CLINICAL IMMUNOLOGY doi: 10.1111/j.1365-3083.2012.02678.x ..................................................................................................................................................................
Risk and Prognosis of Campylobacteriosis in Relation to Polymorphisms of Host Inflammatory Cytokine Genes H. Nielsen*, R. Steffensen & T. Ejlertsenà
Abstract *Department of Infectious Diseases, Aalborg Hospital, Aarhus University Hospital, Aalborg, Denmark; Department of Clinical Immunology, Aalborg Hospital, Aarhus University Hospital, Aalborg, Denmark; and àDepartment of Clinical Microbiology, Aalborg Hospital, Aarhus University Hospital, Aalborg, Denmark
Received 21 September 2011; Accepted 16 December 2011 Correspondence to: Henrik Nielsen, Department of Infectious Diseases, Aalborg Hospital, DK9000 Aalborg, Denmark. E-mail:
[email protected] The authors have no conflicts of interest to declare. The study received no funding. Part of the study was presented at 48th Annual Meeting of Infectious Diseases Society of America, Vancouver, Canada, 21–24 October 2010 (abstract 1057).
The risk of infection with Campylobacter jejuni ⁄ coli as well as complications may be related to host genetics. We assessed six single-nucleotide polymorphisms in inflammatory cytokine genes in 105 patients with Campylobacter jejuni ⁄ coli gastroenteritis. The population distribution of the genes was determined in healthy subjects. The patients responded to mailed questionnaires with regard to reactive arthritis (RA) and irritable bowel syndrome (IBS) in 6-month follow-up. The genotype INFG(+ 874A ⁄ A) was less frequent in patients than in controls (20% versus 33%; P = 0.015), whereas the distribution of the other five SNPs did not differ from controls. After 6 months, RA had developed in 15 subjects and IBS in 20 subjects. RA was significant more frequent in patients with IL-18(-137G ⁄ G) (22%) than IL-18(-137C ⁄ C) (0%), P = 0.03, with INFG(+874 T ⁄ T (32%) than INFG(+874A ⁄ A) (0%), P = 0.007, and with INFG(+2197 A ⁄ A) (22%) than INFG(+2197G ⁄ G) (0%), P = 0.02. The development of IBS was not linked to gene polymorphisms. In conclusion, the risk of acquiring clinical gastroenteritis with Campylobacter jejuni ⁄ coli is related to the INFG (+ 874A>T) of intron 1. Polymorphisms in IL18 and INFG are linked to the risk of post-infectious reactive arthritis, but not to irritable bowel syndrome.
Introduction Campylobacter gastroenteritis is characterized mostly by a self-limited course of diarrhoea, abdominal cramps and fever. Campylobacter is highly infectious, and infective doses as low as 500–800 CFU have been reported [1, 2]. However, when Campylobacter outbreak data are analysed, it is clear that not every person exposed to a certain dose of Campylobacter either will be colonized or develops clinical symptoms, although dose–response relations have been observed [3]. Both bacterial virulence factors and host susceptibility factors are thought to be involved in determining whether disease develops. Post-infectious complications such as reactive arthritis (RA), irritable bowel disease (IBS), Guillain–Barre´ syndrome, and inflammatory bowel disease may develop in a subset of patients [4, 5], basically by unknown mechanisms.
Post-infectious irritable bowel syndrome after traveller’s diarrhoea [6] and community-acquired gastroenteritis [7–9] are well described and may become chronic [10]. Longer duration of diarrhoea, abdominal pain and female sex are risk factors for IBS [7, 8]. A possible relation to bacterial factors, for example, toxigenicity in vitro, has been observed in patients developing post-infectious IBS [11], but whether host genetic factors play a role is not clear. However, immune responsiveness, crucial for clinical symptoms, may be under genetic regulation. Heterogeneity of the intensity of inflammatory responses with differences in local mucosal destruction and slower resolution of pathology could be important. Dysregulation of pro- and anti-inflammatory signals may impact the outcome after pathogen interaction. Residual changes may include increased inflammatory and enteroendocrine cells, both of which could result in altered bowel patterns [12].
