knowledge on lifestyle of fungal pathogens derives from studies in non-obligate biotrophs and there are limited data about obligate biotrophs, such as rust fungi and powdery mildews. These fungi show a high level of compatibility with their host, but the reasons for the obligate biotroph status remains unknown (Mendgen and Hahn, 2002). To date, only sparse molecular data were obtained on defense mechanisms in poplar, and published data concern interactions with herbivores or viruses (Christopher et al., 2004; Smith et al., 2004; Ralph et al., 2006a; Major and Constabel, 2006). Molecular responses to Melampsora spp. invasion are unknown.

Here we investigated the interaction between an interamerican hybrid poplar, P. trichocarpa x P. deltoides ’Beaupré’ and M. larici-populina. This poplar hybrid has been largely used in commercial poplar cultivation in Europe and harbors a qualitative resistance to M. larici-populina (Pinon and Frey, 2005). It is derived from a cross between P. trichocarpa, a species for which the genome sequence is available (Tuskan et al., 2006), and P. deltoides, a species from which rust resistance loci are inherited (Jorge et al., 2005). Besides, efforts had been made to localize rust-resistance related genes in poplar pedigrees through genetic approaches (Cervera et al., 2004). Different studies successfully mapped rust-resitance quantitative trait loci (QTL) in P. trichocarpa and P. deltoides (Lescot et al., 2004; Yin et al., 2004). To characterize the specific host-response to either virulent or avirulent strains of M. larici-populina, we carried out a combined molecular and histological analysis of time-course infection through scanning electron microscopy and qPCR to detect rust progression in planta. We also investigated lignin and ROS production in plant tissue to determine major differences in plant response between the compatible and incompatible interactions. Then, rust-responsive genes were identified using either a SSH-cDNA library of poplar leaves infected by the avirulent M. larici-populina strain or NimbleGen whole genome expression arrays. Finally, expression profiles of Populus defense-related genes during the time-course of infection were confirmed with additional transcriptome-based approaches (RT-qPCR and cDNA arrays).

Rinaldi, page 6, Plant Physiology

RESULTS

Time-course of compatible and incompatible interactions Rust development in P. trichocarpa x P. deltoides ‘Beaupré’ leaves was monitored at the macroscopic and microscopic levels over a period of 10 days post inoculation (dpi) with either compatible (98AG31; pathotype 3-4-7) or incompatible (93ID6; pathotype 3-4) strains of M. larici-populina. In the compatible interaction, uredinia formation was visible under the abaxial epidermis 5 dpi and by 6-7 dpi, uredinia emerged through the epidermis and formed orange pustules of 1-2 mm diameter (Figure 1). Uredinia distribution was uniform on the leaf surface and there were about 73 ±6 pustules per cm2. In the incompatible interaction (93ID6), no lesion or pustule were observed on the leaf surface over a period of 10 days. The abaxial epidermis showed very localized necrotic zones and dark dots inside mesophyll tissues were visible in transparency after 6 dpi (Figure 1). Control leaves inoculated with water showed no pustules or necrotic lesions after 10 days. Infection structures developed by M. larici-populina at the leaf surface were monitored by aniline blue staining and light microscopy. Compatible and incompatible spores of M. larici-populina germinated within 2 h post inoculation (hpi) and germ tubes of different length (1 µm to 1 mm) were observed on the leaf surface (Figure 2A). Most of the germ tubes ramified, formed appressoria and had successfully penetrated plant tissues at 2 hpi. Low temperature variable pressure scanning electron microscopy (VPSEM) was used to follow in planta colonization of M. larici-populina by direct observations of infected leaves sections. Fungal structures on the leaf surface were similar to those observed with aniline blue staining for both interactions. Penetration through stomata occurred for about half of the successful events of germination between 2 and 6 hpi (Figure 2B). At 6 and 12 hpi, sub-stomatal vesicles were observed in the sub-stomatal chambers (Figure 2C) and infection hyphae were developing in the mesophyll tissue from these vesicles. At 18 and 24 hpi, infection hyphae extended into the mesophyll and in some cases reached the palisadic mesophyll (Figure 2D, E). The infection hyphae terminated their growth on a mesophyll cell forming haustorial mother cells while other infection hyphae continued their course into the mesophyll after branching (Figure 2D, E). Infection structures inside the cells (ie., haustoria) cannot be observed using VPSEM. Most of the compatible strain hyphae observed by VPSEM invaded both the spongy and the palisadic mesophyll by 48 hpi. The number of infection hyphae dramatically increased for the compatible strain at 96 hpi (Figure 2F). Observations were further made at 5 and 7 dpi. In the compatible interaction, hyphae totally invaded the plant tissue around primary infection sites at 5 dpi, domes were formed in the spongy mesophyll and spore-forming cells were differentiating (data not shown). By 7 dpi, domes corresponding

Rinaldi, page 7, Plant Physiology to uredinial pustules released spores on the leaf abaxial surface (Figure 2G). In the case of the incompatible interaction, the number of hyphae observed in planta was similar to that of the compatible interaction until 24 hpi and a limited number of hyphae was observed at later timepoints. At 96 hpi, a few hyphae were ramified or extended into the palissadic mesophyll (Figure 2H).

Fungal growth in leaves during compatible and incompatible interactions Assuming that the proportion of fungal and plant biomass present at any given time during an infection is equivalent to the proportion of fungal and plant DNA, quantitation of fungal nuclear ribosomal DNA internal transcribed spacer (ITS) can be used to estimate the extent of fungal growth in the plant (Boyle et al., 2005). Invasion of foliar tissues by compatible and incompatible strains was monitored in planta by real-time PCR (qPCR) quantification of M. larici-populina rDNA ITS. In planta growth of compatible and incompatible strains of M. larici-populina was similar during early stages of infection (2, 6, 12 and 24 hpi) (Figure 3). A drastic increase in fungal DNA mass of about 12-fold was observed between 24 and 48 hpi for the compatible strain while the incompatible strain showed a slower increase (4-fold). The amount of fungal rDNA ITS decreased for the latter strain between 48 and 96 hpi indicating a possible hyphal decay (Figure 3). In contrast, growth of the compatible strain dramatically increased at 96 hpi and DNA mass was more than 500-fold higher than the amount measured for the incompatible strain.

Detection of reactive oxygen species and lignin monomers Leaf tissues inoculated with compatible and incompatible strains of M. larici-populina showed no endogenous ROS accumulation based on diaminobenzidine (DAB) staining (data not shown). In contrast, control leaves with H2O2 injection and wounded leaves exhibited DAB precipitates (data not shown). Phloroglucinol staining is considered to be specific for cinnamaldehyde end-groups present in lignins (Nakano and Meshitsuka, 1992). At 2, 6, 12 (data not shown), 24, and 48 hpi, a light red coloration of vessels of major orders was observable on leaf inoculated with the incompatible strain and no coloration was visible for the rest of the leaf tissues (Figure 4A). An intense red coloration of leaf tissues was detected at 96 hpi in leaves inoculated with the incompatible strain (figure 4A and 4B) whereas staining was restricted to lower orders of leaf vessels in the case of the compatible interaction or in control leaves (figure 4A). Infection hyphae of the compatible strain could be observed as yellowish dots in the mesophyll tissue at 96 hpi (figure 4B). In control leaf tissues, a light red coloration was restricted to vessels.

Rinaldi, page 8, Plant Physiology Defense-related genes in a SSH cDNA library of rust-infected leaves Suppression subtractive hybridization (SSH) technology is a powerful approach to identify genes differentially expressed by cells or organisms in specific developmental stages (Diatchenko et al. 1996). A subtractive cDNA library from incompatible rust-infected leaves (12, 24 and 48 hpi), subtracted by RNA from non-inoculated leaf tissues, was constructed. Assembly of 1,999 ESTs obtained from the 5’ and 3’ ends of 1152 SSH cDNAs produced 967 non-redundant Tentative Consensus sequences (TC) corresponding to 486 different genes. These sequences have been deposited in the NCBI database (accession numbers CT027996-CT029994; CT033829). Among them, 357 ESTs (37%) corresponded to singletons and 610 ESTs (63%) were clustered in 129 TC and ~90% of the ESTs were supported on both 5’ and 3’ ends. A BlastN search showed that 467 of these ESTs have a homolog in the P. trichocarpa genome sequence in the Joint Genome Institute (JGI) database. The remaining TCs showed no significant similarity to any genes in the NCBI databases suggesting that they are either absent from the current P. trichocarpa genome sequence assembly (version 1.1) or they might be specific of P. trichocarpa x P. deltoides ‘Beaupré’. The sequences showed no significant hits against M. larici-populina and other basidiomycetes genomes on the JGI portal (data not shown). A summary of homology searches against GenBank using the Blast algorithm is shown in Supplemental Table S1. ESTs from ribulose 1,5-bisphosphate carboxylase oxygenase (rubisco) and chlorophyll a/b binding proteins (CAB) genes were not identified in the SSH cDNA library, whereas they represent 24% of a ‘Beaupré’ cDNA leaf library (Kohler et al., 2003) indicating that the SSH library was efficiently depleted from constitutively expressed transcripts. This analysis indicated that the most prevalent ESTs represented genes directly connected with plant defense and nitrogen metabolism. Among these abundant ESTs, an EST matching an inositol-3-phosphate synthase (I3PS) gene was the most frequently detected sequence (199 occurrences; 20% of ESTs) (Table 1). Several transcripts corresponding to defense-related genes (PR-1, PR-2, PR-3, PR-5) and pathogen perception (RLK, LRR, ankyrin protein) were also among the most abundant SSH ESTs. For example, PR-1 transcripts represented about 4 % of the SSH transcripts indicating a striking upregulation of its expression. A least three distinct types of chitinase-like genes, including basic (PR-8) and acidic (PR-3) chitinases, were expressed in rust-infected leaves. Transcripts coding for aspartate aminotransferase, asparagine synthetase, and NADHglutamate synthase, with no obvious direct defensive roles, were also abundant in the SSH library.

Rinaldi, page 9, Plant Physiology Identification of rust-responsive genes at 48 hpi using whole genome oligoarrays Microscopy observations (Figure 2) and qPCR measurement of fungal DNA (Figure 3) showed a shift in fungal progression between compatible and incompatible interactions at 48 hpi. A strong difference in lignin deposition at infection sites was observed in the case of the incompatible interaction at 96 hpi (Figure 4) suggesting that the host molecular response probably initiated after the fungus entered into the mesophyll (12 hpi)(Figure 2D, E) and when haustorial infection structures are differentiating. We thus investigated changes in gene expression in ‘Beaupré’ leaves at 48 hpi in compatible and incompatible interactions (Figure 1) using the NimbleGen Populus whole genome expression oligoarray (Tuskan et al., 2006). We identified 280 (0.4 %) and 1730 (2.6 %) transcripts differentially accumulated (≥ 2-fold) in the compatible and incompatible interactions, respectively, compared to control leaves mockinoculated with water (Table 2 and Supplemental Table S2). Among these transcripts, 150 showed an increased concentration ≥ 3-fold in the incompatible interaction and only seven in the compatible interaction.

