RNA splicing and editing modulation of 5-HT2C receptor function ...

13 downloads 0 Views 2MB Size Report
Dec 18, 2012 - Aggressive impulsive behaviors in rodents, primates and suicide .... them in the arena, containing fresh bedding for each squad. Total time.
Molecular Psychiatry (2013) 18, 656–665 & 2013 Macmillan Publishers Limited All rights reserved 1359-4184/13 www.nature.com/mp

ORIGINAL ARTICLE

RNA splicing and editing modulation of 5-HT2C receptor function: relevance to anxiety and aggression in VGV mice CBP Martin1,6, F Ramond2,6, DT Farrington3, AS Aguiar Jr4, C Chevarin1, A-S Berthiau2, S Caussanel2, L Lanfumey1, K Herrick-Davis5, M Hamon1, JJ Madjar2 and R Mongeau1 Changes in serotonin2C receptor (5-HTR2c) editing, splicing and density were found in conditions such as depression and suicide, but mechanisms explaining the changes in 5-HTR2c function are unknown. Thus, mice expressing only the fully edited VGV isoform of 5-HTR2c, in which clinically relevant behavioral changes are associated with alterations in splicing and receptor density, were studied. VGV mice displayed enhanced anxiety-like behavior in response to a preferential 5-HTR2c agonist in the social interaction test. Nearly half of interactions between pairs of VGV congeners consisted of fighting behaviors, whereas no fighting occurred in wild-type (WT) mice. VGV mice also exhibited a striking increase in freezing behaviors in reaction to an innately aversive ultrasonic stimulus. This behavioral phenotype occurred in conjunction with decreased brain 5-HT turnover during stress. These functional data were put in relation with the 5-HTR2c mRNA splicing process generating a truncated protein (5-HTR2c-Tr) in addition to the full-length receptor (5-HTR2c-Fl). 5-HTR2c-Tr mRNA was less abundant in many brain regions of VGV mice, which concomitantly had more 5-HTR2c than WT mice. Fluorescence resonance energy transfer and bioluminescence resonance energy transfer studies in transfected living HEK293T cells showed that 5-HTR2c-Tr interacts with 5-HTR2c-Fl. The 5-HTR2c-Tr was localized in the endoplasmic reticulum where it retained 5-HTR2c-Fl, preventing the latter to reach the plasma membrane. Consequently, 5-HTR2c-Tr decreased 3 H-mesulergine binding to 5-HTR2c-Fl at the plasma membrane in a concentration-dependent manner and more strongly with edited 5-HTR2c-Fl. These results suggest that 5-HTR2c pre-mRNA editing and splicing are entwined processes determining increased 5-HTR2c levels in pathological conditions through a deficit in 5-HTR2c-Tr. Molecular Psychiatry (2013) 18, 656–665; doi:10.1038/mp.2012.171; published online 18 December 2012 Keywords: anxiety; depression; heterodimer; serotonin; 2,4-dinitrophenol

INTRODUCTION Aggressive impulsive behaviors in rodents, primates and suicide prone individuals are associated with low brain serotonin (5-HT) turnover, especially in the frontal cortex (FC).1,2 This decreased 5-HT function could be linked to changes in autoinhibitory feedback mechanisms mediated mainly by 5-HT1A and 5-HT1B/1D autoreceptors, but also indirectly via 5-HT2C receptors (5-HTR2c) on GABAergic interneurons3 that exert inhibition of 5-HT release during surges of endogenous 5-HT in response to acute stress and anxiety.4 Anxio-depressive disorders are associated in some individuals, with increased neuroendocrine and anxiety responses to the preferential 5-HTR2c agonist, m-chlorophenylpiperazine (mCPP),5–8 and individuals carrying the 5-HTR2c-Cys-23-Ser polymorphism, frequent in certain psychiatric populations,9,10 have increased cerebral bloodflow in their left FC in response to mCPP.11 Furthermore, an increased density of FC 5-HTR2c has been observed in individuals who committed suicide.12 The latter change, by increasing 5-HTR2c-mediated negative feedback regulation, could lead to reduce FC 5-HT availability. It thus becomes crucial to understand the molecular mechanisms underlying changes in 5-HTR2c density. Two cellular processes appear of importance: 5-HTR2c editing and alternative splicing. The editing process, whereby substitution of amino-acid

residues occurs in the second intracellular loop of the receptor, via conversion of adenosine into inosine by adenosine deaminases acting on pre-mRNA, is unique to the 5-HTR2c type among all 5-HT receptors. In vitro studies indicated that editing decreases both the coupling of the receptor with its downstream signaling system and its constitutive activity.13,14 Several clinical studies reported increased 5-HTR2c pre-mRNA editing in the FC of depressed suicide victims.15–17 Interestingly, increased levels of 5-HTR2c were found throughout the brain of transgenic VGV mice expressing only the fully edited receptor.18,19 5-HTR2c editing appears to interact with pre-mRNA splicing.20 Many 5-HT receptors go through alternative splicing, and as such, 5-HTR2c pre-mRNA results in two major products: RNA1 exhibiting a frame shift in the coding sequence leading to a premature stop codon that generates 5-HTR2c-Tr, a truncated receptor that does not bind ligands; and RNA2 coding for 5-HTR2c-Fl, the full-length receptor. Both mRNA are naturally occurring in rodent and human brains, and were found to co-exist in ependymal cells of the choroid plexus.21 At the clinical level, FC RNA2/RNA1 ratio was increased in individuals who committed suicide and this was positively correlated with editing efficiencies at several sites within the 5-HTR2c pre-mRNA.22

1 INSERM U894, Centre de Psychiatrie et de Neuroscience, UPMC, Fac. Med. Pierre and Marie Curie, Site Pitie´-Salpeˆtrie`re, Paris, France; 2Centre de Ge´ne´tique Mole´culaire et Cellulaire, CNRS UMR 5534, Universite´ Claude Bernard Lyon 1, Lyon, France; 3Wadsworth Center, New York State Department of Health, Albany, NY, USA; 4Department of Pharmacology, Universidade Federal de Santa Catarina, Floriano´polis, SC, Brazil and 5Center for Neuropharmacology and Neuroscience, Department of Psychiatry, Albany Medical College, Albany, NY, USA. Correspondence: Dr R Mongeau, INSERM U894, Fac. Med. Pierre and Marie Curie, Site Pitie´-Salpeˆtrie`re, 91 Boulevard de l’Hoˆpital, Paris 75634, France. E-mail: [email protected] 6 These authors contributed equally to this work. Received 7 May 2012; revised 12 October 2012; accepted 15 October 2012; published online 18 December 2012

5-HTR2c editing and splicing in anxiety and aggression CBP Martin et al

657 Several lines of mutant mice expressing only the fully edited VGV 5-HTR2c have recently been generated. They consistently display enhanced motor responses to 5-HTR2c ligands18,19 and other behavioral and metabolic changes associated with the increased 5-HTR2c density.18,23 Compared with wild-type (WT) mice, BALB/c VGV mice also displayed increased anxiety in the elevated plus-maze,24 while C57BL/6J VGV mice tended to be more anxious and presented increased energy expenditure and loss of fat mass associated with a decrease in cholesterol.18 The present study assessed the hypothesis whether editing, by interfering with a 5-HTR2c mRNA splicing process, can indirectly alter the density of 5-HTR2c on the cellular membrane and thereby explain related changes in emotional behaviors. Using C57BL/6J VGV mice as a model, we investigated how changes in behavior could be explained by modifications in 5-HTR2c splicing and editing. These mice were characterized by the emergence of aggressive impulsive behaviors not present in WT mice in the social interaction test, increased anxiogenic effect in response to a 5-HTR2c agonist and a stronger freezing reaction to an innate fear stimulus. Whether or not these behavioral changes could be related to the peculiar metabolic status rather than to the 5-HTR2c phenotype of VGV mice,18 was assessed by examining the behavioral consequences of increased energy expenditure and decreased body fat following treatment with 2,4-dinitrophenol, a mitochondrial uncoupling agent,25 in WT C57BL/6J mice. Quantification of 5-HTR2c mRNA in various brain areas indicated a decrease in RNA1 in VGV mice. In vitro investigations demonstrated that the product of RNA1, 5-HTR2c-Tr, prevents 5-HTR2c-Fl from reaching the plasma membrane and binding to its ligands. These experiments thus provided a functional link between 5-HTR2c editing, the splicing process, and the regulation of 5-HTR2c density and function, possibly accounting for the behavioral changes in VGV mice.