2012 The Authors. Scandinavian Journal of Immunology 2012 Blackwell Publishing Ltd.
449
H. Nielsen et al. 450 Campylobacteriosis and Host Genes ..................................................................................................................................................................
In a population-based study of Campylobacter infection, 7% of patients had post-infectious reactive arthritis [13]. The duration of diarrhoea and abdominal pain was longer in patients with reactive musculoskeletal complications than in those with an uncomplicated course. The frequency range of 5–13% of RA has been confirmed in other studies [14–16]. It is still unknown whether host susceptibility plays a role in the development of chronic sequelae after Campylobacter infection, although an interferon gamma SNP has previously been described related to RA [15]. The well-described association of HLA-B27 with risk of RA apparently does not include Campylobacter infection [14, 16]. To further elucidate a possible role of host genetics in the risk of acquiring Campylobacter enteritis and for the post-infectious development of complications, we examined six different cytokine gene polymorphisms, all previously demonstrated to play a role in mucosal immunity [15, 17, 18], in patients with community-acquired Campylobacter infection. In traveller’s diarrhoea with enteroaggregative Escherichia coli, a strong association with the risk of clinical disease was observed for a polymorphism in interleukin-8 [17], which is a crucial cytokine for acute inflammation. Doorduyn et al. [15] reported a single-nucleotide polymorphism in the interferon-gamma gene to be an independent risk factor for reactive arthritis following bacterial enteritis, and Sakai et al. [18] found specific IL-18 genotypes to increase mucosal levels of IL-18 and to increase histopathology in an experimental Helicobacter pylori model. The role of these cytokine polymorphisms in the risk and outcome of Campylobacter jejuni ⁄ coli infection, however, has not been studied.
Materials and Methods We included 105 consecutive unselected adult patients with a culture-confirmed Campylobacter jejuni ⁄ coli gastroenteritis. The patients had no other bacterial enteric pathogen identified from stool cultures. The patients were all from North Jutland County, and all stool samples from the region are analysed at our institution. The study was approved by the Regional Scientific Ethics Committee (N-VN-20060048), and all subjects provided their informed consent. Patients with previously diagnosed rheumatology or gastroenterology disorders were excluded. The clinical course was followed over 6 months, and the patients responded on mailed questionnaires with regard to occurrence of reactive arthritis (RA) any time during the follow-up and for irritable bowel syndrome (IBS) symptoms at 6 months according to the Rome criteria [19]. RA was defined by self-reporting occurrence of acute, painful swelling of one or more joints for >1 week beginning after the illness with gastrointestinal symptoms. The control group consisted of 192 Danish blood donors, and all donors were of self-reported good health.
DNA was extracted from whole blood using the Maxwell 16 System Blood DNA Purification kit (Promega, Madison, WI, USA) for all samples. Determination of all genotypes was carried out using real-time polymerase chain reaction (RT-PCR) with TaqMan SNP Genotyping Assays (Applied Biosystems, Foster City, CA, USA). Five SNPs, one in the promoter region of IL-8 [(IL-8 – 251 T ⁄ A); rs4073] and two in the promoter region of IL-18 [(IL-18 -137 G>C); rs187238] and [(IL-18 -607 G>T); rs 1946518], one located in intron 3 of interferon-c [INFG(+2197 A>G); rs1861493] and one located in exon 1 of tumour necrosis factor receptor superfamily, member 11b [TNFRSF11B(+1181 C>G); rs2073618] were genotyped using predesigned ⁄ validated TaqMan Genotyping assays (ABI IDnr. C_11748116_10; C_2408543_10; C_2898460_10; C_2683476_10; C_19710 47_1_) respectively. The INFG (+874 A>T); rs2430561 was a custom TaqMan SNP assay, the primers were forward 5¢-ACTGTGCCTTCCTGTAGGGTATT and reverse 5¢GCTGTCATAATAATATTCAGACATTCACAATTG AT and probes VIC-5¢-CACAAATCAAATCTCACACA and FAM-5¢-ACAAAATCAAATCACACACACCACAGA GATATTACATCAC. For all TaqMan assays, DNA amplification was carried out in 5-ll volume containing 20 ng DNA, 0.9 lM primers and 0.2 lM probes (final concentrations), amplified in 384-well plates. PCRs were performed with the following protocol on a GeneAmp PCR 9700 (Applied Biosystems): 95 C for 10 min, followed by 40 cycles of 95 C for 15 s and 60 C for 1 min. Subsequently, endpoint fluorescence was determined (ABI PRISM 7900 HT Sequence Detection Systems, SDS version 2.3 software; Applied Biosystems). Statistical analysis. The genotype frequencies between patients and healthy subjects and between subgroups of patients at follow-up were compared using chi-square test. When one of the cells had an expected value less than five, the Fisher¢s exact test was used. Chi-square analysis was performed and the odds ratio and risk ratio with 95% confidence interval was calculated using Vassar Stats online statistical calculators (http://faculty.vassar.edu/ lowry/VassarSt ats.html) for all the possible genotypes using a categorical model. Association analysis was undertaken to compare the frequency of mutant allele and mutant genotypes between cases and controls. P-values < 0.05 were considered to be significant.