Incompatible interaction The transcript showing the highest rust-induced accumulation (32-fold) in the incompatible interaction corresponded to a P. trichocarpa gene model (Protein ID #678883) with no sequence similarity in the non redundant NCBI database or the Arabidopsis genome. The corresponding genomic sequence is located at the begining of scaffold 5059 of the P. trichocarpa genome assembly and is truncated in 5’. This transcript showed a strong homology with several Populus ESTs in NCBI dbEST. These ESTs are longer in their 5’ and 3’ ends of nucleotide sequences and encode a 82 amino acid polypeptide with no ortholog in databases. SignalP 3.0 (http://www.cbs.dtu.dk/services/SignalP/) analysis identified a signal peptide of 24 amino acid length and Phobius (http://phobius.cgb.ki.se/) predicted a non cytoplasmic localisation for the protein suggesting a putative localisation outside of the plant cell. Genes encoding enzymes known to be associated with the host defense response were highly induced at 48 hpi in the incompatible interaction and presented no significant regulation in the compatible interaction. These genes encode several types of PR proteins, such as PR-1 homologs, basic glucan-endo-1,3-beta-glucosidase (PR-2), thaumatin-like and osmotin-like proteins (PR-5), that were also identified in the SSH cDNA library and PR-10like proteins. All those PR transcripts showed an increase ≥ 3-fold compared to the mockinoculated treatment. Among other transcripts showing an important induction in the incompatible interaction (≥ 5-fold accumulation), we detected transcripts coding for components of the signaling pathways (calmodulins), a receptor-like kinase (RLK) and the I3PS identified in the

Rinaldi, page 10, Plant Physiology SSH library. Transcripts related to secondary metabolism and cell-wall synthesis, such as dirigent-like proteins, chalcone-, flavonol- and tropinone reductases, were also detected among transcripts significantly accumulated in the incompatible interaction supporting the observed accumulation of phloroglucinol-stained lignin monomers (Figure 4A). Several rust-induced genes corresponded to different members of the glutathione Stransferase (GST) gene family. Twelve different GST transcripts showed at least a 2-fold accumulation in the incompatible interaction compared to the mock-inoculated treatment. The most strongly accumulated GST transcripts consisted in two phylogenetic groups of sequences (group 1, Protein ID #276538, #277644, #272826; and group 2, Protein ID #657351 and #820835; Table 1) that shared a high sequence similarity (≥ 90 %). Alignment of the oligonucleotide probe sequences matching these GST sequences revealed a significant overlap that may have resulted in possible cross-hybridizations between transcript species. Nevertheless, all transcripts that were strongly accumulated belonged to the tau GST class and not to other classes (i.e., Phi, Theta and Zeta GSTs) described so far in plants (Dixon et al., 2002; Wagner et al., 2002). There were a few transcripts (292) showing a decrease in concentration at 48 hpi in the incompatible interaction. These include several chloroplastic transcripts, as well as different transcripts coding transposable elements (TE), including the magali Spm-like TE (Protein ID#418172) located within a rust-resistance locus in P. deltoides (Lescot et al., 2004). A transcript encoding a lysine decarboxylase also showed a dramatic decrease in concentration at 48 hpi (8-fold). Most of these transcripts also presented a decrease in concentration in the compatible interaction (Table 2).

Compatible interaction Only a few transcripts were significantly up- or down-regulated in the compatible interaction (158 and 122, respectively). The highest increase (4.2-fold) corresponded to a transcript coding for an anthocyanin acyltransferase-like protein. Several transcripts corresponding to signaling components (serine/threonine kinase, calcium binding protein) and LRR containing proteins, including a RLK, were significantly induced (≥ 2.5-fold). Interestingly, a transcript coding a ∆1-pyrroline-5-carboxylase (Protein ID# 421059) showed a 2.5-fold induction. This protein is involved in proline biosynthesis and a regulation of transcripts involved in the catabolism of proline was previously described specifically in the flax/M. lini compatible interaction (Ayliffe et al., 2002).

Identification of rust-responsive genes at 48 hpi using cDNA microarrays Before the availability of the NimbleGen whole genome expression oligoarrays, we carried out a series of transcript profilings of rust-infected (incompatible interaction) and

Rinaldi, page 11, Plant Physiology mock-inoculated (control) P. trichocarpa x P. deltoides ‘Beaupré’ leaves at 48 hpi using 28K PICME cDNA microarrays. Thus, these datasets obtained on different plants (year 2004) than those for oligoarray-based expression profiling (year 2005), were compared to the oligoarray expression profiles. We identified 1614 transcripts corresponding to 1055 P. trichocarpa gene models that were significantly accumulated or decreased (≥ 2-fold) at 48 hpi in the incompatible interaction compared to control leaves. Among these transcripts, 218 showed an increased concentration ≥ 3-fold and 136 a decreased concentration ≤ 3-fold. Transcripts accumulated in response to the rust infection are mostly identical to those described in the oligoarray expression profiling (Table 3 and Supplemental Table S3). The highest levels of rustinduction (≥ 8-fold) were observed for transcripts coding PR proteins such as PR-1, PR-2, PR-5, PR-8 and PR-10 and the Rust-Induced Secreted Protein #678883 (RISP). GST transcript corresponding to Protein ID #820835 showed a 5.9-fold induction. Besides, two transcripts coding GSTs not significantly regulated in the whole genome oligoarray analysis and belonging to the same rust-induced tau GST class (see above) were detected as significantly induced on PICME microarrays (Protein ID #670248, 9.4-fold and protein ID #658124, 6-fold). Several cytochrome-P450 transcripts showed contrasting expression profiles, some being strongly induced and others repressed as observed on the whole genome oligoarray. Several other transcripts related to redox regulation also showed a slight decrease in concentration at 48 hpi in the incompatible interaction (e.g., peroxidases, thioredoxin) whereas other transcripts in the same cellular category were strongly induced (e.g., GSTs, protein disulfide isomerase, peroxidases). Several transcripts involved in the photosynthetic machinery and carbon metabolism (e.g., light harvesting complex chlorophyll a/b binding proteins,

photosystem

I

and

II

polypeptides,

ribulose-1,5-bisphosphate

carboxylase/oxygenase, RuBisCO activase) and two different transcripts involved in thiamin biosynthesis showed a decreased concentration at 48 hpi in the incompatible interaction.

Validation of rust-regulated genes using cDNA macroarrays and RT-qPCR Expression data were further carried out at 12, 24 and 48 hpi in both compatible and incompatible interactions by either a RT-qPCR approach or reverse-northern on a Populus 4K cDNA Nylon macroarray (Supplemental Table S4) with different sets of biological replicates than those used in the expression profiling experiments described above. We measured transcripts coding for PR-1, PR-5 and PR-10 proteins as typical genes triggered by host defense reactions at 48 hpi in leaf tissues. The transcripts coding for I3PS (Protein ID #832275), the dirigent-like protein (Protein ID #711753), NPR1 (Protein ID #253241) and the RISP (Protein ID #678883) that showed the highest transcripts

Rinaldi, page 12, Plant Physiology accumulation based on the whole genome oligoarrays, cDNA microarrays or SSH library sequencing were also measured. Genes coding for a photosystem I centre reaction subunit (Protein ID #711610) and the small subunit of the RUBISCO (Protein ID #813777) that were slightly down-regulated during both types of interactions were included in the set of genes tested by RT-qPCR. Strong accumulation of the selected rust-induced transcripts was confirmed by RTqPCR amplification in leaf tissues challenged by the incompatible strain of M. larici-populina compared to mock-inoculated tissues. Maximum induction of PR-genes was reached at 48 hpi (Figure 5) and interestingly NPR1 transcript showed a peak of expression at 24 hpi. The transcript coding the RISP (Protein ID #678883) with the highest accumulation (32-fold) detected at 48 hpi with whole genome oligoarray profiling, showed a different profile with RTqPCR. A strong induction (7-fold) was measured at earlier time-points in the incompatible interaction and a lower induction level was detected at 48 hpi. We thus measured the level of this latter transcript by RT-qPCR with the RNA samples used to perform the whole genome oligoarray hybridizations and we observed a 56 (±8)-fold accumulation at 48 hpi (Figure 5). This observation confirmed that the rate of induction is influenced by the physiological status of the infected plants rather than strong technical biases in array measurement. In some cases, RT-qPCR revealed a late induction of transcripts coding PR proteins (e.g., PR-1 and PR-10; Figure 5) at 48 hpi in the compatible interaction with lower levels than those reached in the incompatible interaction whereas array analysis did not revealed such induction.

Comparison of the different transcript profiling approaches Genes showing striking differences in transcript concentration during the incompatible interaction were detected by the different transcript profiling approaches, i.e.,SSH cDNA sequencing, whole genome oligoarrays, cDNA microarrays, cDNA macroarrays and RTqPCR indicating consistancy of the various approaches (Figure 5; Table 4), although the regulation ratio may vary. For example, the RISP transcript that showed the highest accumulation (32-fold) based on the whole genome oligoarrays was represented by several ESTs on the cDNA microarrays and showed a level of accumulation over 10-fold (Protein ID #678883, Table 3). In contrast, the strongly induced transcript coding PR-5 protein (Protein ID #669475) showed a 28.8-fold induction based on the cDNA microarray and was quite abundant in the SSH library (2 % of the cDNA clones), whereas a lower level was detected on the whole genome oligoarray. The I3PS transcript that was highly abundant in the SSH library (~20.4 % of the cDNA clones) only showed ~5-fold accumulation in both whole genome oligoarray and cDNA microarray analyses. In addition to bias resulting from the different technologies (full length cDNA vs. 60-mer oligonucleotide probes), differences in mRNA accumulation detected between the various profiling approaches likely reflect the fact

Rinaldi, page 13, Plant Physiology that RNA were extracted from different sets of biological replicates with delayed plant defense response due to the variable physiological status of cuttings grown in greenhouse. A high proportion of rust-induced genes were identified in the SSH library. This technique presents the potential of identifying rare transcripts or genes expressed locally that may be missed in microarray expression profiling (e.g., statistics stringency in array analysis). Thus, this approach is not redundant but complementary to array-based transcriptome profiling.

DISCUSSION Reactions that lead to programmed cell death in incompatible interactions between plant and hemi-biotrophic or necrotrophic pathogens preventing the pathogen to spread in plant tissues have been largely described in several plant pathosystems (Heath, 2000). In contrast, interactions involving biotrophic pathogens, with their sophisticated type of pathogenesis that keeps plant cells alive and minimizes tissue damage in susceptible hosts, are poorly known. The uredinial stage of rust fungi is generally taking place through stomatal penetration, and most studies suggest that host compatibitity requires the ability for the fungus to avoid or negate pre-haustorial defenses within the substomatal cavity of the host leaf, breach the mesophyll plant cell wall to form the first haustorium, and develop a biotrophic interaction with the living invaded cell to support further fungal growth (SchulzeLefert and Panstruga, 2003; Glazebrook, 2005; Spanu, 2006). Recent work described haustorially expressed secreted proteins of the rust biotrophic pathogen Melampsora lini (Catanzariti et al., 2006) that led to HR when expressed in planta, indicating a probable direct R-Avr recognition system in Linum usitatissimum challenged by an avirulent strain of M. lini (Dodds et al., 2006). In the present study, we describe at the microscopic, histological and transcriptomic levels a novel pathosystem involving P. trichocarpa x P. deltoides ‘Beaupré’ challenged by urediniospores of the leaf rust basidiomycete M. larici-populina. The cultivar ‘Beaupré’ is resistant to M. larici-populina isolate 93ID6 (pathotype 3-4) and susceptible to isolate 98AG31 (pathotype 3-4-7) (Barrès et al., 2006). Unexpectedly, there was no significant difference in fungal growth from spore germination to contact with mesophyll cell between these two isolates. Spore germlings of both isolates were able to penetrate the leaf through stomatas in the first hours after inoculation, forming primary infection structures (i.e., substomatal vesicles) in the spongy mesophyll and reaching mesophyll cells for infection. Appressoria were formed on leaf surface but are not a prerequisite to penetrate inside plant tissues as frequent direct hyphal penetration through stomatas were observed. Based on the amount of fungal rDNA, differences of growth in planta were only noticeable between