MATERIALS AND METHODS Animals Mice expressing VGV 5-HTR2c were generated and backcrossed for 410 generations into the C57BL/6J genetic background.18 They were housed under standard laboratory conditions (12-h light–dark cycle, lights on at 07:00 hours, 60% humidity, 21±1 1C room temperature) with free access to food and water. As previously reported,23 VGV mice were smaller than WT mice (at 4 months body weight: WT ¼ 29.3±0.6 g; VGV ¼ 25.3±0.8 g, Po0.01; mean values±s.e.m., n ¼ 5). Mice (2–4 months old) were usually kept 2–6 per cage (29  18 cm2) before the experiments, except for the aversive ultrasound paradigm, which was carried out in animals placed one per cage for at least 1 week before testing. In 5-HT turnover studies, some mice were stressed by placing them for 45 min inside a 50-ml tube perforated at the tip to allow breathing. They were gently immobilized inside the tube by a perforated rubber plug fixed around the tail. Experiments were conducted in agreement with institutional guidelines (no. 87–848, MAF, permission no. 75–116).

Social interaction test Mice were habituated to the arena (40  40 cm2) for two consecutive days to maximize the duration of social interactions. The following day, mice of same strain and size, and unfamiliar to each other were paired, injected with mCPP or saline, and kept in individual cages for 30 min before placing them in the arena, containing fresh bedding for each squad. Total time spent in active social interactions (defined as sniffing, fighting, chasing, grooming or crawling under and over each other) was scored from a recorded video using ODlog (Macropod Software, www.macropodsoftware. com) by an observer unaware of treatment groups.

Juvenile social investigation test The test was adapted from Christianson et al.26 Mice were habituated to the test arena (50  50 cm2) before the experiment. An adult mouse was presented to a 3-week-old C57BL/6J pup enclosed in a small grid circular cage, placed in the center of the arena. Social investigation (sniffing events & 2013 Macmillan Publishers Limited

toward the circular cage) was then analyzed for 5 min with Any-maze (Stoelting). Ambulation was scored by videotracking (Viewpoint).

Ultrasound-induced defense paradigm Mice were tested for their innate fear reactions to a train of ultrasonic stimuli, as previously described.27 In brief, 100-ms frequency sweeps of 17– 20 kHz, 85 dB, alternately 2 s ON and then 2 s OFF for 1 min, were delivered into the home cage after a 3-min baseline period. Flight reactions triggered during the ON periods were measured as the number of running events from one side of the cage to the other followed by behavioral arrest, while the percentage time freezing to the US was quantified by sampling events of complete immobility (except breathing) every 4 s during the OFF period and during a 1-min post-stimulus period.

Neurochemical studies Tissue levels of 5-HT and its metabolite 5-hydroxyindoleacetic acid (5-HIAA) were determined using HPLC-ED detection, as previously described4 (see Annex).

Immunohistochemistry Animals were decapitated, the brains were dissected on ice, then cut into a slab containing the FC and fixed in 4% paraformaldehyde. Immunohistochemistry with the 5-HT2C receptor polyclonal antibody in rabbit [1:200, ab32172 from Abcam, Cambridge, GB, UK) was adapted from a previous study28 (see Annex).

Cell culture and transfection HEK293T cells were cultured in DMEM (Cellgro, Manassas, VA, USA) with 10% fetal bovine serum (HyClone, Logan, UT, USA) and penicillin–streptomycin (Invitrogen, Carlsbad, CA, USA) at 37 1C and in 5% CO2. For fluorescence resonance energy transfer (FRET) experiments, cells were washed in phosphate-buffered saline, plated on poly-D-lysine-treated glass coverslips and transfected with 0.1 mg of the indicated plasmid DNA using 4 ml of lipofectamine reagent (Invitrogen) in serum-free culture media according to the manufacturer’s protocol. Cells were placed in serum-free media for 18 h before confocal analysis. For radioligand-binding experiments, cells were transfected with 6 mg of total plasmid DNA, and harvested 48 h later.

Receptor fusion proteins FRET studies were performed using both human and murine versions of 5HTR2c-Fl and 5-HTR2c-Tr. Receptor-binding experiments were performed using the murine 5-HTR2c-Fl non-edited (INI), edited (VGV, VSV and VNV), and 5-HTR2c-Tr. The cloning strategy, adapted from a previous protocol,29 can be found in Annex. The pEYFP–ER plasmid (Clontech, Mountain View, CA, USA) encoding a YFP fusion protein containing the ER targeting sequence of calreticulin with a KDEL retention sequence and the pEYFP– Golgi plasmid (Clontech) encoding a YFP fusion protein that specifically targets the trans-medial region of the Golgi apparatus were used as markers to visualize ER and Golgi, respectively.

Confocal microscopy, FRET and BRET studies HEK293T cells cultured on glass coverslips and transfected as described above, were visualized with 2 mm optical slice through the middle live cells using confocal microscopy, as previously described.30 FRET was measured by acceptor photobleaching and bioluminescence resonance energy transfer (BRET) using Renilla luciferase (Rluc) expressed as a fusion protein on the C-terminus of the 5-HTR2c-Fl (5-HTR2c Rluc) was done as previously described31 (see Annex).

Quantification of RNA levels by RT–qPCR Tissue samples dissected on ice were frozen in liquid nitrogen. The RNA extraction procedure was performed according to Nadam et al.32 The RT– qPCR amplification was performed with LC480 (Roche, Meylan, France) to determine the initial concentration of templates in samples from a calibration curve (6 log-wide scales of RNA1 and RNA2 cDNA concentrations, in triplicate; PCR efficiency41.95; R240.98). The crossing points of all samples were within the range of the calibration curve. Quantitect SYBR Green PCR kit (Qiagen, Valencia, CA, USA) was used according to the manufacturer’s recommendations. Primers: RNA1,33 forward: 50 -TGC reverse: 50 -TATCGCTGGACCGGAGTT TGATATGCTGGTGGGACTACT-30 , Molecular Psychiatry (2013), 656 – 665

5-HTR2c editing and splicing in anxiety and aggression CBP Martin et al

658 TCAGTT-30 ; RNA2,34 forward: 50 -CATCATGAAGATTGCCATCGTT-30 , reverse: 50 -AGTGTTCGTGAATAATACTACCTGCG-30 ; HTR2c-total mRNA, forward TGCTTAAAACTGAAGCAATAATGG, reverse AGGCCAATTAGGTGCACAAG were from Applied Biosystems (Courtaboeuf, France). The sum of RNA1 and RNA2 quantities was always equal to the total 5-HTR2c mRNA amount, and no significant 5-HTR2c-RNA323 product was detected. Results are expressed as RNA copies per 37.5 ng of total RNA.