Results From a population-based sample of stool cultures positive for Campylobacter jejuni ⁄ coli, we examined the polymorphisms of six inflammatory cytokine genes. In comparison with a population background without infection, the INFG (+874 A>T) polymorphism was mere frequently observed in patients (P = 0.01, Table 1), whereas no
Scandinavian Journal of Immunology, 2012, 75, 449–454
H. Nielsen et al. Campylobacteriosis and Host Genes 451 .................................................................................................................................................................. Table 1 Risk of Campylobacter gastroenteritis in relation to polymorphisms in host inflammatory genes. Patients (n = 105) (%) IL-8 -251 T ⁄ A rs4073a IL-18 -607 G>T rs1946518 IL-18 -137 G>C rs187238 INFG +2197 A>G rs1861493 INFG +874 A>T rs2430561 TNFRSF11B 1181 C>G rs2073618
AA AT TT GG GT TT GG CG CC AA AG GG AA AT TT CC CG GG
25 54 26 47 41 17 59 39 7 57 43 5 21 59 25 21 54 30
Controls (n = 192) (%) (23.8) (51.4) (24.8) (44.8) (39.0) (16.2) (56.2) (37.1) (6.7) (54.3) (41.0) (4.8) (20.0)* (56.2) (23.8) (20.0) (51.4) (28.6)
45 94 51 72 91 29 99 75 18 101 72 19 64 94 34 44 95 53
(23.7) (49.5) (26.8) (37.5) (47.4) (15.1) (51.6) (39.1) (9.4) (52.6) (37.5) (9.9) (33.3) (49.0) (17.7) (22.9) (49.5) (27.6)
a
IL-8-251 tested in 190 controls only. *P = 0.01. Chi-square test.
difference could be demonstrated for IL-8 (-251 T ⁄ A), IL-18 (-607 G>T), IL-18 (-137 G>C), INFG (+2197 A>G) or TNFRSF11B (1181 C>G). In accordance with clinical experience, a number of subjects with Campylobacter jejuni ⁄ coli gastroenteritis developed complications during 6 months of follow-up, with 15 reporting reactive arthritis (RA) and 20 subjects having irritable bowel syndrome (IBS). The risk of post-infectious RA was significantly associated with IL-18 (-137 G>C), INFG (+2197 A>G), INFG (+874 A>T), as well as TNFRSF11B (1181 C>G), Table 2. We could not detect any association between IL-8 (-251 T ⁄ A) polymorphism and risk of RA. As post-infectious RA could be associated with other factors than cytokine gene polymorphisms, for example age and gender, we calculated the difference between 15 patients with RA and 90 patients without RA, but not statistical difference was demonstrated (mean age of 45.2 years in RA versus 47.8 years in non-RA, P = 0.81; women, 10 ⁄ 15 in RA versus 50 ⁄ 90 in non-RA, P = 0.42). For none of the six SNPs, a relationship with 6 months IBS symptoms could be found (Table 2). It is acknowledged that marginally significant results were obtained for allelic differences in IL-8 (-251 T ⁄ A), IL-18 (-137 G>C) and IL18 (-607 G>T) (Table 2), but as we could not demonstrate significance for the same positions when phenotypic distribution was analysed, we do not take these marginal observations into consideration in conclusions.