Rinaldi, page 14, Plant Physiology compatible and incompatible isolates after 24 hpi (Figure 3). The compatible isolate then spread in leaf tissues and colonized the whole mesophyll, while the incompatible strain remained in the spongy mesophyll (Figure 2F and 2H). Fungal growth increased until the compatible strain developed spore-forming cells and produced typical golden pustules filled with masses of urediniospores on the lower leaf surfaces between 6 and 7 dpi. At this stage, the resistant phenotype was generally characterized by the presence of scattered necrotic lesions and the absence of macroscopic symptoms. Similar responses have been reported in P. deltoides x P. nigra ‘Ogy’ inoculated with virulent and avirulent isolates of M. laricipopulina (Laurans and Pilate, 1999). We were not able to detect H2O2 accumulation through DAB staining in leaf tissues challenged by the incompatible strain of M. larici-populina. H2O2 production possibly occurred transiently and only in plant cells challenged by M. larici-populina during infection. Supporting this contention, several genes encoding enzymes of the redox regulation pathways such as GSTs, ascorbate peroxidases and superoxide dismutase were highly up-regulated at 48 hpi. Studies conducted at the protein level confirmed the up-regulation of thioredoxin and peroxiredoxin during Populus-Melampsora interaction (Rouhier et al., 2004; Vieira et al., 2005). The lack of H2O2 accumulation has been previously reported in plant interacting with biotroph pathogens (Glazebrook, 2005). This may reflect the specific and complex biotrophic relationships between rust and living host cells. As observed by Laurans and Pilate (1999) and in the present study, the necrotic tissues are highly localized to limited area (Figure 1) supporting the fact that H2O2 production related to HR was not spreading far from infection sites in leave tissues. Phloroglucinol staining confirmed that a massive production of monolignols was induced upon inoculation of plant tissues by the incompatible rust strain (Figure 4). Such compounds are believed to play a role in plant defense (Dixon, 2001). Several genes of the phenylpropanoid pathways and dirigent-like proteins encoding genes were induced at 48 hpi in inoculated leaves prior observation of the maximum level of phloroglucinol staining. Strong production of secondary metabolites in colonized leaves likely lead to the synthesis of phytoalexins and lignin deposition in secondary cell walls restricting the fungal proliferation as showed in the cowpea-U. vignae interaction and in other pathosystems involving biotrophic fungal pathogens (Heath, 1997; Heath, 2000).

Callose synthase and

phenylalanine ammonia-lyase (PAL) genes are often reported as marker genes of lignin and callose deposition although the levels of induction may strongly vary from one interaction to another. In the present study, the homologs of Populus PAL and callose synthase were not significantly induced during the incompatible interaction at the time-points tested. Induction of

Rinaldi, page 15, Plant Physiology dirigent proteins encoding transcripts have been reported in conifers submitted to wounding or insect-attacks (Ralph et al., 2006b) and their products may participate to a general stress response in trees submitted to biotic or abiotic stress. Studying the transcriptome of rust-infected leaves with whole genome oligoarray harboring more than 50,000 putative gene models from the P. trichocarpa genome sequence (Tuskan et al., 2006) identified 2397 rust-responsive genes (~3% of the total set of arrayed genes) that may play a role in defense reactions in the incompatible interaction or, conversely, in supporting fungal growth in susceptible plants. As expected from previous studies in model species (Schenk et al., 2000; Mahalingam et al., 2003), many functional groups of genes were found to be involved in the defense response, including signal transduction pathways components, genes stimulated during biotic or abiotic stress responses and genes of primary and secondary metabolisms. A striking alteration in steadystate RNA populations took place at 48hpi, whereas few genes were regulated at earlier stages of interaction when tested by RT-qPCR or cDNA macroarrays. This suggests that gene expression in response to rust infection is activated later after the fungal cells entered in contact with leaf surface and colonized the substomatal cavity. Recognition of the pathogen is likely taking place upon triggering of specific recognition mechanisms when fungal hyphae are elongating within the mesophyll and attempt to penetrate the plant cellwall barrier to form haustorial structures (Figure 2). Presence of strongly inducible genes in the incompatible interaction indicates that the rust infection has had a significant impact on the leaf transcriptome despite the limited amount of fungal mycelium (Figure 3) during the early stages of invasion. The observed differences between the transcriptomes of leaves infected by either the compatible or incompatible isolates were striking. The incompatible strain elicited up-regulation of a wide range of defense-related genes (e.g., PR-proteins, GSTs), whereas these genes were not induced by the compatible strain. Several genes that may participate to the perception of the rust pathogen by sensing avirulence products released by invading hyphae were differentially accumulated in the incompatible interaction between P. trichocarpa x P. deltoides and M. larici-populina. We identified transcripts coding for putative LRR disease resistance proteins (Protein ID #645750; Protein ID #826060) that showed an induction of their expression (Table 4). Transcripts coding for LRR receptor protein kinases (Protein ID #417599 and #171587), showing homology with respectively RLK5 and PERK1, were also induced during the incompatible interaction. PERK1 encodes a putative receptor kinase with an extracellular domain with sequence identity to cell wall-associated extensin-like proteins. PERK1 transcripts are rapidly expressed upon mechanical wounding, in response to Sclerotinia

Rinaldi, page 16, Plant Physiology sclerotiorum and SA and methyl jasmonate application (Silva and Goring, 2002). RLK5, also named HAESA, is involved in the control of floral abscission in A. thaliana (Haffani et al., 2004). These receptor kinases belong to a large family that had been shown to play a role in microbial sensing and they may likely participate to pathogen perception in poplar. In flax, the M. lini products of the avirulence genes Avr567 are expressed in haustoria and recognized inside plant cells (Dodds et al., 2004). This recognition occurs through a direct interaction with the L resistance genes products of flax (Dodds et al., 2006). L genes are members of the NBS-LRR resistance genes family (Ellis et al., 1999). We did not identify any members of this familly among rust-induced genes. These plant proteins are responsible for the detection of pathogens in natural conditions and should be constitutively expressed, thus their expression may not necessarily be under transcriptional control during the infection process. None of the rust-induced putative receptors and LRR proteins is located in the superclusters of NBS-LRR R genes containing the MER locus (Tuskan et al., 2006) or close to the rustresistance loci identified in poplar by genetic mapping (Cervera et al., 2004; Lescot et al., 2004; Jorge et al., 2005). Strikingly, a significant induction of RLK transcripts was also detected in the compatible interaction at 48 hpi (2.7-fold). Upon recognition of the pathogen aggression, a complex network of signaling enzymes and molecules relays the information in the plant cell to the nucleus where specific defenserelated gene expression is triggered. As shown in several other plant-fungus interactions, components of the signaling pathways were induced in the incompatible interaction between P. trichocarpa x P. deltoides ‘Beaupré’ and M. larici-populina. These include transcripts from the calcium- and ethylene-related pathways, calmodulin, calreticulin, ACC oxidase, 14-3-3 proteins and EREBP and MYB families transcription factors. NPR1 is an important regulator of PR genes expression through binding to transcriptional regulators TGA elements and a low accumulation (~2-fold) of its transcript has been reported in different pathosystems (Glazebrook, 2005). P. trichocarpa x P. deltoides ‘Beaupré’ NPR1 transcript (Protein ID #253241) was accumulated at 24 and 48 hpi in poplar leaves during the incompatible interaction (Figure 5) prior the strong induction observed for targeted PR-genes. Interestingly, we also detected the induction of a transcript coding for NPR1/NIM1-interacting protein (NIMIN-1) at 48 hpi (Table 4). NIMIN-1 directly interacts with NPR1 and can modulate its activity and expression of PR-genes in A. thaliana (Weigel et al., 2005). A gene that showed among the highest levels of induction, using the different transcript profiling approaches, encoded a I3PS. The protein is involved in the production of inositol-phosphate, a

metabolite that

could

lead

to

the

production

of

various

products

such

as

phosphatidylinositides, cell-wall components or oligosaccharides of the raffinose series (Loewus and Murthy, 2000). Phosphatidylinositols (PI), like inositol 1,4,5-trisphosphate, are

Rinaldi, page 17, Plant Physiology important secondary messenger of the cell transduction pathways that play a crucial role in calcium homeostasis in plant cell (Munnik et al., 1998). Involvement of calcium-related signaling in plant/rust interaction has been previously reported (Xu and Heath, 1998). Several calcium-binding proteins encoding genes are induced in poplar leaves during the incompatible interaction with M. larici-populina and I3PS may contribute to the production of PI involved in calcium regulation. Considering the strong induction of I3PS transcript in poplar leaves during the incompatible interaction with M. larici-populina, addressing the exact role of inositol-phosphate in response to either biotic or abiotic stress requires further investigations. Within transcripts with the highest rust-induced accumulation (> 10-fold) in the incompatible interaction several encoded PR-proteins such as PR-1, PR-2 (1,3-β-glucanase), PR-3 (acidic chitinase), PR-5 (thaumatin-like protein), PR-8 (basic chitinase) and PR-10 (ribonuclease). All these enzymes are known for their antifungal properties (Van Loon and Van Strien, 1999) and are typical SA-induced marker genes of plant response to bacterial and fungal attacks (Van Loon and Van Strien, 1999; Schenk et al., 2000). There is evidence that Uromyces rust species are susceptible to apoplastic PR proteins, including PR-1 (Rauscher et al. 1999). Interestingly, a gene encoding a PR-10 protein was also activated in epidermal cells of resistant cowpea challenged by the cowpea rust fungus and prior of the fungus entering the cell lumen (Mould et al., 2003). We identified many expressed hypothetical proteins among rust-responsive genes. Of interest is the RISP whose transcript showed the strongest (32-fold) induction in the incompatible interaction in the whole genome oligoarray analysis. The RISP may play a role in early defense against M. larici-populina and it remains to address its exact role to determine whether it is a novel PR protein in Populus. In a compatible biotrophic interaction, the invading hyphae are able to alter the hostplant metabolism in such a way that increasing amount of nitrogen and carbon metabolites are mobilized and translocated to fungal cells (Mendgen and Hahn, 2002; Panstruga, 2003; Both et al., 2005). In the compatible interaction between P. trichocarpa x P. deltoides ‘Beaupré’ and M. larici-populina, we did not detect a striking induction of metabolism-related elements and only a few genes encoding transporters and enzymes of the carbon metabolism were slightly induced with the cDNA-macroarray experiment. We observed a 2.5fold induction of a Populus transcript encoding a ∆1-pyrroline-5-carboxylate synthetase (Protein ID #421059, Table 2) in the compatible interaction whereas no induction of this gene was observed in the incompatible interaction. This enzyme catalyzes the two first steps of proline synthesis. The fis1 transcript encodes a ∆1-pyrroline-5-carboxylate dehydrogenase which is specifically expressed in the flax/M. lini compatible interaction (Ayliffe et al., 2002).

Rinaldi, page 18, Plant Physiology FIS1 is involved in the catabolism of proline to glutamate and a possible link between such catabolic activity and the fungal metabolism remains unclear.

In conclusion, the rust-responsive genes from P. trichocarpa x P. deltoides ‘Beaupré’ presented here are a valuable resource for further functional genomics studies addressing mechanisms of durable resistance in a perennial species, Populus, and other Salicaceae. Comparative analysis of compatible and incompatible interactions showed the stimulation of several known genes involved in plant defense reactions to biotrophic pathogens like PR proteins targeted by plant recognition systems (i.e., R genes). New candidate genes, such as I3PS and RISP, that may participate to a specific Populus response to rust were also detected. The accumulation of most rust-responsive transcripts occurred at a late stage (48 hpi) when fungal hyphae penetrate the mesophyll cells, although a few transcripts were induced at earlier timepoints. It appears that a perennial species, such as Populus, does not use no specific arrays of defense proteins. Expansion of NBS-LRR genes as well as PR proteins gene families in Populus genome (Tuskan et al., 2006) may underly specific recognition systems for an efficient targeting of certain PR proteins within expanded families. Further analyses, including gene inactivation, will address whether the observed quantitative differences in gene expression between the compatible and incompatible infections are sufficient to explain the drastic difference in the interaction of both M. larici-populina strains with ‘Beaupré’. Rust-responsive genes will be used in genetic studies, including ecotilling, comparing qualitative and quantitative resistances to rust in various poplar cultivars in order to help in marker-assisted breeding of new genotypes for durable resistance against M. laricipopulina.