Binding assays The binding assays and quantitative autoradiography using 3H-mesulergine, described in Annex, were adapted from Olaghere da Silva et al.19and Aloyo and Harvey.35

Drug administrations The 5-HTR2c agonist mCPP hydrochloride (Sigma-Aldrich, Saint-QuentinFallavier, France) was dissolved in 0.9% saline and injected at dose (base) of 0.1 mg kg  1 i.p., 30 min before the test. 5-HT depletion was performed using 4-Chloro-DL-phenylalanine methyl-ester hydrochloride (pCPA, Sigma-Aldrich; 300 mg (base) kg  1 per day  3 days). The mitochondrial uncoupling agent, 2,4-dinitrophenol,36 was administered in drinking water at a dose (10 mg l  1) estimated to be 0.25 mg per day for 2–4 weeks in 2-month-old mice.

Statistics Data are mean values±s.e.m. Two groups analyses were done with the Student’s t-test. The BRET and RT–qPCR data, the percentage inhibition produced by 5-HTR2c-Tr in the binding experiments, and social

interactions were analyzed using either the one- or two-way ANOVA (analysis of variance) followed by Bonferroni’s post hoc test.

RESULTS VGV mice exhibit modified emotional behaviors with changes in 5-HT turnover We tested the hypothesis that C57BL/6J VGV mice had increased anxiety-like behaviors, in particular in response to the 5-HTR2c agonist mCPP, the drug challenge of choice to investigate anxiety in humans and in rodents using the social interaction test.4,37 Although mCPP is not selective for 5-HTR2c, its anxiogenic effect, as much as that of acute selective serotonin reuptake inhibitors, is blocked by selective 5-HTR2c antagonists, but not by other 5-HT receptors antagonists.4,37,38 We used here a very low dose of mCPP (0.1 mg kg  1) that produces an anxiogenic trend and does not alter locomotion in C57BL/6J mice.4 It produced a large and significant decrease of social interactions in VGV mice (  62±12%) compared with WT mice (  38±11%, Figure 1a). At baseline, VGV mice displayed a large increase in social interactions (Figure 1a). However, these were mostly aggressive in VGV mice, resulting in 36% actual fighting behaviors, the latter behaviors being absent in WT mice (Figure 1a). Administration of mCPP did not reduce the proportion of aggressive behaviors vs other active social interactions behaviors. To determine the role played by aggression in the enhanced interactions of VGV mice,

Figure 1. Behavioral and brain neurochemical profiles of VGV mice. (a) VGV mice spent more time in active social interactions than wild-type (WT) mice and displayed fighting behaviors that were absent in WT mice. Injection of m-chlorophenylpiperazine (mCPP; 0.1) (0.1 mg kg  1, i.p.) 30 min before the social interaction test reduced social interactions. The two-way analysis of variance (ANOVA) indicated significant effects of Genotype [F(1,24) ¼ 41; Po0.001], Treatment [F(1,24) ¼ 20; Po0.001] and an interaction between the Genotype and the Treatment factors [F(1,24) ¼ 12; Po0.01]. Bonferroni post hoc test indicated a significant reduction of social interactions by mCPP only in the VGV group (Po0.001). A Student’s t-test on fighting behaviors in the VGV group (gray bars) did not indicate a significant decrease of these aggressions after administration of mCPP (P ¼ 0.33, n ¼ 6–7). (b) VGV mice did not display an increase in social interaction in the juvenile social investigation paradigm. The automated recording of ambulation revealed a significant decrease in the total distance traveled during the 5min period (WT ¼ 12.4±1.02 m, VGV ¼ 5.8±1.4 m, Po0.01, n ¼ 6–7). (c) VGV mice challenged with an aversive ultrasound (100 ms, 17–20 kHz sweeps, 85 dB, 2 s ON and 2 s OFF, during 1 min) displayed a marked increase in freezing behavior compared with WT mice (*Po0.001), but no change in the frequency of flight reactions. (d) The 5-HT turnover (5-HIAA/5-HT) observed immediately after stress (45-min restraint) was significantly decreased in the frontal cortex (FC), the hippocampus and the VTA/SN of VGV mice compared to WT mice (dPo0.01, n ¼ 5–6). In the baseline condition, there were also significant, albeit smaller, decreases (Po0.05, n ¼ 8–11) in the FC (WT ¼ 0.69±0.02, VGV ¼ 0.57±0.03), the hippocampus (WT ¼ 1.39±0.08, VGV ¼ 1.05±0.05) and the VTA/SN (WT ¼ 1.24±0.07, VGV ¼ 1.05±0.05). Molecular Psychiatry (2013), 656 – 665

& 2013 Macmillan Publishers Limited

5-HTR2c editing and splicing in anxiety and aggression CBP Martin et al

659 an alternative social investigation test was performed to assess the time spent by a freely moving adult mouse actively investigating an enclosed pup. In this condition, which excludes inter-adult aggression, VGV mice did not display more interactions (Figure 1b). Finally, 2,4-dinitrophenol-treated WT mice that were characterized by increased energy expenditure and decreased body fat/cholesterol levels, like that occurring in C57BL/6J VGV mice, displayed neither aggression nor increased inter-adult social interactions, in contrast to that observed with the mutants (see Annex, Supplementary Figures 1a–e). The behavioral phenotype was further assessed in the ultrasound-induced defense paradigm. Consistent with previous studies,27 ultrasound-induced freezing was low in WT mice tested in their home cage. In contrast, VGV mice spent most of their time freezing in reaction to the ultrasound during the OFF periods (Figure 1c). They also spent a large amount of time freezing (63±11%) during the 1-min post-stimulus period, whereas none of the WT mice froze during that period. VGV mice retained nevertheless a normal capacity for flight during the ultrasound ON periods (Figure 1c). Again after the 2,4-dinitrophenol treatment, fear behaviors were not altered (Annex, Supplementary Figures 1f and g), arguing for direct 5-HTR2c-mediated changes in VGV mice. As depicted in Figure 1d, the altered behavioral phenotype of VGV mice occurred in conjunction with decreases in 5-HT turnover, which were statistically more robust in all brain areas in the stress than in the basal condition. The changes in 5-HIAA/5HT ratios were explained by differences in both 5-HIAA and 5-HT levels (Annex Table 1).

Altogether, these results show marked neurochemical changes and altered emotional behavior associated with the VGV edition pattern. Since VGV mice also showed an increase in 5-HTR2c density,18,19 a modification in both RNA1 and RNA2 mRNA was investigated. RNA2/RNA1 5-HTR2c ratio is increased in brain areas of VGV mice In agreement with previous studies that showed in VGV mice an increased 5-HTR2c density in all brain areas where this receptor is normally expressed,18,19 5-HTR2c-like immunopositive cells were more densely stained and an autoradiography study indicated a 49±5 fold increase in [3H]mesulergine binding in FC tissues from VGV mice compared with WT mice (Figures 2a and b). The amount of RNA2, encoding functional 5-HTR2c (5-HTR2c-Fl), was quantified using RT–qPCR to determine if a corresponding increase in mRNA levels could account for the increased amount of 5-HTR2c proteins. RNA2 amount did not differ in VGV mice vs WT controls (Figure 2d). However, the RNA2/RNA1 ratios were nearly doubled in mutants compared with WT mice (Figure 2c). This is explained by large decreases in the RNA1 encoding 5-HTR2c-Tr in all areas (Figure 2e). Since 5-HT turnover was decreased in VGV mice (see above), the effect of decreasing 5-HT turnover was assessed in WT mice by inhibiting tryptophan hydroxylase with pCPA. This treatment had no effect on RNA1 levels in cortical or hippocampal tissues (Figure 2f), and produced only a marginal reduction in RNA1 amount in the VTA/ SN explaining a small, but significant increase in RNA2/RNA1 ratio (saline ¼ 2.06±0.11, pCPA ¼ 2.59±0.17, n ¼ 5; Po0.05).