Discussion Campylobacteriosis is an inflammatory enteritis that is initially found in the small bowel and later affects the 2012 The Authors. Scandinavian Journal of Immunology 2012 Blackwell Publishing Ltd.
colon and the rectum [1]. The diarrhoea can be either watery or bloody indicating that the extents of intestinal inflammation vary among individuals, and the clinical course in exposed subjects may even be subclinical. It is controversial if bacterial genetic factors cause the diversity of clinical symptoms [20], whereas it is generally recognized that polymorphisms in host genes that regulate inflammation may be associated with different clinical outcomes in diseases for which inflammation is a critical variable. Polymorphisms in a number of cytokine genes have an impact on the type of immune response that occurs after various infectious stimuli [21], and studies in Campylobacter infection could provide more understanding of the pathogen–host interaction. Previous investigations failed to identify host gene polymorphisms associated with Campylobacter infection [15, 22], while other authors reported a specific SNP in the interleukin-8 promoter to be a risk factor for enteroaggregative E. coli diarrhoea [17]. In our cohort, we could not confirm the IL-8 (-251 T ⁄ A) polymorphism to be associated with Campylobacter gastroenteritis. It is therefore unlikely that IL-8 (-251 T ⁄ A) is a host risk factor for enteric infections in general, but it may be restricted to E. coli diarrhoea. The relationship of IL-8 (-251 T ⁄ A) to infection with other enteric pathogens has not been reported. We did, however, identify a polymorphism in INFG (+874 A>T) to be associated with an increased risk of clinical diagnosis of Campylobacter jejuni ⁄ coli infection. Cellular immunity including Th1 T lymphocyte activation may very well play a role in susceptibility to Campylobacter infection as exemplified by the increased risk in HIV-positive patients. Furthermore, regulation of mucosal inflammation could be modulated by Th1 immunity [4]. Reactive arthritis usually begins around 14 days after infection with an estimated incidence in community cases of 5–13% [13–16]. Reactive arthritis after bacterial gastroenteritis, at least in severe cases, is associated with HLA-B27, but not following Campylobacter [16]. So far, except for HLA-B27, only one other genetic factor that may increase the susceptibility to reactive arthritis has previously been described; that is, Doorduyn et al. [15] reported an increased risk of reactive arthritis following gastroenteritis in patients with SNP in INFG (+874 A>T), which could be confirmed in our data to be a risk factor for RA. Moreover, we observed a higher frequency of another SNP in INFG (+2197 A>G) in patients after Campylobacter enteritis. A central role of INF-c in Th1 immunity is probable in reactive arthritis. In this study, we could not demonstrate a significant difference in age or gender between patients with post-infectious RA and patients without RA, although this could be due to the limited number of patients with this outcome. Interleukin-18 is known to induce INF-c in the presence of IL-12 in vitro, and animal models have
452 Campylobacteriosis and Host Genes H. Nielsen et al. .................................................................................................................................................................. Table 2 Risk of (a) reactive arthritis (b) Irritable bowel syndrome (IBS) after Campylobacter gastroenteritis in relation to polymorphisms of host inflammatory genes.