MATERIALS AND METHODS

Plant materials and growth conditions All experiments were performed on rooted cuttings of the hybrid poplar P. trichocarpa x P. deltoides ‘Beaupré’. For the analysis of compatible and incompatible poplar-rust interactions, P. trichocarpa x P. deltoides ‘Beaupré’ plants were grown for 12 weeks in a greenhouse from dormant cuttings in 5 L pots containing a sand-peat (50-50% v/v) mixture, with an initial fertilization of 1.45 g.L-1 CaO and 6 g.L-1 of slow release 13:13:13 N:P:K fertilizer (Nutricot T 100, Fertil, Boulogne-Billancourt, France). ‘Beaupré’ plants were watered daily with deionized water under 16/8 hr photoperiod in greenhouse conditions with supplemental artifical light to complement to a minimum illumination of 200 µmol.s-1.m-2 during winter season. After 12 weeks, young trees were > 1 m height and presented 10 to 14 fully expanded leaves.

Rinaldi, page 19, Plant Physiology Inoculation procedures Two isolates of M. larici-populina were used in this study: the virulent 98AG31 (pathotype 34-7) and avirulent 93ID6 (pathotype 3-4) isolates (Barrès et al., 2006). The urediniospores of the two M. larici-populina isolates were multiplicated on detached leaves of P. deltoides x P. nigra ‘Robusta’ which is susceptible to all M. larici-populina strains and collected at 10 dpi. The spores were dried and were kept in a dry atmosphere at 1° C. Fully expanded leaves from Leaf Plastochrony Index (LPI) 5 to 9 were detached from several ‘Beaupré’ plants and spray-inoculated on their abaxial surface with an urediniospore suspension in water-agar (0.1 g.l-1) adjusted to 100,000 urediniospores.ml-1 or with water-agar as a control (mockinoculated leaves). Inoculations were done by pooling three leaves of different LPI from different plants (i.e., LPI 5 from plant 1, LPI 8 from plant 2 and LPI 9 from plant 3) for each treatment and each time-point. The inoculated leaves (i.e., 27 leaves in total) were then incubated with the abaxial surface uppermost, floating on deionized water in 22.5 x 22.5 cm Petri dishes, at 19 ± 1 °C under continuous artificial illumination (fluorescent light, 25 µmol.s1.m-2), for various durations. The material harvested at different time-points in the different treatments consisted in 7 cm2 (30 mm diameter) leaf disks randomly sampled on the overall leaf surface. The leaf disks were immediatly snap-frozen in liquid nitrogen and transfered to 80°C until further analysis.

Microscopy analysis and scanning electron microscopy analysis Fungal infection structures at leaf surface were observed by clearing inoculated leaf disks (control, compatible and incompatible) in boiling ethanol (70% v/v) for 10 min in a water bath, followed by 10 minutes incubation in an aniline blue solution (10 mg/ml)( Sigma-Aldrich, SaintQuentin Fallavier, France) and washes in distilled water. Observations by light microscopy were carried at a magnification of 400X on a OPTIPHOT system (Nikon, Japan). In order to obtain a high density of M. larici-populina urediniospores on the abaxial surface of poplar leaves for scanning electron microscopy observation, dry-inoculations were performed with an air pistol (DIANA model 3, Mayer and Grammelspacher, Rastatt) with about 1 mg of spores (ca. 4.105 spores) inoculated for each shot. For each combination of time-point (2, 6, 12, 24, 48, 96, 120 and 192 hpi) x treatment (compatible and incompatible interactions), two leaves were inoculated and observations were carried on three leaf fragments of 1cm2, snap-frozen immediately after harvesting. Samples were fractured in liquid nitrogen and were attached to aluminium stubs on a Peltier stage (-50°C). They were then examined under a variable pressure scanning electron microscope (model 1450VP, Leo, Cambridge, UK). Backscattered secondary electron images were observed at an accelerating voltage of 15 KV, a working distance of 10 mm and at a pressure chamber of about 30 Pa. Digital images of samples (abaxial side and transversal section) were captured using the microscope software

Rinaldi, page 20, Plant Physiology and edited with Adobe Photoshop CS2 (Adobe Systems France SAS, Paris, France) to adjust brightness and contrast or to artificially paint fungal hyphae colonizing the leaf tissues.

Reactive oxygen species and lignin monomers detection Production of ROS was investigated in inoculated leaf disks (ø 30 mm) using the DAB technique according to Thordal-Christensen et al. (1997). Leaf disks were incubated in a solution containing 0.2% (w/v) of 3,3-diamino-benzidine tetrahydrochloride (Sigma-Aldrich) in a shaking bath for 24h at 25°C in the dark. Other infiltration procedures (e.g. vacuum forced infiltration) were also tested. An evapotranspiration system was set with complete leaves where petioles were standing in DAB solution as described in Orozco-Cardenas and Ryan (1999) for up to 24h. Then, leaf disks were cleared in boiling ethanol (70% v/v) in a water bath for 10 min and washed in water. Positive controls for DAB coloration were performed by injection of several H2O2 solutions of various concentrations (0.5 to 20%; Sigma-Aldrich) through syringes on uninfected leaves and by wounding tissues of both non-inoculated and inoculated leaves. Magnification for observation was of 100X. All observations were carried on three replicates of each treatment (control, compatible and incompatible) at 2, 6, 12, 24, 48 and 96 hpi. Light microscopy was carried on an OPTIPHOT system (Nikon). Lignin monomers production was examined using the Wiesner coloration procedure with standard protocol according to Nakano and Meshitsuka (1992). Control and inoculated leaf disks were incubated in a phloroglucinol solution (2% w/v) for 5 minutes in the dark. Disks were then incubated in a 6N HCl solution for 5 minutes, rinsed and kept in water for further observations. Observations were carried on replicates at 2, 6, 12, 24, 48 and 96 hpi, and captured with a digital camera Sony F707 (Sony, Paris, France).

DNA and RNA extraction Total DNA was extracted from leaf tissues with the DNeasy Plant Minit Kit (QIAgen, Courtaboeuf, France) from 100 mg of frozen (-80°C) material. RNA was removed by the addition of RNase A during extraction. DNA quality was verified by electrophoresis on agarose gel and DNA quantity was measured by spectrophotometry (Sambrock et al., 2001). Total RNA extraction was performed with the RNeasy Plant Mini Kit (QIAgen) from 100 mg of pooled (-80°C) foliar disks harvested from leaves of various LPI and various individual poplar plants for each treatment considered. Pooling of samples from different trees and LPI helped in minimizing the variations between individual RNA samples. Extraction from leaf tissue was modified as described in Kohler et al. (2004) and DNase I (QIAgen) treatment was included in the RNA extraction procedure according to the manufacturer’s instructions to eliminate traces of genomic DNA. Quality and quantity of RNA samples were checked by electrophoresis on agarose denaturing gel and by spectrophotometry for cDNA library

Rinaldi, page 21, Plant Physiology construction and cDNA-array experiments (Sambrock et al., 2001) while quality and quantity of RNA samples used for hybridization with NimbleGen Populus arrays were assessed on the RNA analyzer Experion (Bio-Rad, Marne-la-Coquette, France) following manufacturer’s recommendation.

Amplification of rDNA ITS by qPCR Development of the compatible and incompatible rust strains was followed in planta by specific amplification of the nuclear rDNA internal transcribed spacer (ITS) on total DNA extracted from inoculated leaf tissues (Boyle et al., 2005). The same amount of 100 ng DNA was used for each qPCR amplification. Amplifications were performed in 1X iQ SYBR Green Supermix (Bio-Rad) with 0.3 µM of specific 5’- and 3’-primers for M. larici-populina (GenBank accession

#AY375268;

M. larici-populina

primers

ITS-Mlp-F,

GAGCGCACTTTAATGTGACTC; ITS-Mlp-R, ACTTAATTAAGTTGATAGGG; Frey et al., unpublished) with a MJ-opticon2 DNA engine (Bio-Rad). Assuming a signal intensity proportional to amplified ITS sequences, we considered the pathogen growth as the relative difference (2-∆Ct) of fungal ITS amplicons calculated for compatible or incompatible interactions compared to mock-inoculated tissues at 2, 6, 12, 24, 48 and 96 hpi. Amplifications were carried on in triplicates and a statistical analysis (t-test) based on ∆Ct curves was performed with the software Statview 5.0 (SAS Institute, Cary, NC, USA) for Mac OS 9. A standard curve was drawn for conversion of Ct values to pathogen DNA mass (Boyle et al., 2005).

Sequencing of cDNAs from SSH library Double-stranded cDNAs corresponding to mRNAs expressed in P. trichocarpa x P. deltoides ‘Beaupré’ leaves upon infection with the incompatible strain of M. larici-populina at 12, 24 and 48 hpi (tester probe; 1/3, 1/3, 1/3), and cDNAs from ‘Beaupré’ mock-inoculated leaves at 12, 24 and 48 hpi (driver probe; 1/3, 1/3, 1/3), were separately obtained by using the SMART-PCR cDNA Synthesis Kit (BD Biosciences). The mixed-tester cDNA pool was subtracted by the mixed-driver probe (SSH) following the manufacturer’s instructions (PCRSelect cDNA Subtraction Kit, BD Biosciences) (Diatchenko et al., 1996). These subtracted cDNAs were sub-cloned in pGEM-T plasmids (Promega, Charbonnières, France) and were used to transform Escherichia coli DH10b bacteria (Invitrogen, Cergy-Pontoise, France). Purification by rolling circle amplification (RCA) and Dye Terminator sequencing of plasmid DNA from SSH clones were performed at the GENOSCOPE (Centre National de Séquençage, Evry, France) on ABI3730xl DNA analyzers (Applied Biosystems, Courtaboeuf, France). Raw sequence data was edited using SEQUENCHER 4.2 (Gene Codes Corporation, Ann Arbor, MI, USA) for Mac OS X. Leading and trailing vector and polylinker

Rinaldi, page 22, Plant Physiology sequences were removed by SEQUENCHER filters. Group of sequences were assembled into clusters using the contig routine of SEQUENCHER and parsed using dedicated Perl scripts.