Figure 2. 5-HTR2c protein and mRNA levels in VGV mice. (a) Typical images showing an increased 5-HTR2c-like immunoreactivity and [3H]mesulergine binding in the prelimbic portion of the frontal cortex (FC) in VGV compared with wild-type (WT) mice. Scale bar ¼ 25 mm. Autoradiography experiments were performed with or without spiperone (± spip) to prevent [3H]mesulergine (3 nM) binding at 5-HT2A receptor sites.19 (b) Amount of specific 5-HT2C receptor binding in the prelimbic portion of the FC in VGV compared with WT mice (mean±s.e.m., Student’s t-test, ***Po0.0001, n ¼ 4–5). (c) The ratio of RNA2 (encoding 5-HTR2c-Fl)/RNA1 (encoding 5-HTR2c-Tr) was increased in VGV mice compared with WT mice. The two-way analysis of variance (ANOVA) indicated a significant difference between Areas [F(2,26) ¼ 9; P ¼ 0.001] and between Genotype [F(1,26) ¼ 39; Po0.001] with no interactions. (d) These changes were not accounted for by variations in RNA2 levels, (e) but rather by decreases in RNA1 in VGV compared with WT mice. The two-way ANOVA indicated a significant difference between Areas [F(2,26) ¼ 30; Po0.001] and between Genotype [F(1,26) ¼ 30; Po0.001] with no interactions. (f ) Inhibition of tryptophan hydroxylase with pCPA (300 mg kg  1 per day  3 days, i.p.) did not change RNA1 levels, except in the VTA/SN. The two-way ANOVA indicated significant differences between Areas [F(2,22) ¼ 74; Po0.001] and between Treatment [F(1,22) ¼ 5; Po0.05] with a significant Area  Treatment interaction [F(2,22) ¼ 5; Po0.05]. *Po0.05, **Po0.01 Bonferroni’s post hoc test comparing Genotype or Treatment within a single area. & 2013 Macmillan Publishers Limited

Molecular Psychiatry (2013), 656 – 665

5-HTR2c editing and splicing in anxiety and aggression CBP Martin et al

660 These data show that the increase in 5-HTR2c density did not result from an increase in RNA2 levels, but was associated with an increase in RNA2/RNA1 ratio. This led us to investigate the functional link between RNA1 and RNA2 products, in experiments with cultured cells. 5-HTR2c-Tr retains 5-HTR2c-Fl in the endoplasmic reticulum of cultured cells In view of the changes in 5-HTR2c-Tr encoding RNA1 levels in VGV mice, we then investigated possible modulatory effects of 5-HTR2c-Tr in HEK293T cells. In these cells, 5-HTR2c-Fl/YFP was observed at the plasma membrane (Figure 3a, left), while 5-HTR2cTr/YFP remained inside the cell (Figure 3a, center) and none was found at the plasma membrane (Figure 3a, right). In another set of studies, YFP-tagged proteins targeted to the endoplasmic reticulum (ER/YFP) and Golgi (Golgi/YFP) served as markers to identify these intracellular structures by fluorescence confocal microscopy. The ER appears as a vast reticulated and tubular structure extending outward from the nuclear envelope to the plasma membrane (Figure 3b, left), while the Golgi apparatus appears as dense concentrated areas of fluorescence with a discrete perinuclear distribution (Figure 3b, right). Co-transfection of cells with cDNA encoding 5-HTR2c-Tr/CFP and the ER/YFP or

Golgi/YFP marker revealed that the truncated receptor is retained in the ER (Figure 3c, left) and did not traffic to the Golgi apparatus (Figure 3c, right). Cells co-transfected with 5-HTR2c-Fl/CFP and 5-HTR2c-Tr/YFP were then examined by confocal microscopy to determine the fate of 5-HTR2c-Fl in this condition. Cells synthesizing 5-HTR2c-Fl/ CFP alone exhibited fluorescence almost exclusively on the plasma membrane (Figure 3e), but when co-synthesized with 5-HTR2c-Tr, 5-HTR2c-Fl was retained inside the cell (Figure 3d, left). The CFP– YFP merged image shows a co-localization of 5-HTR2c-Tr/YFP and 5-HTR2c-Fl/CFP within the same intracellular compartments (Figure 3d, right). In contrast, 5-HTR2c-Fl/CFP co-expressed the truncated M4-muscarinic receptor (M4-Tr) remained exclusively localized at the plasma membrane (Figure 3e). FRET was performed in the ER of cells co-synthesizing 5-HTR2cFl/CFP (donor) and 5-HTR2c-Tr/YFP (acceptor) to determine if these isoforms were in close enough proximity to allow formation of heterodimers. Confocal images were captured, then cells were irradiated with 514 nm light to photobleach YFP (Figure 3f top), and images were captured after photobleaching (Figure 3f, bottom). If CFP and YFP are within 1–10 nm of each other and their chromophore dipoles are aligned, resonance energy is transferred from CFP to YFP following excitation of CFP by the external laser source (458 nm). As shown in Figure 3f (bottom right), CFP-to-YFP resonance energy transfer appeared as an increase in CFP fluorescence (donor dequenching) following YFP photobleaching, indicating that 5-HTR2c-Fl/CFP and 5-HTR2c-Tr/ YFP were closely connected, as expected from heterodimers. In contrast to the high FRET efficiency observed in cells cosynthesizing 5-HTR2c-Fl/CFP þ 5-HTR2c-Tr/YFP, no FRET was observed in cells synthesizing 5-HTR2c-Tr/CFP alone or in combination with the ER/YFP marker. To determine if positive FRET signals were specific and not random collisions from highly synthesized proteins within the ER, FRET efficiencies were calculated as a function of the donor/acceptor (uD/A) ratio and Figure 3. 5-HTR2c-Tr interacts with 5-HTR2C-Fl and retains the latter, full-length receptor, within the endoplasmic reticulum. Confocal fluorescence imaging of transfected HEK293 living cells. Scale bar (white line) ¼ 10 mm. Transfection with 0.1 mg of 5-HTR2c plasmid resulted in receptor levels of 3.2±0.2 pmol mg  1 protein. (a) 5HTR2c-Fl-YFP is present at the plasma membrane whereas 5-HTR2cTr-YFP remains inside the cell and never appears at the plasma membrane. The third panel is a merge of DIC and fluorescence images, indicating that the receptor is not present at the plasma membrane. (b) Localization of ER/YFP (YFP variant containing an ER targeting and retention sequence) and Golgi/YFP (YFP variant containing a Golgi apparatus targeting sequence). The Golgi apparatus appears as rounded, dense areas of concentrated fluorescence with a perinuclear distribution (white arrow). (c) 5HTR2c-Tr is retained within the ER and does not enter the Golgi compartment. Note that the ER appears faintly fluorescent as the Golgi apparatus marker is synthesized in the ER and then transported to the Golgi apparatus (white arrows). (d) In cells cosynthesizing 5-HTR2c-Fl/CFP and 5-HTR2c-Tr/YFP, most of 5-HTR2c-Fl does not reach the plasma membrane and co-localizes with 5HTR2c-Tr in the ER. (e) As a control, a truncated M4-muscarinic receptor (M4-Tr) was created, tagged with YFP, and co-synthesized in cells together with 5-HTR2c-Fl/CFP. The M4-Tr/YFP receptors were retained in the cell and displayed fluorescence patterns similar to that of ER/YFP or 5-HTR2c-Tr/YFP markers (center). However, 5HTR2c-Fl exhibited normal trafficking patterns and plasma membrane localization in these cells (right). (f ) Acceptor photobleaching fluorescence resonance energy transfer (FRET) in living HEK293T cells co-synthesizing 5-HTR2c-Fl/CFP and 5-HTR2c-Tr/YFP. Images were captured before and after photobleaching of the YFP in a region of the ER (marked by the white square). Interaction between 5-HTR2c-Fl/CFP and 5-HTR2c-Tr/YFP is visualized as an increase in CFP fluorescence (marked by the white arrow) following YFP photobleaching, showing an interaction between the two proteins.