(a) IL-8 -251 T ⁄ A rs4073
IL-18 -607 G>T rs1946518
IL-18 -137 G>C rs187238
INFG +2197 A>G rs1861493
INFG +874 A>T rs2430561
TNFRSF11B 1181C>G rs2073618
(b) IL-8 -251 T ⁄ A rs4073
IL-18 -607 G>T rs1946518
IL-18 -137 G>C rs187238
INFG +2197 A>G rs1861493
AA AT TT Allele A T GG GT TT Allele G T GG CG CC Allele G C AA AG GG Allele A G AA AT TT Allele A T CC CG GG Allele C G AA AT TT Allele A T GG GT TT Allele G T GG CG CC Allele G C AA AG
Yes
No
P value
8 ⁄ 25 4 ⁄ 54 3 ⁄ 26
17 ⁄ 25 50 ⁄ 54 23 ⁄ 26
0.17
20 10 11 ⁄ 47 3 ⁄ 41 1 ⁄ 17
84 96 36 ⁄ 47 38 ⁄ 41 16 ⁄ 17
25 5 13 ⁄ 59 2 ⁄ 39 0⁄7
110 70 46 ⁄ 59 37 ⁄ 39 7⁄7
28 2 13 ⁄ 57 2 ⁄ 43 0⁄5
129 51 44 ⁄ 57 41 ⁄ 43 5⁄5
28 2 0 ⁄ 21 7 ⁄ 59 8 ⁄ 25
129 51 21 ⁄ 21 52 ⁄ 59 17 ⁄ 25
7 23 6 ⁄ 21 4 ⁄ 54 5 ⁄ 30
94 86 15 ⁄ 21 50 ⁄ 54 25 ⁄ 30
16 14
80 100
4 ⁄ 25 9 ⁄ 54 7 ⁄ 26
21 ⁄ 25 45 ⁄ 54 19 ⁄ 26
17 23 10 ⁄ 47 8 ⁄ 41 2 ⁄ 17
87 83 37 ⁄ 47 33 ⁄ 41 15 ⁄ 17
28 12 15 ⁄ 59 5 ⁄ 39 0⁄7
107 63 44 ⁄ 59 34 ⁄ 39 7⁄7
35 5 12 ⁄ 57 8 ⁄ 43
122 48 45 ⁄ 57 35 ⁄ 43
Odds ratio and 95% confidence interval
Risk ratio and 95% confidence interval
0.44 [0.19–0.99]
0.89 [0.79–1.00]
0.31 [0.11–0.86]
0.87 [0.79–0.97]
0.18 [0.04–0.79]
0.85 [0.78–0.93]
0.18 [0.04–0.79]
0.85 [0.78–0.93]
0.28 [0.11–0.68]
0.84 [0.76–0.95]
1.43 [0.66–3.1]
1.05 [0.94–1.18]
0.71 [0.35–1.41]
0.94 [0.82–1.07]
0.72 [0.35–1.53]
0.94 [0.83–1.08]
0.36 [0.13–0.98]
0.85 [0.76–0.97]
0.05 0.06
0.02 0.03
0.01 0.02
0.01 0.007
0.005 0.048
0.43 0.55
0.38 0.69
0.47 0.12
0.04 0 78
Scandinavian Journal of Immunology, 2012, 75, 449–454
H. Nielsen et al. Campylobacteriosis and Host Genes 453 .................................................................................................................................................................. Table 2 Continued
INFG +874 A>T rs2430561
TNFRSF11B 1181C>G rs2073618
GG Allele A G AA AT TT Allele A T CC CG GG Allele C G
Yes
No
0⁄5
5⁄5
32 8 4 ⁄ 21 12 ⁄ 59 4 ⁄ 25
125 45 17 ⁄ 21 47 ⁄ 59 21 ⁄ 25
20 20 4 ⁄ 21 12 ⁄ 54 4 ⁄ 30
81 89 17 ⁄ 21 42 ⁄ 54 26 ⁄ 30
20 20
76 94
P value
Odds ratio and 95% confidence interval
Risk ratio and 95% confidence interval
0.69 [0.30–1.62]
0.94 [0.82–1.08]
1.10 [0.55–2.19]
1.02 [0.89–1.16]
1.24 [0.62–2.47]
1.04 [0.91–1.19]
0.54 0.94
0.86 0.61
0.60
Chi-square and Fisher’s exact tests were used for comparison of genotype frequencies between occurrences of (a) reactive arthritis; (b) irritable bowel syndrome.