NimbleGen Populus expression oligoarrays The P. trichocarpa whole genome expression oligoarray version 2.0 (NimbleGen Systems Inc, Madison, WI, USA) consisted of 65,965 probe sets corresponding to 55,970 gene models predicted on the P. trichocarpa genome sequence v1.0 and 9,995 aspen cDNA sequences (Populus tremula, Populus tremuloides, and P. tremula x P. tremuloides). The Populus v2.0 oligoarray (Brunner, DiFazio and Dharmawardhana, unpublished data) is fully described in the platform GPL2699 stored in the Gene Expression Omnibus (GEO) at NCBI (http://www.ncbi.nlm.nih.gov/geo). For hybridization with whole genome oligoarray, a series of three replicates was obtained from mock-inoculated P. trichocarpa x P. deltoides ‘Beaupré’ leaves (control), and leaves infected with either compatible or incompatible strains of M. larici-populina at 48 hpi. Preparation of samples, hybridization procedures, and data acquisition and normalization were performed at the NimbleGen facility (NimbleGen Systems, Reykjavik, Iceland) following the manufacturer’s procedures. Average expression levels were calculated for each gene from the independent probes on array and were used for further analysis. Log2-transformed data

were

calculated

and

were

subjected

to

the

CyberT

statistical

framework

(http://www.igb.uci.edu/servers/cybert/) (Long et al., 2001; Baldi and Hatfield, 2002) by using the ‘bayesreg’ script in the R statistical package (http://www.r-project.org/) with the following parameters: bayesT(aData,3,3,TRUE,1,TRUE,101,9). Statistical analyses were conducted separately for compatible and incompatible interactions vs. mock-inoculated tissues in a simple paired data comparison model with all gene probe duplicates considered independently. Gene probes that showed a mean intensity close to the background level (i.e., lower than 200) in all experimental conditions were removed. Transcripts for which probe duplicates both showed a P-value lower than 0.05 were considered as significantly regulated. A subset of transcripts that showed a 3-fold increase or 3-fold decrease in abundance in one treatment compared to the control was then selected. All materials and procedures descriptions comply MIAME standards set for array data (Brazma et al., 2001). The complete expression dataset is available as series accession number GSE7098 in the GEO at NCBI.

cDNA microarrays The PICME (Platform for Integrated Clone Management; http://www.picme.at/) Populus microarray, composed of 28,000 elements including 23,500 cDNAs, is described in the

Rinaldi, page 23, Plant Physiology platform GPL4874 stored in the GEO at NCBI. This set of cDNAs corresponds to ~10,000 different predicted gene models in the P. trichocarpa genome sequence (Tuskan et al., 2006). For hybridization with PICME microarrays, a series of three replicates was obtained from mock-inoculated P. trichocarpa x P. deltoides ‘Beaupré’ leaves (control), and leaves infected with the incompatible strain of M. larici-populina at 48 hpi. Samples details and hybridization procedures are fully described in samples series GSM162978 and GSM162979 deposited in the GEO at NCBI. Microarray images were acquired on an Axon GenePix 4000B scanning device (DIPSI, Châtillon, France) at a resolution of 10 µm. Quantitation of signals was done with the GenePix Pro 5 software (Axon, DIPSI) with automatic detection of background levels by block and lowess selected for normalization of signals. Mean intensities in each channel were used for quality control and log-transformed ratios were calculated on the ratios of mean signals. Log-ratios were then submitted to a t-test using the CyberT website. Only two replicates were retained for the statistical analysis as one replicate suffered from post-processing hybridization problems. Based on the statistical analysis, a gene was considered significantly up- or down-regulated if the t-test associated Bayes-lnP value was lower than 0.01 and the ratio ≥ 3-fold. All materials and procedures descriptions comply MIAME standards set for array data (Brazma et al., 2001). The complete expression dataset is available as series accession number GSE7049 in GEO at NCBI.

cDNA macroarrays The P. trichocarpa x P. deltoides ‘Beaupré’ macroarray, composed of 4,600 cDNA, is fully described in the platform GPL4887 stored in the GEO at NCBI. For hybridization with cDNA macroarrays, a series of three independant biological replicates was obtained from mock-inoculated P. trichocarpa x P. deltoides ‘Beaupré’ leaves (control), and leaves infected with either compatible and incompatible strains of M. larici-populina at 12, 24 and 48 hpi. Hybridization, image acquisition and analysis were performed as previously described (Duplessis et al., 2005; Gupta et al., 2005). Data quality assessment was performed with the Cyber-T web interface. Based on the statistical analysis, a gene was considered significantly up- or down-regulated if the t-test associated ln-P value was lower than 0.05 in at least one treatment at any time-point. For the final analysis of expression patterns, fold change of gene expression in compatible or incompatible interaction compared to mock-inoculated leaves were averaged and genes having their expression falling between 0 and 1 were multiplied by -1 and inverted to facilitate their interpretation. All materials and procedures descriptions comply MIAME standards set for array data (Brazma et al., 2001). The complete expression dataset and samples details are available in series GSE7121 described in the GEO at NCBI.

RT-qPCR analysis

Rinaldi, page 24, Plant Physiology To allow the amplification of specific transcripts by RT-qPCR, we designed primers from the P. trichocarpa gene models coding for the PR proteins PR-1, PR-5, and PR-10 (Protein ID #550049, #669475 and #827390 respectively), I3PS (Protein ID #832275), NPR1 (Protein ID #253241), dirigent-like protein (Protein ID #711753), RISP (Protein ID #678883), ribulose bisphosphate carboxylase oxygenase (Protein ID #813777), PSI reaction centre subunit IV (Protein ID #711610) and arabinogalactan protein (Protein ID #573930). The primers were designed in the coding sequence and amplified fragments showed a length ranging between 160 and 271 nt. Primers list is detailed in Supplemental Table S5. A BlastN against the P. trichocarpa genome sequence was performed for each primer sequence in order to verify the absence of cross-annealing in other regions of the P. trichocarpa genome sequence. RNA samples used for RT-qPCR corresponded to an additional biological replicate (year 2005) to the ones used in the transcriptomic analyses mentioned above. First strand cDNAs were synthesized from 1 µg Dnase-treated total RNA using the iScript cDNA synthesis Kit (Bio-Rad) in a total volume of 20 µl according to the manufacturer’s instructions. Two microliters of RT products were amplified by PCR in 1X iQ SYBR Green Supermix (Bio-Rad) with 0.3 µM of specific 5’- and 3’-primers with a MJ-opticon2 DNA engine (Bio-Rad). The specific 5’ and 3’ primers (see Supplemental Table S5) were used and the ubiquitin specific primers used as a relative control were the same as described in Kohler et al. (2004) (P. trichocarpa Protein ID #732892; GenBank ID CA825222). Fold changes in gene expression between inoculated and mock-inoculated poplar leaves were based on ∆Ct calculation. ∆Ct corresponded to Ct of one selected gene subtracted by Ct of ubiquitine and fold change expression was based on calculation of the ∆∆C(t) (Livak and Schmittgen, 2001) that corresponded to ∆C(t) in inoculated tissues substracted by the ∆C(t) in mock-inoculated tissues.

Accession Numbers Sequences from the SSH library described in this article can be retrieved in GenBank under accession numbers CT027996 to CT029994 and CT033829

SUPPLEMENTAL MATERIAL

Table S1: Complete list of transcripts sequenced from a cDNA SSH library of Populus trichocarpa x Populus deltoides ‘Beaupré’ leaves inoculated with the incompatible isolate 93ID6 of Melampsora larici-populina. The table includes the cDNA-ID of a representative EST for each Tentative Consensus sequence (TC) and the GenBank accession number of 5’ and 3’ sequences for each transcript; the gene function homology found through BlastX

Rinaldi, page 25, Plant Physiology searches at the NCBI with associated expected value (E-value); the corresponding best gene models identified in the P. trichocarpa ‘Nisqually-1’ genome sequence (version 1.1) at http://genome.jgi-psf.org/Poptr1_1/Poptr1_1.home.html;

and

the

abundance

of

each

transcript species among the 973 sequenced ESTs.

Table S2: List of expression ratios of Populus trichocarpa x Populus deltoides ‘Beaupré’ transcripts measured with the NimbleGen P. trichocarpa whole genome expression oligoarray at 48 h post-inoculation (hpi) between ‘Beaupré’ leaves inoculated with compatible (C48) or incompatible (I48) strains of Melampsora larici-populina and mock-inoculated (water) ‘Beaupré’ leaves at 48 hpi. The tables list the NimbleGen Probeset-ID in Populus v2.0 genome oligoarray; the corresponding aspen cDNA-ID when probeset was derived from an aspen TC; the corresponding best gene model in the P. trichocarpa ‘Nisqually-1’ genome sequence

database

(JGI;

version

1.1)

at

http://genome.jgi-

psf.org/Poptr1_1/Poptr1_1.home.html; and the best hit against Arabidopsis thaliana genome sequence or other sequences databases when no hit was found against A. thaliana genome. The expression ratios calculated from each probeset duplicates between inoculated versus mock-inoculated normalized values with associated P-value and PPDE-value obtained in three independent biological replicates are given. Mean ratio derived from probeset duplicates are indicated. The tables list significant (P< 0.05) transcripts that showed at least a 2-fold regulation between inoculated and control treatments.

Table S3: List of expression ratios of Populus trichocarpa x Populus deltoides ‘Beaupré’ transcripts measured with the PICME Populus 28K cDNA-microarrays at 48 h postinoculation (hpi) between ‘Beaupré’ leaves inoculated with incompatible strain of Melampsora larici-populina (I48) and mock-inoculated (water) ‘Beaupré’ leaves. The table lists the PICME Probe # and cDNA-ID (http://www.picme.at/); the corresponding best gene models in the P. trichocarpa

‘Nisqually-1’

genome

sequence

(version

1.1)

at

http://genome.jgi-

psf.org/Poptr1_1/Poptr1_1.home.html; the best database match at NCBI with corresponding species name; and the expression ratios measured in two independent biological replicates and associated P-values. cDNA ESTs that clustered together and corresponded to a same P. trichocarpa gene model are indicated in grey boxes. The table lists significant (P< 0.05) transcripts that showed at least a 2-fold regulation between inoculated and control treatment.

Table S4: Complete list of expression ratios of Populus trichocarpa x Populus deltoides ‘Beaupré’ transcripts measured with Nylon-based ‘Beaupré’ cDNA-macroarrays at 12, 24 and 48 h post-inoculation (hpi) during time course infection of ‘Beaupré’ leaves with compatible (C) and incompatible (I) strains of Melampsora larici-populina. The table lists the cDNA-ID

Rinaldi, page 26, Plant Physiology and corresponding gene homology as described in Kohler et al. (2003) (see http://mycor.nancy.inra.fr.poplardb.html); P. trichocarpa

‘Nisqually-1’

genome

corresponding sequence

best

(version

gene 1.1)

at

models

in

the

http://genome.jgi-

psf.org/Poptr1_1/Poptr1_1.home.html; and expression ratios calculated between inoculated versus mock-inoculated (water) normalized values obtained in three independent experimental replicates. Significant levels of regulation are highlighted in grey boxes.

Table S5: Specific 5’ and 3’ primers designed for RT-qPCR amplification of Populus transcripts. Protein ID number of gene models in Populus trichocarpa genome sequence (http://genome.jgi-psf.org/Poptr1_1/Poptr1_1.home.html)

used

to

design

primers

are

indicated.

ACKNOWLEDGEMENTS We would like to thank Jean Pinon at INRA Nancy (France); Véronique Jorge, Catherine Bastien, and Arnaud Dowkiw at INRA Orléans (France); Patricia Faivre-Rampant at INRA Evry (France); and Nicolas Rouhier and Jean-Pierre Jacquot at Université Henri Poincaré Nancy 1 (France), for valuable discussions during the course of this research. Stephen DiFazio at West Virginia University (WV, USA) and Amy Brunner at Virginia Polytechnic Institute and State University (VA, USA) are gratefully acknowledged for the access to the Populus NimbleGen whole genome oligoarray design before publication. The authors would like to thank Patrice Vion for taking care of poplar nursery and cuttings at INRA Nancy.

LITERATURE CITED

Ayliffe MA, Roberts JK, Mitchell HJ, Zhang R, Lawrence GJ, Ellis JG, Pryor TJ (2002) A plant gene up-regulated at rust-infection sites. Plant Physiol 129:169-180.

Baldi P, Hatfield GW (2002) DNA microarrays and gene expression from experiment to data analysis and modeling. Cambridge University Press. Cambridge, UK.

Barrès B, Dutech C, Andrieux A, Caron H, Pinon J, Frey P (2006) Isolation and characterization of 15 microsatellite loci in the poplar rust fungus, Melampsora laricipopulina, and cross-amplification in related species. Mol Ecol Notes 6:60-64.

Both MW, Csukai M, Stumpf MPH, Spanu PD (2005) Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen. Plant Cell 17:2107-2122.

Rinaldi, page 27, Plant Physiology

Boyle B, Hamelin RC, Séguin A (2005) In vivo monitoring of obligate biotrophic pathogen growth by kinetic PCR. Appl Environ Microbiol 71:1546-1552.

Brazma A, Hingamp P, Quackenbush J, Sherlock G, Spellman P, Stoeckert C, Aach J, Ansorge W, Ball CA, Causton HC, Gaasterland T, Glenisson P, Holstege FCP, Kim IF, Markowitz V, Matese JC, Parkinson H, Robinson A, Sarkans U, Schulze-Kremer S, Stewart J, Taylor R, Vilo J, Vingron M (2001) Minimum information about a microarray experiment (MIAME) - toward standards for microarray data. Nature Genet 29:365-371.