Molecular Psychiatry (2013), 656 – 665

& 2013 Macmillan Publishers Limited

5-HTR2c editing and splicing in anxiety and aggression CBP Martin et al

661 acceptor fluorescence. FRET efficiency was dependent on uD/A ratio and Pearson’s correlation coefficient was near 1 (R2 ¼ 0.93; Annex, Supplementary Figures 2c–f). Furthermore, it was independent of receptor amount as monitored by total acceptor (YFP) fluorescence (Annex, Figure 2b). Additional FRET experiments were performed using 5-HTR2c-Tr and non-edited (INI) isoform of the murine 5-HTR2c and results (Annex, Figures 2c–f) indicated the formation of homodimers and heterodimers, consistently with the results above. BRET was performed to confirm FRET and confocal microscopybased intracellular trapping assays. BRET was measured in cells transfected with cDNA encoding 5-HTR2c-Fl/Rluc or b2-adrenergic/ Rluc and co-transfected with either cDNA encoding 5-HTR2c-Fl/ YFP, 5-HTR2c-Tr/YFP, M4-muscarinic/YFP or b2-adrenergic/YFP. Significant BRET, that is interactions above the bioluminescence level obtained from unrelated proteins coupling (BRET values near 0.05), was observed with 5-HTR2c-Fl/Rluc þ 5-HTR2c-Fl/YFP, 5-HTR2c-Fl/Rluc þ 5-HTR2c-Tr/YFP and with the control b2-adrenergic/Rluc þ b2-adrenergic/YFP (all BRET values were above 0.1; Annex, Supplementary Figure 3) but not with other combinations. Altogether, these results demonstrate for the first time a functional role played by 5-HTR2c-Tr. We therefore investigated if the retention of 5-HTR2c-Fl by 5-HTR2c-Tr in the ER had consequences on receptor ligand binding. [3H]mesulergine binding to 5-HTR2c is reduced in the presence of 5-HTR2c-Tr Membrane-binding assays were carried out on transfected HEK293 cells to determine whether 5-HTR2c-Tr alters the binding of the 5-HTR2c antagonist [3H]mesulergine. The co-expression of cDNA encoding 5-HTR2c-Fl þ 5-HTR2c-Tr in the 3:1 proportion was taken

as the comparison point since the RNA2/RNA1 ratio naturally occurring in vivo in brain areas rich in 5-HTR2c, such as, for example, the VTA/SN, was closely similar (22:8; see Figures 2d and e) in WT mice. Completely omitting the addition of 5-HTR2c-Tr (3:0 ratio) markedly increased the maximal binding capacity compared with the 3:1 proportion (Bmax; þ 52±11%, mean±s.e.m.; n ¼ 3– 4; Figure 4d). Consistently, increasing the amount of 5-HTR2c-Tr cDNA co-expressed with 5-HTR2c-Fl cDNA (3:3 ratio) decreased in turn [3H]mesulergine binding (  31±5%, Figure 4d). Interestingly, decreasing the proportion of 5-HTR2c-Tr cDNA had considerably more effect than increasing it (from 3:1–3:3), suggesting that the inhibitory effect of 5-HTR2c-Tr on 5-HTR2c present at the membrane does not follow a simple linear relationship. High specific binding (480%) and large amount of 5-HTR2c binding sites remained apparent in the 3:3 condition. Interestingly, neither [3H]mesulergine binding affinity (Figure 4a), nor the capacity of the 5-HTR2c agonist RO-60-0175 to inhibit [3H]mesulergine binding were changed by co-expression of 5-HTR2c-Tr (Figure 4b). Cells co-transfected with the cDNA encoding the 5-HTR2c-Fl VGV isoform did not reveal any significant changes in affinity either, but, as illustrated in Figure 4c, removing 5-HTR2c-Tr produced a major increase in Bmax. Overall, the increases of [3H]mesulergine binding was 1.5 or more times greater when cells were transfected with edited cDNA encoding 5-HTR2c VGV, VSV or VNV variants compared with the INI non-edited form (Figure 4d). The two-way ANOVA indicated a significant effect of changing the 5-HTR2c-Fl þ 5-HTR2c-Tr ratio (F(1,18) ¼ 79; Po0.0001), a significant effect of editing (F(3,18) ¼ 3; Po0.05) and a significant interaction between these factors (F(3,18) ¼ 3; Po0.05). Finally, whole cell [3H]mesulergine binding was also performed to monitor 5-HTR2c-Fl on intact plasma membrane in the presence of 5-HTR2c-Tr. 5-HTR2c-Fl þ 5-HTR2c-Tr co-synthesis

Figure 4. Reduction of maximal [3H]mesulergine binding capacity in the presence of 5-HTR2c-Tr. (a) Cell co-transfection with cDNA encoding 5-HTR2c-Fl and 5-HTR2c-Tr (at the 3:0, 3:1 and 3:3 ratios) dose dependently decreased 5-HTR2c maximal [3H]mesulergine binding capacity (Bmax) without altering binding affinity (5-HTR2c-Fl INI alone: Kd ¼ 1.8±0.5 nM; 3:1 of 5-HTR2c-Tr: Kd ¼ 2.3±0.6 nM; 3:3 of 5-HTR2c-Tr: Kd ¼ 2.1±0.5 nM, n ¼ 3–4). (b) The single site displacement of 3 nM [3H]mesulergine with RO 60–0175 with a pKi of 6.9 was not altered by coexpression of cDNA encoding HTR2c-Tr. (c) Cells transfected with cDNA encoding the edited VGV form of 5-HTR2c-Fl displayed similar 5-HTR2c binding affinity (5-HTR2c-Fl INI alone: Kd ¼ 1.8±0.5 nM vs 5-HTR2c-Fl VGV alone: Kd ¼ 1.7±0.1 nM; n ¼ 3–4) but Bmax was more strongly reduced by 5-HTR2c-Tr. Curves illustrate single experiments, repeated three times with similar results. (d) The percentage of 5-HTR2c-Trinduced inhibition of the maximal binding capacity was lower for the INI form than for all the other edited forms (VNV, VSV, VGV). The twoway analysis of variance (ANOVA) indicated significant effects of Ratio [F(1,18) ¼ 18.6; Po0.001] and of Editing [F(3,18) ¼ 8.1; P ¼ 0.01]. However, the extent of the inhibition produced by varying the ratio of 5-HTR2c-Tr to 5-HTR2c-Fl did not change as a function of the Editing factor [F(3,18) ¼ 0.8]. *Po0.05, **Po0.01 the 0:3 compared with the 1:3 condition, using the Bonferroni’s post hoc test comparing the edited isoforms to the INI form. & 2013 Macmillan Publishers Limited