demonstrated that IL-18 is an essential coregulator of Th1 immunity. Two single-nucleotide polymorphisms (SNPs) in the promoter region of the IL18 gene (at positions – 607 and – 137) have been linked to diabetes [23] and rheumatoid arthritis [24] as well as to mucosal inflammation in Helicobacter pylori gastric infection [18]. It has been shown in vitro that specific IL18 genotypes (C ⁄ C at position –607 and G ⁄ G at position –137) have the potential to induce higher IL-18 production in response to external stimulation than do other genotypes [25], and this was supported by examination of levels of IL-18 in mucosal inflammation [18]. We observed an increased risk of RA in subjects with the G ⁄ G at position -137, which supports the role of IL-18 in development of post-infectious arthritis. In contrast, none of the subjects with C ⁄ C at position -137 developed RA. Irritable bowel syndrome following gastroenteritis is well recognized [6–10], and continuing mucosal inflammation may depend on polarization of the Th1 and Th2 cytokine response as well as other proinflammatory cytokine signals. These responses could be under genetic control contributing to the risk of post-infectious symptoms. However, we did not find an association between the determined SNPs and IBS after 6 months. Our observation does not exclude that other cytokine systems could have a role, and the mechanisms of IBS probably are multifactorial. For some cytokine polymorphism positions, we observed marginally significance in allelic but not in phenotypic distribution, but we only wish to conclude whether both analyses showed statistical significance. The present study has limitations as the sample size was not powered to detect exact incidences of complications or small changes in the risk of outcomes. The transformation of the findings into relative risk in the 2012 The Authors. Scandinavian Journal of Immunology 2012 Blackwell Publishing Ltd.
population is at present not possible. Furthermore, the mechanisms of action for the observed associations are so far unknown, and we did not have access to cytokine concentrations in samples from the patients. Our findings should ideally be confirmed in an unrelated validation cohort of campylobacteriosis patients, with the opportunity to examine the cytokine levels in both faeces and blood to further elucidate mechanisms of action. In conclusion, the risk of acquiring clinical gastroenteritis with Campylobacter jejuni ⁄ coli is related to the INFG + 874A>T of intron 1, but not to polymorphism in the promoter of interleukin-8. Polymorphisms in IL-18 and INF-c are linked to the risk of post-infectious reactive arthritis following culture-confirmed Campylobacter jejuni ⁄ coli infection, but not to irritable bowel syndrome.
References 1 Black RE, Levine MM, Clements ML, Hughes TP, Blaser MJ. Experimental Campylobacter jejuni infection in humans. J Infect Dis 1988;157:472–9. 2 Robinson DA. Infective dose of Campylobacter jejuni in milk. BMJ 1981;282:1584. 3 Teunis P, Brandhof WVD, Nauta M, Wagenaar J, Kerkhof HVD, Pelt WV. A reconsideration of the Campylobacter dose–response relation. Epidemiol Infect 2005;133:583–92. 4 Janssen R, Krogfelt KA, Cawthraw SA, Pelt WV, Wagenaar JA, Owen RJ. Host-pathogen interactions in Campylobacter infections: the host perspective. Clin Microbiol Rev 2008;21:505–18. 5 Gradel KO, Nielsen HL, Schønheyder HC, Ejlertsen T, Kristensen B, Nielsen H. Increased short- and long-term risk of inflammatory bowel disease after Salmonella or Campylobacter gastroenteritis. Gastroenterology 2009;137:495–501. 6 Stermer E, Lubezky A, Potasman I, Paster E, Lavy A. Is traveler’s diarrhea a significant risk factor for the development of irritable bowel syndrome? A prospective study. Clin Infect Dis 2006;43:898–901.