Catanzariti A-M, Dodds PN, Lawrence GJ, Ayliffe MA, Ellis JG (2006) Haustorially expressed secreted proteins from flax rust are highly enriched for avirulence elicitors. Plant Cell 18:243–256.

Cervera MT, Sewell MM, Faivre-Rampant P, Storme V, Boerjan W (2004) Genome mapping in Populus. In Kumar S, Fladung M, eds, Molecular Genetics and breeding of forest trees. The Haworth Press, NY, USA. pp 387-410.

Christopher ME, Miranda M, Major IT, Constabel PC (2004) Gene expression profiling of systemically wound-induced defenses in hybrid poplar. Planta 219:936-947.

Diatchenko L, Lau Y-FC, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov ED, Siebert PD (1996) Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Nat Acad Sci U S A 93:6025-6030.

Dixon RA (2001) Natural products and plant disease resistance. Nature. 411:843-847.

Dixon DP, Lapthorn A, Edwards R (2002) Plant glutathione transferases. Genome Biol 3:reviews3004.1-3004.10.

Dodds PN, Lawrence GJ, Catanzariti A-M, Ayliffe AM, Ellis JG (2004) The Melampsora lini AvrL567 avirulence genes are expressed in haustoria and their products are recognized inside plant cells. Plant Cell 16:755-768.

Dodds PN, Lawrence GJ, Catanzariti A-M, Teh T, Wang C-IA, Ayliffe MA, Kobe B, Ellis JG (2006) Direct protein interaction underlies gene-for-gene specificity and coevolution of the

Rinaldi, page 28, Plant Physiology flax resistance genes and flax rust avirulence genes. Proc Nat Acad Sci U S A 103:88888893

Dong X (2004) NPR1, all things considered. Curr Opin Plant Biol 7:547-552.

Dowkiw A, Bastien C (2004) Characterization of two major genetic factors controlling quantitative resistance to Melampsora larici-populina leaf rust in hybrid poplars: strainspecificity, field expression, combined effects, and relationship with a defeated qualitative resistance gene. Phytopathology 94:1358-1367.

Duplessis S, Courty P-E, Tagu D, Martin F (2005) Transcript patterns associated with ectomycorrhiza development in Eucalyptus globulus and Pisolithus microcarpus. New Phytol 165:599-611.

Ellis JG, Lawrence GJ, Luck JE, Dodds PN (1999) Identification of regions in alleles of the flax rust resistance gene L that determine differences in gene-for-gene specificity. Plant Cell 11:495-506.

Eulgem T (2004) Regulation of the Arabidopsis defence transcriptome. Trends Plant Sci 10:71-78.

Frey P, Gérard PR, Feau N, Husson C, Pinon J (2005) Variability and population biology of Melampsora rusts on poplars. In Pei MH, McCracken AR, eds, Rust diseases of willow and poplar. CAB International, Wallingford, UK. pp 63-72.

Gérard PR, Husson C, Pinon J, Frey P (2006) Comparison of genetic and virulence diversity of Melampsora larici-populina populations on wild and cultivated poplar and influence of the alternate host. Phytopathology 96:1027-1036.

Glazebrook J (2005) Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu Rev Phytopath 43: 205-227.

Gupta P, Duplessis S, White H, Karnosky DF, Martin F, Podila GK (2005) Gene expression patterns of trembling aspen trees following long-term exposure to interacting elevated CO2 and tropospheric O3. New Phytol 167:129-142.

Rinaldi, page 29, Plant Physiology Haffani YZ, Silva NF, Goring DR (2004) Receptor kinase signalling in plants. Can J Bot 82:1-15.

Heath MC (1997) Signalling between pathogenic rust fungi and resistant or susceptible host plants. Ann Bot 80:713-720.

Heath MC (1998) Involvement of reactive oxygen species in the response of resistant (hypersensitive) or susceptible cowpeas to the cowpea rust fungus. New Phytol 138:25163

Heath MC (2000) Hypersensitive response-related death. Plant Mol Biol 44:321-334.

Jorge V, Dowkiw A, Faivre-Rampant P, Bastien C (2005) Genetic architecture of qualitative and quantitative Melampsora larici-populina leaf rust resistance in hybrid poplar: genetic mapping and QTL detection. New Phytol 167:113-127.

Katagiri F (2004) A global view of defense gene expression regulation – a highly interconnected signaling network. Curr Opin Plant Biol 7:506-511.

Koiwa H, Kato H, Nakatsu T, Oda J, Yamada Y, Sato F (1999) Crystal structure of tobacco PR-5d protein at 1.8 A resolution reveals a conserved acidic cleft structure in antifungal thaumatin-like proteins. J Mol Biol 286: 1137-1145.

Kohler A, Delaruelle C, Martin D, Encelot N, Martin F (2003) The poplar root transcriptome: analysis of 7000 expressed sequence tags. FEBS Lett 542:3741.

Kohler A, Blaudez D, Chalot M, Martin F (2004) Cloning and expression of multiple metallothioneins from hybrid poplar. New Phytol 164:83-93.

Krebitz M, Wagner B, Ferreira F, Peterbauer C, Campillo N, Witty M, Kolarich D, Steinkellner H, Scheiner O, Breiteneder H (2003) Plant-based heterologous expression of Mal d 2, a thaumatin-like protein and allergen of apple (Malus domestica), and its characterization as an antifungal protein. J Mol Biol 329: 721-730.

Laurans F, Pilate G (1999) Histological aspects of a hypersensitive response in poplar to Melampsora larici-populina. Phytopathology 89: 233-238.

Rinaldi, page 30, Plant Physiology Lescot M, Rombauts S, Zhang J, Aubourg S, Mathé C, Jansson S, Rouzé P, Boerjan W (2004) Annotation of a 95-kb Populus deltoides genomic sequence reveals a disease resistance gene cluster and novel class I and class II transposable elements. Theor Appl Genet 109: 10-22.

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2

-∆∆C(t)

method. Methods 25: 402-408.

Loewus FA, Murthy PPN (2000) myo-Inositol metabolism in plants. Plant Sci 150:1-19.

Long AD, Mangalam HJ, Chan BYP, Tolleri L, Hatfield GW, Baldi P (2001) Improved statistical inference from DNA microarray data using analysis of variance and a bayesian statistical framework. J Biol Chem 276:19937-19944.

Mahalingam R, Gomez-Buitrago A-M, Eckardt N, Shah N, Guevara-Garcia A, Day P, Raina R, Fedoroff NV (2003) Characterizing the stress/defense transcriptome of Arabidopsis. Genome Biol 4:R20

Major IT, Constabel PC (2006) Molecular analysis of poplar defense against herbivory: comparison of wound- and insect elicitor-induced gene expression. New Phytol 172:617-635.

Mendgen K, Hahn M (2002) Plant infection and the establishment of fungal biotrophy. Trends Plant Sci 7: 352-356.

Mould MJR, Xu T, Barbara M, Iscove NM, Heath MC (2003) cDNAs generated from individual epidermal cells reveal that differential gene expression predicting subsequent resistance or susceptibility to rust fungal infection occurs prior to the fungus entering the cell lumen. Mol Plant-Micr Interact 6:835-845

Munnik T, Irvine RF, Musgrave A (1998) Phospholipid signaling in plants. Biochim Biophys Acta 1389:222-272

Nakano J, Meshitsuka G (1992) The detection of lignin. In Dence C, Lin S, eds, Methods in Lignin Chemistry. Springer-Verlag, Berlin. pp 23-32.

Newcombe G, Chastagner GA (1993) First report of the Eurasian poplar leaf rust fungus, Melampsora larici-populina, in North-America. Plant Dis 77:532-535.

Rinaldi, page 31, Plant Physiology

Nimchuk Z, Eulgem T, Holt III BF, Dangl JL (2003) Recognition and response in the plant immune system. Annu Rev Genet 37: 579-609.

Orozco-Cardenas M, Ryan CA (1999) Hydrogen peroxide is generated systemically in plant leaves by wounding and systemin via the octadecanoid pathway. Proc Nat Acad Sci USA 96:6553-6557.

Panstruga R (2003) Establishing compatibility between plants and obligate biotrophic pathogens. Curr Opin Plant Biol 6:320-326.

Pinon J, Frey P (2005) Interactions between poplar clones and Melampsora populations and their implications for breeding for durable resistance. In Pei MH, McCracken, AR, eds, Rust diseases of willow and poplar. CAB International, Wallingford, UK. pp 139-154.

Ralph S, Oddy C, Cooper D, Yueh H, Jancsik S, Kolosova N, Philippe RN, Aeschliman D, White R, Huber D, Ritland CE, Benoit F, Rigby T, Nantel A, Butterfield YSN, Kirkpatrick R, Chun E, Liu J, Palmquist D, Wynhoven B, Stott J, Yang G, Barber S, Holt RA, Siddiqui A, Jones SJM, Marra MA, Ellis BE, Douglas CJ, Ritland K, Bohlmann J (2006)a. Genomics of hybrid poplar (Populus trichocarpa x deltoides) interacting with forest tent caterpillars (Malacosoma disstria): normalized and full-length cDNA libraries, expressed sequence tags, and a cDNA microarray for the study of insect-induced defences in poplar. Mol Ecol 15:1275-1297.

Ralph S, Park J-Y, Bohlmann J, Mansfield SD (2006)b. Dirigent proteins in conifer defense: gene discovery, phylogeny, and differential wound- and insect-induced expression of a family of DIR and DIR-like genes in spruce (Picea spp.). Plant Mol Biol 60:21-40.

Rauscher M, Ádám AL, Wirtz S, Guggenheim R, Mendgen K, Deising HB (1999) PR-1 inhibits the differentiation of rust infection hyphae in leaves of acquired resistant broad bean. Plant J 19: 625-635.

Rouhier N, Gelhaye E, Gualberto JM, Jordy M-N, De Fay E, Hirasawa M, Duplessis S, Lemaire SD, Frey P, Martin F, Manieri W, Knaff DB, Jacquot J-P (2004) Poplar peroxiredoxin Q. A thioredoxin-linked chloroplast antioxidant functional in pathogen defense. Plant Physiol 134:1027-1038.

Rinaldi, page 32, Plant Physiology Sambrook J, Russell DW (2001) Molecular cloning - A Laboratory manual (3rd edition Vols, 1,2,3). Cold Spring Harbor Laboratory Press, New York.

Schenk PM, Kazan K, Wilson I, Anderson JP, Richmond T, Somerville SC, Manners JM (2000) Coordinated plant defense responses in Arabidopsis revealed by microarray analysis. Proc Nat Acad Sci USA 97:11655-11660.

Schulze-Lefert P, Panstruga R (2003) Establishment of biotrophy by parasitic fungi and reprogramming the host cells for disease resistance. Annu Rev Phytopathol 41:641-667.

Shah J (2003) The salicylic acid loop in plant defense. Curr Opin Plant Biol 6:365-371.

Silva NF, Goring DR (2002) The proline-rich, extensin-like receptor kinase-1 (PERK1) gene is rapidly induced by wounding. Plant Mol Biol 50:667-685.

Smith CM, Rodriguez-Buey M, Karlsson J, Campbell MM (2004) The response of the poplar transcriptome to wounding and subsequent infection by a viral pathogen. New Phytol 164:123-136.

Spanu PD (2006) Why do some fungi give up their freedom and become obligate dependants on their host? New Phytol 171:447-450.

Tao Y, Xie Z, Chen W, Glazebrook J, Chang H-S, Han B, Zhu T, Zou G, Katagiri F (2003) Quantitative nature of Arabidopsis responses during compatible and incompatible interactions with the bacterial pathogen Pseudomonas syringae. Plant Cell 15:317-330.