Molecular Psychiatry (2013), 656 – 665

5-HTR2c editing and splicing in anxiety and aggression CBP Martin et al

662 (1:1) also resulted in significant decreases of binding (5-HTR2cFl ¼ 3.2±0.2 pmol mg  1 protein; 5-HTR2c-Fl þ 5-HTR2c-Tr ¼ 2.0± 0.2 pmol mg  1 protein, n ¼ 5; Po 0.01). DISCUSSION 5-HTR2c are major targets of antidepressant drugs, and studies point to changes in 5-HTR2c editing in relation to behavior and emotion, both in humans and in rodents.39 Mice producing exclusively the fully edited VGV form displayed more anxiety in response to the 5-HTR2c agonist mCPP and considerably more freezing in reaction to an innate fear stimulus. Paired VGV congeners exhibited also remarkably high levels of aggressive behaviors. These behavioral changes were most likely mediated by a change in serotonergic transmission as the effect of mCPP is known to be blocked by selective 5-HTR2c antagonists4,37 and because the other major phenotypic characteristic of VGV mice, an increase in energy expenditure leading to loss of body fat/cholesterol levels,18 has no influence on fear- and aggression-related behaviors, as supported by the data in 2,4dinitrophenol-treated WT mice. We have also observed a decreased 5-HT turnover in VGV mice, which was particularly robust in the stressed condition. Considering that 5-HTR2c mediate an indirect negative feedback on 5-HT release in stress situations,4 the decreased 5-HT turnover observed in VGV mice might be causally related to the large increase in the density of 5-HTR2c, as assessed by autoradiography,18,19 and immunohistochemistry. The enhanced 5-HTR2c-related behavioral function found in vivo is rather counterintuitive as cell transfection studies showed that 5-HTR2c mRNA editing decreases, rather than increases, receptor/Gaq-protein coupling and suppresses constitutive activity.13,14 As previously reported,23 we did not find increase in RNA2 encoding the 5-HTR2c found at the plasma membrane in any of the brain areas studied, that could directly account for the large increase in the receptor protein. Therefore, other more subtle mechanisms should be held responsible for the increased expression of 5-HTR2c in VGV mice: we envisaged here that these mice either have (1) a lack of constitutive internalization of 5-HTR2c-INI receptors and of other lowly edited forms or (2) a change in the 5-HTR2c splicing process. In fact, in all the brain regions studied, VGV mice exhibited less RNA1 encoding the truncated variant 5-HTR2c-Tr, a naturally occurring variant of the receptor that does not bind 5-HT and other 5-HTR2c ligands.21 In parallel with the increased receptor density, the RNA2/RNA1 ratio nearly doubled in VGV mice compared with WT mice. Since the increased RNA2/RNA1 ratio occurred in parallel with a decrease of 5-HT turnover in VGV mice, we wondered whether 5-HT depletion with pCPA would trigger changes in this RNA2/RNA1 ratio. It was generally not the case, although pCPA treatment caused a small decrease in the amount of RNA1 in the VTA/SN, where 5-HTR2c are expressed by dopaminergic cells.40 This increase in the RNA2/RNA1 ratio is most likely explained by an interaction between the fully edited 5-HTR2c RNA sequence of VGV mice and the processes leading to alternative splicing (Figure 5). Editing/splicing interaction occurs at editing sites close to the exon/intron boundaries and interferes with the normal regulation of alternative splicing of 5-HTR2c pre-mRNA via small nucleolar RNA.20,41 This RNA binds to a silencing element within exon 5b and promotes the formation of non-edited isoforms by masking a splicing silencer.41 We thoroughly examined, at the cellular level, the hypothesis that 5-HTR2c-Tr is not a simple byproduct of a defective splicing process, but participates rather actively in determining 5-HTR2c function via an interaction with 5-HTR2c-Fl. Investigation of the trafficking pattern of 5-HTR2c-Tr showed that it markedly differed from that of 5-HTR2c-Fl. Instead of being transported to the Golgi Molecular Psychiatry (2013), 656 – 665

apparatus and then to the plasma membrane, 5-HTR2c-Tr accumulated within the ER. On the other hand, we demonstrated by both FRET and BRET, that 5-HTR2c-Tr associates with 5-HTR2c-Fl to form heterodimers trapping 5-HTR2c-Fl into the ER, thereby assigning a possible regulatory function to 5-HTR2c-Tr. In addition, our membrane-binding experiments clearly showed that decreasing 5-HTR2c-Tr increased the Bmax of [3H]mesulergine binding without altering its affinity for the receptor. This result was also confirmed on whole cells with intact cell surface. The exact stoichiometry for the dominant negative effect of 5-HTR2c-Tr has not been determined, but it apparently does not involve a simple one-to-one dimer relationship. One shortcoming of our in vitro assay is the transient production of receptors at cells plasma membrane that probably does not allow observing the maximal inhibitory effect of 5-HTR2c-Tr, and which might occur in VGV mice thereby causing a build-up of 5-HTR2c at neuronal membrane over a much longer period. The phenomenon seems complex also because the increase in [3H]mesulergine binding triggered by decreasing the amount of 5-HTR2c-Tr was more significant when 5-HTR2c-Fl was of edited form (VSV, VNV, VGV) compared with the non-edited INI form. The reason for this is not clear yet, but further points to how much editing and splicing are entwined processes (Figure 5). Based on our cellular studies, one can thus predict that a deficit in 5-HTR2c-Tr would lead to more 5-HTR2c at the plasma membrane, as we observed here in VGV mice. Accordingly, the most likely interpretation of the primary change accounting for the enhanced 5-HTR2c responses of these mice is illustrated in Figure 5. When 5-HTR2c pre-mRNA editing is increased, there is an interference with the alternative splicing process, leading to a decrease in RNA1 encoding 5-HTR2c-Tr, which thereby releases a pool of 5-HTR2c-Fl that would normally be trapped within the ER. Future studies could make a tighter cause–effect relationship using an inducible mutant mouse line in which the fully edited VGV state is triggered postnatally. Indeed, prenatal factors might also determine life-long changes in 5-HTR2c density. As mentioned earlier, another alternative explanation is related to the lack of constitutive activity of the VGV isoform. Constitutive activity is closely linked with the rate of receptor internalization via G-protein-coupled receptor kinase and b-arrestin.42 Constitutive activity is maximal with INI and is inversely proportional to 5-HTR2c RNA editing.43 One could thus argue that a deficit of less edited or unedited forms, in particular the rapidly internalized INI form, would be responsible for the large increase of 5-HTR2c binding in VGV mice. However, mutant C57BL/6J mice expressing only INI were reported to have unchanged 5-HTR2c binding compared with WT mice.18 Therefore, although internalization is crucial for 5-HTR2c function, it could hardly explain the phenotype of VGV mice, compared with the 5-HTR2c ER trapping mechanism via 5-HTR2c-Tr (Figure 5). VGV mice behavioral phenotypes might be, at least partly, accounted for by the decrease in 5-HTR2c-Tr subsequently leading to a major increase in the density of 5-HTR2c. Mutant mice that over-express 5-HTR2c are indeed more anxious.24,44 Interestingly, hand in hand with their anxiogenic profile, VGV mice displayed a major increase in freezing to an innate aversive ultrasonic stimulus of specific frequency, indicating increased innate fear reactions. To the best of our knowledge, previous studies with VGV mice of the C57BL/6J strain had only shown a trend for more anxiety in the elevated plus-maze, which was consistent with the significant anxiogenic profile of BALB/c VGV mice.24 The high freezing of VGV mice to the ultrasound is reminiscent of that observed in mice previously exposed to inescapable foot-shocks.27 On the other hand, inescapable stress increases the levels of 5HTR2c mRNA in the amygdala,45 a structure well known to play key roles in both conditioned and unconditioned freezing,46 and the enhancement of freezing triggered by acute 5-HT reuptake inhibition is blocked by a selective 5-HTR2c antagonist.47 & 2013 Macmillan Publishers Limited