454 Campylobacteriosis and Host Genes H. Nielsen et al. .................................................................................................................................................................. 7 Neal KR, Hebden J, Spiller R. Prevalence of gastrointestinal symptoms six months after bacterial gastroenteritis and risk factors for development of the irritable bowel syndrome: postal survey of patients. BMJ 1997;314:779–82. 8 Gwee KA, Graham JC, McKendrick MWM et al. Psychometric scores and persistence of irritable bowel after infectious diarrhea. Lancet 1996;347:150–3. 9 Spiller RC. Postinfectious irritable bowel syndrome. Gastroenterology 2003;124:1662–71. 10 Marshall JK, Thabane M, Garg AX, Clark W, Moayyedi P, Collins SM. Eight year prognosis of postinfectious irritable bowel syndrome following waterborne bacterial dysentery. Gut 2010;59:605–11. 11 Thornley JP, Jenkins D, Neal K, Wright T, Brough J, Spiller RC. Relationship of Campylobacter toxigenicity in vitro to the development of postinfectious irritable bowel syndrome. J Infect Dis 2001;184:606–9. 12 Spiller RC, Jenkins D, Thornley JP et al. Increased rectal mucosal enteroendocrine cells, T lymphocytes and increased gut permeability following acute Campylobacter enteritis and its post-dysenteric irritable bowel syndrome. Gut 2000;47:804–11. 13 Hannu T, Mattila L, Rautelin H et al. Campylobacter-triggered reactive arthritis: a population-based study. Rheumatology 2002;41: 312–8. 14 Johnsen K, Ostensen M, Melbye AC, Melby K. HLA-B27-negative arthritis related to Campylobacter jejuni enteritis in three children and two adults. Acta Med Scand 1983;214:165–8. 15 Doorduyn Y, Pelt WV, Siezen CLE et al. Novel insight in the association between salmonellosis or campylobacteriosis and chronic illness, and the role of host genetics in susceptibility to these diseases. Epidemiol Infect 2008;136:1225–34. 16 Schiellerup P, Krogfelt KA, Locht H. A comparison of self-reported joint symptoms following infection with different enteric pathogens: effect of HLA-B27. J Rheumatol 2008;35:480–7.
17 Jiang ZD, Okhuysen PC, Guo DC et al. Genetic susceptibility to enteroaggregative Escherichia coli diarrhea: polymorphism in the interleukin-8 promotor region. J Infect Dis 2003;188:506–11. 18 Sakai K, Kita M, Sawai N et al. Levels of interleukin-18 are markedly increased in Helicobacter pylori-infected gastric mucosa among patients with specific IL18 genotypes. J Infect Dis 2008;197:1752– 61. 19 Ersryd A, Posserud I, Abrahamsson H, Simren M. Subtyping the irritable bowel syndrome by predominant bowel habit: Rome II versus Rome III. Aliment Pharmacol Ther 2007;26:953–61. 20 Nielsen H, Persson S, Olsen KEP, Ejlertsen T, Kristensen B, Schønheyder HC. Bacteraemia with Campylobacter jejuni: no association with the virulence genes iam, cdtB, capA or virB. Eur J Clin Microbiol Infect Dis 2010;29:357–8. 21 Daser A, Mitchison H, Mitchison A, Mu¨ller B. Non-classical-MHC genetics of immunological disease in man and mouse. The key role of pro-inflammatory cytokine genes. Cytokine 1996;8:593–7. 22 Geleijns K, Jacobs BC, Rijs WV, TioGillen AP, Laman JD, Doorn PAV. Functional polymorphisms in LPS receptors CD14 and TLR4 are not associated with disease susceptibility or Campylobacter jejuni infection in Guillan-Barre´ patients. J Neuroimmunol 2004;150: 132–8. 23 Kretowski A, Mironczuk K, Karpinska A et al. Interleukin-18 promoter polymorphisms in type 1 diabetes. Diabetes 2002;51: 3347–9. 24 Sivalingam SP, Yoon KH, Koh DR, Fong KY. Single-nucleotide polymorphisms of the interleukin-18 gene promoter region in rheumatoid arthritis patients: protective effect of AA genotype. Tissue Antigens 2003;62:498–504. 25 Giedraitis V, He B, Huang WX, Hillert J. Cloning and mutation analysis of the human IL-18 promoter: a possible role of polymorphisms in expression regulation. J Neuroimmunol 2001;112: 146–52.
Scandinavian Journal of Immunology, 2012, 75, 449–454