Thordal-Christensen H, Zhang Z, Wei Y, Collinge DB (1997) Subcellular localization of H2O2 in plants: H2O2 accumulation in papillae and hypersensitive response during the barley-powdery mildew interaction. Plant J 11:1187-1194.

Tuskan GA, DiFazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapman J, Chen G-L, Cooper D, Coutinho PM, Couturier J, Covert S, Cronk Q, Cunningham R, Davis J, Degroeve S, Déjardin A, dePamphilis C, Detter J, Dirks B, Dubchak I, Duplessis S, Ehlting J, Ellis B, Gendler K, Goodstein D, Gribskov M, Grimwood J, Groover A, Gunter L, Hamberger B, Heinze B, Helariutta Y, Henrissat B,

Rinaldi, page 33, Plant Physiology Holligan D, Holt R, Huang W, Islam-Faridi N, Jones S, Jones-Rhoades M, Jorgensen R, Joshi C, Kangasjärvi J, Karlsson J, Kelleher C, Kirkpatrick R, Kirst M, Kohler A, Kalluri U, Larimer F, Leebens-Mack J, Leplé J-C, Locascio P, Lou Y, Lucas S, Martin F, Montanini B, Napoli C, Nelson DR, Nelson C, Nieminen K, Nilsson O, Pereda V, Peter G, Philippe R, Pilate G, Poliakov A, Razumovskaya J, Richardson P, Rinaldi C, Ritland K, Rouzé P, Ryaboy D, Schmutz J, Schrader J, Segerman B, Shin H, Siddiqui A, Sterky F, Terry A, Tsai C-J, Uberbacher E, Unneberg P, Vahala J, Wall K, Wessler S, Yang G, Yin T, Douglas C, Marra M, Sandberg G, Van de Peer Y, Rokhsar D (2006) The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313:1596-1604.

Van Loon LC, Van Strien EA (1999) The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiol Mol Plant Pathol 55:85-97.

Vieira Dos Santos C, Cuiné S, Rouhier N, Rey P (2005) The Arabidopsis plastidic methionine sulfoxide reductase B proteins. sequence and activity characteristics, comparison of the expression with plastidic methionine sulfoxide reductase A, and induction by photooxidative stress. Plant Physiol 134:4088-4095.

Wagner U, Edwards R, Dixon DP, Mauch F (2002) Probing the diversity of the Arabidopsis glutathione S-transferase gene family. Plant Mol Biol 49:515-532.

Weigel RR, Pfitzner UM, Gatz C (2005) Interaction of NIMIN1 with NPR1 modulates PR gene expression in Arabidopsis. Plant Cell 17: 1279-1291.

Xu H, Heath MC (1998) Role of calcium in signal transduction during the hypersensitive response caused by basidiospore-derived infection of the cowpea rust fungus. Plant Cell 10:585-597.

Yin T-M, DiFazio SP, Gunter LE, Jawdy SS, Boerjan W, Tuskan GA (2004) Genetic and physical mapping of Melampsora rust resistance genes in Populus and characterization of linkage disequilibrium and flanking genomic sequence. New Phytol 164: 95-105.

FIGURE LEGENDS

Figure 1: Experimental design of time-course infection of detached leaves of Populus trichocarpa x Populus deltoides ‘Beaupré’ mock-inoculated with water or inoculated with incompatible (avirulent, 93ID6) and compatible (virulent, 98AG31) strains of Melampsora

Rinaldi, page 34, Plant Physiology larici-populina. RNA were sampled in independent replicate experiments at 12, 24 and 48 hours post-inoculation (hpi) and were used for transcript profiling. Leaf tissues were also sampled at 2, 6, 12, 18, 24, 48 and 96 hpi and were then used for observation in the variable pressure scanning electron microscopy (VPSEM), detection of reactive oxygen species (ROS) and lignin synthesis, and qPCR detection of pathogen growth in planta. Expression of disease (uredinia formation on abaxial epidermis) or resistance (localized hypersensitive reaction) were observed at 7 days post-inoculation (dpi). Necrotic lesions or uredinia on abaxial epidermis of foliar disks are shown at 7 dpi for the incompatible or the compatible interaction, respectively.

Figure 2: Development of infection structures of compatible (A to G) strain 98AG31 and incompatible strain 93JE3 (H) of Melampsora larici-populina during time-course infection of leaves of Populus trichocarpa x Populus deltoides ‘Beaupré’. A, aniline blue-stained urediniospores producing several ramified germ tubes at vicinity of stomata and hyphal penetration through stomata without appressorium formation at 2 hpi; B, urediniospores producing germ tubes and appressoria at vicinity of stomata and primary infection hyphae penetrating through stomata at 6 hpi; C, sub-stomatal vesicle formed under the abaxial epidermis and infection hyphae developing in the spongy mesophyll at 12 hpi; D, infection hyphae colonizing the spongy mesophyll at 48 hpi; E, infection hyphae developing from the spongy mesophyll to the palisade mesophyll at 48 hpi; F, spongy and palisade mesophyll colonized by infection hyphae at 96 hpi; G, uredinium formed on the abaxial epidermis releasing newly formed urediniospores at 196 hpi; H, limited development of hyphae of the incompatible M. larici-populina strain 93ID6 in the mesophyll at 96 hpi compared to compatible strain in pannel F. The hyphae of M. larici-populina strain 98AG31 were painted in red in pannels F and H to help in visualization of fungal hyphae in plant mesophyll. Fungal infection structures are pinpointed by arrowheads. ap, appressorium; gt, germtube; ih, infection hyphae; inf, infection site; nf sp, newly formed spore; pih, primary infection hyphae; sp, spore; ssv, sub-stomatal vesicle; ur, uredinium.

Figure 3: Time-course infection of leaves of Populus trichocarpa x P. deltoides ‘Beaupré’ by compatible (98AG31) and incompatible (93ID6) strains of Melampsora larici-populina. Development of the two rust strains was followed in planta by specific amplification of the rDNA intergenic ITS region from total DNA extracted from inoculated leaf tissues at 2, 6, 12, 24, 48 and 96 hpi. Pathogen growth curves correspond to ∆Ct of fungal ITS amplicons measured by quantitative PCR. Note the log scale. Estimates of fungal mass DNA are indicated on the graph for the two strains at 12, 24, 48 and 96 hpi. Amplifications were

Rinaldi, page 35, Plant Physiology carried out on three biological replicates and significant differences between the two M. laricipopulina strains are indicated by a star (t-test; P < 0.05).

Figure 4: Wiesner coloration revealing monolignols accumulation by a red coloration in leaf disks of Populus trichocarpa x P. deltoides ‘Beaupré’ sampled on detached leaves inoculated with compatible (98AG31) or incompatible (93ID6) strains of Melampsora larici-populina or mock-inoculated with water. A, cleared leaf disks at 24, 48 and 96 hpi in compatible and incompatible interactions and in the control treatment; B, 10X close-up of leaf disks at 96 hpi. M. larici-populina infecting hyphae are visible by transparency in the case of the compatible interaction.

Figure 5: Reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) expression patterns for transcripts of pathogenesis-related proteins PR-1, PR-5, PR-10, inositol-3-phosphate synthase, NPR1, dirigent-like protein, rust-induced secreted protein #678883, ribulose 1,5-bisphosphate carboxylase oxygenase, arabinogalactan protein and photosystem I centre reaction IV. Total RNA of mock-inoculated or inoculated leaves of Populus trichocarpa x Populus deltoides ‘Beaupré’ with either compatible (black bars) or incompatible (white bars) strains of Melampsora larici-populina 12, 24 and 48 hours postinoculation, was isolated and aliquots of 1 µg were used for first-strand cDNA synthesis. PCR was performed with 2 µl of first-strand cDNA. A control with no RT in the first strand cDNA synthesis reaction mix was included to control for the lack of genomic DNA. The Populus ubiquitin transcript (GenBank ID, CA825222) was used as a control for transcript not regulated by rust. Inset, data for the rust-induced secreted protein #678883, transcript concentration was measured by RT-qPCR on the RNA samples used for the whole genome oligoarray analysis at 48 hpi (n=3).

Rinaldi, page 36, Plant Physiology Table 1: Most prevalent rust-responsive transcripts in leaves of Populus trichocarpa x Populus deltoides ‘Beaupré’ inoculated with the incompatible strain 93ID6 of Melampsora larici-populina measured by ESTs redundancy in a SSH-enriched cDNA library. nd, not detected Populus trichocarpa Contig ID

a

Accession# (5’)

b

Accession# (3’)

c

Best database match (species)

d

e

Protein ID #

% (EST #)

2YE21

CT029167

CT029166

inositol-3-phosphate synthase (Mesembryanthemum crystallinum) 832275

1YH15

CT029702

CT029701

pathogenesis related protein 1, PR-1 (Vitis vinifera)

550049

3.8 (37)

3YM24

CT028131

CT028130

thaumatin-like protein, PR-5 (Nicotiana tabacum)

747341

2.2 (21)

1YL15

CT029535

CT029534

protein disulfide isomerase, PDI-3 (Cucumis melo)

230101

1.3 (13)

20.4 (199)

1YC18

CT029896

CT029895

aspartate aminotransferase (Arabidopsis thaliana)

710171

1.1 (11)

1YH09

CT029711

CT029710

chitinase (class I), PR-3 (Medicago sativa)

831333

0.9 (9)

2YE11

CT029187

CT029186

cytochrome P450 (Oryza sativa)

680604

0.9 (9)

3YD08

CT028543

CT028542

asparagine synthetase (Triphysaria versicolor)

722643

0.9 (9)

3YG19

CT028393

CT028392

hypothetical protein (Glycine max)

579371

0.8 (8)

2YK09

CT028933

CT028932

subtilisin-like serine protease, AIR3 (A. thaliana)

810987

0.8 (8)

1YI17

CT029657

CT029656

Chitinase, PR-3 (Psophocarpus tetragonolobus)

586583

0.6 (6)

1YK13

nd

CT029580

acidic class III chitinase SE2, PR-3 (Beta vulgaris)

746640

0.6 (6)

2YB13

CT029291

CT029290

RNA helicase (O. sativa)

755273

0.5 (5)

2YB09

nd

CT029298

asparagine synthetase (Helianthus annuus)

722643

0.5 (5)

1YK07

CT029592

CT029591

wall-associated kinase (A. thaliana)

758034

0.5 (5)

1YJ14

CT029624

CT029623

senescence-related protein (Pyrus pyrifolia)

265740

0.4 (4)

2YI14

CT029011

CT029010

beta-1,3-glucanase, PR-2 (Fragaria x ananassa)

290846

0.4 (4)

1YP01

CT029388

CT029387

receptor-like protein kinase, RLK (e-value < E-5)

756597

0.4 (4)

3YF23

CT028431

CT028430

leucine-rich repeat protein kinase (A. thaliana)

826060

0.4 (4)

2YC08

CT029266

CT029265

disease resistance protein (A. thaliana)

788310

0.4 (4)

1YG06

CT029755

CT029754

protein disulfide isomerase, PDI-2 (C. melo)

565873

0.4 (4)

3YD21

CT028524

CT028523

ankyrin repeat protein (e-value < E-5)

571736

0.4 (4)

2YM21

CT028822

CT028821

beta-1,3-glucanase, PR-2 (Hevea brasiliensis)

769807

0.4 (4)

Rinaldi, page 37, Plant Physiology 1YN04

CT029471

CT029470

NADH glutamate synthase (Phaseolus vulgaris)

824538

0.4 (4)

1YG23

CT029729

CT029728

subtilisin-like proteinase (O. sativa)

790236

0.4 (4)

a

representative EST ID from assembly contig;

b,c

GenBank accession number of 5’ and 3’ sequences of transcripts; dbest database match (and

corresponding species) obtained with a BlastX query at NCBI; eProtein ID number of the best database match in P. trichocarpa ‘Nisqually-1’ (version 1.1) obtained with a BlastN search on the JGI website (http://genome.jgi-psf.org/Poptr1_1/Poptr1_1.home.html).