5-HTR2c editing and splicing in anxiety and aggression CBP Martin et al

663

Figure 5. Editing and splicing mechanisms possibly accounting for changes in 5-HTR2c function in relation with emotional behaviors. (a) The HTR2c gene generates a pre-mRNA that is edited or not by adenosine deaminases (ADAR1 and ADAR2) allowing the conversion of adenosine into inosine at various sites denominated A, B, E, C and D, located in exon 5. The process of RNA editing leads to 24 naturally occurring forms of the receptor (among which are the non-edited INI form and edited forms such as VGV, VSV and VNV;62 VGV mutant mice produce exclusively this fully edited VGV form). (b) The mRNA then goes through the splicing process leading principally to the RNA2 encoding the functional form of the receptor (5-HTR2c-Fl). There is also alternative splicing involving removal of introns at alternative sites within exon 5 and joining donor splice sites with an acceptor site in the exon 6.21 This produces a mRNA (RNA1) having a frame shift with premature stop codon that generates a truncated receptor (5-HTR2c-Tr). (c) Because the editing sites are very close to the exon/intron boundaries, editing interferes with normal regulation of alternative splicing of the HTR2c gene via small nucleolar RNA.20 (d) Functional 5-HTR2c (5-HTR2c-Fl), edited or not at specific amino-acid residues (red dots), require homodimerization of two receptor proteins.53 (e) Non-functional truncated receptors (5-HTR2c-Tr) homodimerize or make heterodimers that trap functional receptors within the endoplasmic reticulum. (f ) A deficit of RNA1 ultimately leads to an increased density of functional 5-HTR2c which thereby increases the inhibitory feedback mediated by these receptors during stress,4 and incidentally may contribute to anxious or aggressive behaviors.

Accordingly, 5-HTR2c-mediated mechanisms are clearly implicated in freezing behavior. In relation to the aggression phenotype, some human studies indicate an association between 5-HTR2c gene polymorphism and anger/aggression related traits48 or violent impulses,49 and 5-HTR2c stimulation triggers anger in anxious or antisocial patients.50 A decrease in 5-HTR2c-Tr in areas such as the FC & 2013 Macmillan Publishers Limited

might also play some role, as much as both an increased in RNA2/ RNA1 ratio and 5-HTR2c editing were found to be associated with self-aggression.22 The fact that aggressive VGV mice exhibit more 5-HTR2c is thus relevant to these clinical observations. The decreased 5-HT turnover found in these mice, particularly in stressful conditions, could explain the rise in aggression. Outward or self-directed aggressive impulses are released when 5-HT Molecular Psychiatry (2013), 656 – 665

5-HTR2c editing and splicing in anxiety and aggression CBP Martin et al

664 outflow is decreased, a behavioral imbalance generated among others, by deficits of fronto-cortical 5-HT1A/1B receptor input.1,2 Microinjections of 5-HT1A/1B receptor agonists into the FC specifically decrease aggressive impulses in mice in reaction to a provocative conspecific,1 while here injection of a 5-HTR2c agonist had the tendency to decrease the absolute amount of fighting in VGV mice. The opposite effects in VGV mice of the increased receptor density and the agonist stimulation might appear counterintuitive at first. This trend, however, appears to be related more to the behavioral inhibition generated by the anxiogenic drug mCPP, as fear behaviors became more important than aggressive drives, since the percentage of fighting compared with the overall active interactions tended instead to be increased by the drug challenge. A reduction in 5-HTR2c-Tr would ultimately lead to more 5-HTR2c-mediated inhibition of the stress-induced enhancement in 5-HT release, which would be consistent with the seminal finding that interpersonal and self-inflicted aggressions are associated with reduced 5-HT turnover.51 Interestingly, hetero-dimerization processes such as that found with 5-HTR2c-Tr and 5-HTR2c-Fl have previously been reported for other receptors. Indeed, homo- or hetero-dimerization determines the function of several G-protein-coupled receptors,52 and dimerization can be an essential step to generate a fully functional G-protein-coupled receptor complex.53 Furthermore, hetero-dimerization with a truncated variant and intracellular trapping of native receptors were shown for dopamine D3 receptors,54,55 with clear-cut consequences on D3-dependent behaviors.56 Schizophrenic patients have a large increase of this D3 receptor truncated variant,57 but not of 5-HTR2c-Tr.58 On the other hand, truncated non-functional 5-HT6 and 5-HT2A receptors do exist, but their functional role remains to be determined.59,60 Finally, a truncated variant of the 5-HT2B receptor that does not internalize upon agonist stimulation and that preferentially couples to a distinct G-protein appears important in pulmonary hypertension.61 Therefore, data in the literature and the present findings about the impact of alternative splicing and 5-HTR2c editing on emotional behaviors, all point to a new level of complexity in our understanding of monoaminergic transmission. Enhanced 5-HTR2c editing by interfering with alternative splicing would lead to a deficit of truncated receptors that normally exert a dominant negative effect on the addressing of the full-length 5-HTR2c protein to the membrane. This alternative splicing deficit is an important new avenue of investigation as it might explain, at least in part, psychiatric conditions such as anxio-depressive and aggressive behaviors. CONFLICT OF INTEREST The authors declare no conflict of interest.

ACKNOWLEDGEMENTS We thank Dr K Nishikura and The Wistar Institute (PA) for providing the VGV mice. This research was supported by INSERM, Universite´ Pierre et Marie Curie, European Community DevAnx (Health: F2-2007-201714) Program and ANR contract )Sercedit* (ANR-06-Neuro-045-01). CBP Martin was recipient of a fellowship from the French Ministe`re de la Recherche.

REFERENCES 1 Oquendo MA, Mann JJ. The biology of impulsivity and suicidality. Psychiatr Clin North Am 2000; 23: 11–25. 2 Ryding E, Lindstrom M, Traskman-Bendz L. The role of dopamine and serotonin in suicidal behaviour and aggression. Prog Brain Res 2008; 172: 307–315. 3 Liu S, Bubar MJ, Lanfranco MF, Hillman GR, Cunningham KA. Serotonin2C receptor localization in GABA neurons of the rat medial prefrontal cortex: implications for understanding the neurobiology of addiction. Neuroscience 2007; 146: 1677–1688.