Rinaldi, page 38, Plant Physiology Table 2: Expression ratios of rust-responsive transcripts from Populus trichocarpa x Populus deltoides ‘Beaupré’ measured with the NimbleGen P. trichocarpa whole genome expression oligoarray at 48 h post-inoculation (hpi) in ‘Beaupré’ leaves inoculated with incompatible (I48) or compatible (C48) strains of Melampsora larici-populina.

P. trichocarpa a

b

I48 foldregulation

c

P-value

c

Best blast hit

d

e

NimbleGen Probe ID

Protein ID #

AGI #

TREE0002S00038855

678883

30.6

8.77E-12

no hit [rust-induced secreted protein (RISP)]

no hit

TREE0002S00039697

272826

14.8

2.65E-10

glutathione S-transferase U2 (Nicotiana benthamiana)

At1g17170

TREE0002S00058098

792358

9.6

5.49E-07

hypothetical protein (Arabidopsis thaliana)

At1g58170

TREE0002S00060385

277644

7.6

1.57E-06

glutathione S-transferase parC, auxin-regulated protein (Nicotiana tabacum)

At1g78380

TREE0002S00000329

711753

7.5

4.92E-06

pathogenesis-related protein (dirigent-like protein) (Pisum sativum)

At1g64160 At2g29420 At4g02380

TREE0002S00058872

657351

7.2

1.67E-07

glutathione S-transferase GST 18 (Populus alba x Populus tremula

TREE0002S00001434

731797

7.1

8.96E-06

late embryogenis abundant protein, SAG21 (Arabidopsis thaliana)

TREE0002S00000421

712863

6.5

1.96E-05

UDP-glucose:protein transglucosylase-like protein (Lycopersicon esculentum)

At3g02230

TREE0002S00040010

276538

6.4

1.47E-05

glutathione S-transferase parC, auxin-regulated protein (Nicotiana tabacum)

At1g17180

TREE0002S00035838

795681

6.3

7.03E-06

acidic chitinase (Psophocarpus tetragonolobus)

At5g24090

TREE0002S00032433

581980

6.2

1.07E-05

pathogenesis-related PR-1 protein (Arabidopsis thaliana)

At2g14610

TREE0002S00028427

746640

6.2

1.13E-05

acidic endochitinase, glycoside hydrolase family 18 (Medicago truncatula)

At5g24090

TREE0002S00052008

820835

6.2

4.67E-06

glutathione S-transferase GST 18 (Populus alba x Populus tremula)

At2g29420

TREE0002S00028575

748543

6.1

1.33E-05

pathogenesis-related PR-1 protein (Arabidopsis thaliana)

At2g14610

TREE0002S00000256

710544

6.0

7.90E-05

late embryogenis abundant protein, SAG21 (Arabidopsis thaliana)

At4g02380

TREE0002S00015535

769807

5.5

1.10E-05

beta-1,3-glucanase (Hevea brasiliensis)

At4g16260

TREE0002S00028427

746640

5.4

1.13E-05

acidic endochitinase, glycoside hydrolase family 18 (Medicago truncatula)

At5g24090

TREE0002S00024163

417599

5.3

1.20E-05

receptor-like protein kinase RLK5 (Arabidopsis thaliana)

At5g25930

TREE0002S00063111

248394

5.3

3.19E-05

photosystem II CP43 protein (Panax ginseng)

AtCg00280

TREE0002S00000638

714634

5.3

1.57E-05

hypothetical protein (Populus deltoides x Populus maximowiczii)

At4g19950

TREE0002S00040235

279076

-4.1

1.75E-03

rRNA inton encoded homing endonuclease (Oryza sativa)

no hit

TREE0002S00063251

256788

-4.2

1.18E-02

lysine decarboxylase (Oryza sativa)

At5g06300

Rinaldi, page 39, Plant Physiology TREE0002S00047596

735328

-4.2

5.07E-04

ribosomal protein 40S S9 (Solanum demissum)

At5g39850

TREE0002S00047882

640496

-4.2

1.16E-04

beta-tubulin (Gossypium hirsutum)

At5g12250

TREE0002S00063570

Cp_orf79

-4.2

1.17E-03

hypothetical chloroplastic protein (Spinacia oleracea)

no hit

TREE0002S00062228

418172

-4.5

7.99E-04

magali Spm transposable element 60I2G03 (Populus deltoides)

no hit

TREE0002S00040045

277030

-4.6

5.33E-04

hypothetical chloroplastic protein (Saccharum officinarum)

no hit

TREE0002S00063598

cp_orf61

-4.6

4.47E-03

hypothetical protein SpolCp101 (Spinacia oleracea)

AtCg00300

TREE0002S00035479

795166

-4.8

1.99E-03

no hit

no hit

TREE0002S00030128

596748

-4.8

5.91E-04

GDSL-like Lipase/Acylhydrolase (Oryza sativa)

At1g28640

TREE0002S00032920

585246

-5

1.32E-03

hypothetical chloroplast ATPase (Ycf2) (Populus alba)

AtCg00860

TREE0002S00039944

275797

-5.6

2.95E-02

hypothetical chloroplastic protein (Cuscuta reflexa)

no hit

TREE0002S00056518

771095

-5.8

7.19E-03

no hit

no hit

TREE0002S00040050

277108

-5.9

3.51E-03

hypothetical chloroplastic protein (Nicotiana tabacum)

no hit

TREE0002S00031244

587419

TREE0002S00063597

cp_ycf15

-6

1.17E-02

no hit

no hit

-6.6

1.97E-03

hypothetical protein (Orf77/Ycf15-A) (Arabidopsis thaliana)

AtCg00870

TREE0002S00023106

195834

-7

3.12E-03

hypothetical auxin-induced protein (Capsicum annuum)

At4g34800

TREE0002S00042443

820269

-7.2

3.04E-02

hypothetical protein (Arabidopsis thaliana)

At4g25030

TREE0002S00060995

290970

-8

2.98E-03

lysine decarboxylase-like protein (Oryza sativa)

At5g06300

TREE0002S00040072

277323

-8.1

3.46E-03

hypothetical chloroplastic protein (Nicotiana tabacum)

no hit

P. trichocarpa a

b

C48 foldc

c

d

e

NimbleGen Probe ID

Protein ID #

TREE0002S00055699

594680

4.2

2.22E-03

anthocyanin acyltransferase-like protein (Arabidopsis thaliana)

At5g39050

TREE0002S00029168

837131

3.6

9.66E-04

ferredoxin-nitrite reductase (Betula pendula)

At2g15620

TREE0002S00037742

811643

3.3

3.16E-03

CuZn-superoxide dismutase (Populus tremula x Populus tremuloides)

At2g28190

regulation

P-value

Best blast hit

AGI #

TREE0002S00009339

568530

3.2

1.87E-02

LRR-containing hypothetical protein (Arabidopsis thaliana)

At5g55540

TREE0002S00067017

544845

3

4.55E-02

integrase polyprotein (Medicago truncatula)

At2g15650

TREE0002S00001434

731797

3

9.18E-03

late embryogenis abundant protein, SAG21 (Arabidopsis thaliana)

At4g02380

TREE0002S00048762

679519

3

3.74E-03

polyubiquitin UBQ10 (Arabidopsis thaliana)

At4g05320

TREE0002S00052689

566171

2.9

7.56E-03

beta-ketoacyl-CoA synthase (Oryza sativa)

At5g43760

Rinaldi, page 40, Plant Physiology TREE0002S00034768

794254

2.8

2.72E-03

aldo/keto reductase (Medicago truncatula)

TREE0002S00041247

291991

2.7

1.37E-02

ribulose-1,5-bisphosphate carboxylase/oxygenase, large chain (Lophocolea martiana) AtCg00490

TREE0002S00063977

588636

2.7

4.92E-03

gag/pol polyprotein (Solanum demissum)

At2g14380

At3g53880

TREE0002S00060457

279164

2.7

7.55E-03

receptor-like kinase (Arabidopsis thaliana)

At4g27300

TREE0002S00063843

660789

2.7

1.07E-02

no hit

no hit

TREE0002S00028989

826800

2.6

8.29E-03

serine/threonine protein kinase (Medicago truncatula)

At5g09890

TREE0002S00030792

583368

2.6

1.43E-02

no hit

no hit

TREE0002S00048783

748355

2.6

1.02E-02

pollen coat protein-like (Arabidopsis thaliana)

At5g38760

TREE0002S00007567

561703

2.6

5.65E-03

no hit

no hit

TREE0002S00061579

172038

2.6

2.93E-03

hypothetical protein (Arabidopsis thaliana)

At1g08440

TREE0002S00002619

818390

2.5

1.66E-02

calcium-binding protein (Atriplex nummularia)

At3g50360

TREE0002S00024949

421059

2.5

3.45E-03

delta-pyrroline-5-carboxylate synthetase (Glycine max)

At2g39800

TREE0002S00059712

263964

-4.3

1.58E-02

lysine decarboxylase-like protein (Oryza sativa)

At5g06300

TREE0002S00020096

648814

-4.6

3.00E-02

hypothetical splicing factor (Arabidopsis thaliana)

At2g16940

TREE0002S00023106

195834

-4.6

2.82E-02

hypothetical auxin-induced protein (Capsicum annuum)

At4g34800

TREE0002S00037394

793544

-4.8

1.58E-03

hypothetical protein (Oryza sativa)

no hit

TREE0002S00060995

290970

-5.1

1.67E-02

lysine decarboxylase-like protein (Oryza sativa)

At5g06300

TREE0002S00047970

817423

-5.3

2.73E-03

hypothetical protein (Arabidopsis thaliana)

At5g42050

TREE0002S00055491

591262

-5.4

1.21E-02

cysteine proteinase (Alnus glutinosa)

At2g27420

TREE0002S00056518

771095

-5.4

1.14E-02

no hit

no hit

TREE0002S00031048

585596

-5.5

3.10E-03

calcium binding protein (Arabidopsis thaliana)

At4g13440

TREE0002S00047850

827481

-5.8

2.75E-02

Zn finger protein PHD family (Glycine max)

At2g02470

TREE0002S00054306

588374

-6.3

4.23E-04

no hit

no hit

TREE0002S00058200

789011

-6.4

4.83E-03

pollen coat oleosin-glycine rich protein (Arabidopsis thaliana)

At5g07565

TREE0002S00066249

660216

-6.6

6.71E-03

no hit

no hit

TREE0002S00031244

587419

-6.7

8.78E-03

no hit

no hit

TREE0002S00064258

681711

-6.9

2.92E-03

magali Spm transposable element 60I2G03 (Populus deltoides)

no hit

TREE0002S00029354

589352

-7.1

3.54E-02

hypothetical protein, sec34 homolog (Arabidopsis thaliana)

At1g73430

TREE0002S00050427

274646

-7.4

3.04E-03

phosphoprotein phosphatase (Arabidopsis thaliana)

At1g05000

Rinaldi, page 41, Plant Physiology TREE0002S00061299

298144

-8.7

3.82E-03

lysine decarboxylase-like protein (Oryza sativa)

At5g06300

TREE0002S00044995

583302

-10.5

6.67E-03

calcium-binding EF-hand family protein-like (Arabidopsis thaliana)

At2g44310

TREE0002S00047844

732714

-11

1.50E-02

hypothetical protein (Oryza sativa)

At5g24610

a

Probe-ID number on NimbleGen Populus expression array version 2.0 (NCBI GEO platform GPL2699); bProtein ID # of

corresponding best gene model in the P. trichocarpa ‘Nisqually-1’ genome sequence (version 1.1) at http://genome.jgipsf.org/Poptr1_1/Poptr1_1.home.html; cExpression ratios (and associated P-value) calculated between normalized transcript concentration of inoculated versus mock-inoculated (water) Populus leaves obtained with duplicated probes on NimbleGen whole genome oligoarray and three biological replicates, ratios