Molecular Psychiatry (2013), 656 – 665

4 Mongeau R, Martin CB, Chevarin C, Maldonado R, Hamon M, Robledo P et al. 5-HT(2c) receptor activation prevents stress-induced enhancement of brain 5-HT turnover and extracellular levels in the mouse brain: modulation by chronic paroxetine treatment. J Neurochem 2010; 115: 438–449. 5 Ghaziuddin N, King CA, Welch KB, Zaccagnini J, Weidmer-Mikhail E, Mellow AM et al. Serotonin dysregulation in adolescents with major depression: hormone response to meta-chlorophenylpiperazine (mCPP) infusion. Psychiatry Res 2000; 95: 183–194. 6 Kahn RS, Wetzler S, Asnis GM, Kling MA, Suckow RF, van Praag HM. Pituitary hormone responses to meta-chlorophenylpiperazine in panic disorder and healthy control subjects. Psychiatry Res 1991; 37: 25–34. 7 Van Veen JF, Van der Wee NJ, Fiselier J, Van Vliet IM, Westenberg HG. Behavioural effects of rapid intravenous administration of meta-chlorophenylpiperazine (mCPP) in patients with generalized social anxiety disorder, panic disorder and healthy controls. Eur Neuropsychopharmacol 2007; 17: 637–642. 8 de Leeuw AS, Westenberg HG. Hypersensitivity of 5-HT2 receptors in OCD patients. An increased prolactin response after a challenge with meta-chlorophenylpiperazine and pre-treatment with ritanserin and placebo. J Psychiatr Res 2008; 42: 894–901. 9 Videtic A, Peternelj TT, Zupanc T, Balazic J, Komel R. Promoter and functional polymorphisms of HTR2C and suicide victims. Genes Brain Behav 2009; 8: 541–545. 10 Mazza M, Mandelli L, Martinotti G, Di NM, Tavian D, Negri G et al. Further evidence supporting the association between 5HTR2C gene and bipolar disorder. Psychiatry Res 2010; 180: 151–152. 11 Kuhn KU, Joe AY, Meyer K, Reichmann K, Maier W, Rao ML et al. Neuroimaging and 5-HT2C receptor polymorphism: a HMPAO-SPECT study in healthy male probands using mCPP-challenge of the 5-HT2C receptor. Pharmacopsychiatry 2004; 37: 286–291. 12 Pandey GN, Dwivedi Y, Ren X, Rizavi HS, Faludi G, Sarosi A et al. Regional distribution and relative abundance of serotonin(2c) receptors in human brain: effect of suicide. Neurochem Res 2006; 31: 167–176. 13 McGrew L, Price RD, Hackler E, Chang MS, Sanders-Bush E. RNA editing of the human serotonin 5-HT2C receptor disrupts transactivation of the small G-protein RhoA. Mol Pharmacol 2004; 65: 252–256. 14 Niswender CM, Copeland SC, Herrick-Davis K, Emeson RB, Sanders-Bush E. RNA editing of the human serotonin 5-hydroxytryptamine 2C receptor silences constitutive activity. J Biol Chem 1999; 274: 9472–9478. 15 Gurevich I, Tamir H, Arango V, Dwork AJ, Mann JJ, Schmauss C. Altered editing of serotonin 2C receptor pre-mRNA in the prefrontal cortex of depressed suicide victims. Neuron 2002; 34: 349–356. 16 Niswender CM, Herrick-Davis K, Dilley GE, Meltzer HY, Overholser JC, Stockmeier CA et al. RNA editing of the human serotonin 5-HT2C receptor. Alterations in suicide and implications for serotonergic pharmacotherapy. Neuropsychopharmacology 2001; 24: 478–491. 17 Iwamoto K, Kato T. RNA editing of serotonin 2C receptor in human postmortem brains of major mental disorders. Neurosci Lett 2003; 346: 169–172. 18 Kawahara Y, Grimberg A, Teegarden S, Mombereau C, Liu S, Bale TL et al. Dysregulated editing of serotonin 2C receptor mRNAs results in energy dissipation and loss of fat mass. J Neurosci 2008; 28: 12834–12844. 19 Olaghere da Silva UB, Morabito MV, Canal CE, Airey DC, Emeson RB, Sanders-Bush E. Impact of RNA editing on functions of the serotonin 2C receptor in vivo. Front Neurosci 2010; 4: 26. 20 Flomen R, Knight J, Sham P, Kerwin R, Makoff A. Evidence that RNA editing modulates splice site selection in the 5-HT2C receptor gene. Nucleic Acids Res 2004; 32: 2113–2122. 21 Canton H, Emeson RB, Barker EL, Backstrom JR, Lu JT, Chang MS et al. Identification, molecular cloning, and distribution of a short variant of the 5-hydroxytryptamine2C receptor produced by alternative splicing. Mol Pharmacol 1996; 50: 799–807. 22 Dracheva S, Chin B, Haroutunian V. Altered serotonin 2C receptor RNA splicing in suicide: association with editing. Neuroreport 2008; 19: 379–382. 23 Morabito MV, Abbas AI, Hood JL, Kesterson RA, Jacobs MM, Kump DS et al. Mice with altered serotonin 2C receptor RNA editing display characteristics of PraderWilli syndrome. Neurobiol Dis 2010; 39: 169–180. 24 Mombereau C, Kawahara Y, Gundersen BB, Nishikura K, Blendy JA. Functional relevance of serotonin 2C receptor mRNA editing in antidepressant- and anxietylike behaviors. Neuropharmacology 2010; 59: 468–473. 25 Harper JA, Dickinson K, Brand MD. Mitochondrial uncoupling as a target for drug development for the treatment of obesity. Obes Rev 2001; 2: 255–265. 26 Christianson JP, Ragole T, Amat J, Greenwood BN, Strong PV, Paul ED et al. 5-hydroxytryptamine 2C receptors in the basolateral amygdala are involved in the expression of anxiety after uncontrollable traumatic stress. Biol Psychiatry 2010; 67: 339–345. 27 Mongeau R, Miller GA, Chiang E, Anderson DJ. Neural correlates of competing fear behaviors evoked by an innately aversive stimulus. J Neurosci 2003; 23: 3855–3868.

& 2013 Macmillan Publishers Limited

5-HTR2c editing and splicing in anxiety and aggression CBP Martin et al

665 28 Yu HJ, Yamaguchi A. Endogenous serotonin acts on 5-HT2C-like receptors in key vocal areas of the brain stem to initiate vocalizations in Xenopus laevis. J Neurophysiol 2010; 103: 648–658. 29 Leung PK, Chow KB, Lau PN, Chu KM, Chan CB, Cheng CH et al. The truncated ghrelin receptor polypeptide (GHS-R1b) acts as a dominant-negative mutant of the ghrelin receptor. Cell Signal 2007; 19: 1011–1022. 30 Herrick-Davis K, Grinde E, Mazurkiewicz JE. Biochemical and biophysical characterization of serotonin 5-HT2C receptor homodimers on the plasma membrane of living cells. Biochemistry 2004; 43: 13963–13971. 31 Herrick-Davis K, Grinde E, Weaver BA. Serotonin 5-HT(2C) receptor homodimerization is not regulated by agonist or inverse agonist treatment. Eur J Pharmacol 2007; 568: 45–53. 32 Nadam J, Navarro F, Sanchez P, Moulin C, Georges B, Laglaine A et al. Neuroprotective effects of erythropoietin in the rat hippocampus after pilocarpineinduced status epilepticus. Neurobiol Dis 2007; 25: 412–426. 33 Doe CM, Relkovic D, Garfield AS, Dalley JW, Theobald DE, Humby T et al. Loss of the imprinted snoRNA mbii-52 leads to increased 5htr2c pre-RNA editing and altered 5HT2CR-mediated behaviour. Hum Mol Genet 2009; 18: 2140–2148. 34 Du Y, Stasko M, Costa AC, Davisson MT, Gardiner KJ. Editing of the serotonin 2C receptor pre-mRNA: effects of the morris water maze. Gene 2007; 391: 186–197. 35 Aloyo VJ, Harvey JA. Antagonist binding at 5-HT(2A) and 5-HT(2C) receptors in the rabbit: high correlation with the profile for the human receptors. Eur J Pharmacol 2000; 406: 163–169. 36 Caldeira da Silva CC, Cerqueira FM, Barbosa LF, Medeiros MH, Kowaltowski AJ. Mild mitochondrial uncoupling in mice affects energy metabolism, redox balance and longevity. Aging Cell 2008; 7: 552–560. 37 Bagdy G, Graf M, Anheuer ZE, Modos EA, Kantor S. Anxiety-like effects induced by acute fluoxetine, sertraline or m-CPP treatment are reversed by pretreatment with the 5-HT2C receptor antagonist SB-242084 but not the 5-HT1A receptor antagonist WAY-100635. Int J Neuropsychopharmacol 2001; 4: 399–408. 38 Dekeyne A, Denorme B, Monneyron S, Millan MJ. Citalopram reduces social interaction in rats by activation of serotonin (5-HT)(2C) receptors. Neuropharmacology 2000; 39: 1114–1117. 39 Martin CBP, Hamon M, Lanfumey L, Mongeau R. The role of 5-HT2C receptors in the antidepressant response: a critical review. In: Cryan JF, Leonard BE (eds) Psychopathology and Pharmacotherapy of Depression: Recent Advances and Future Needs. Karger: Basel, pp 155–181, 2010. 40 Bubar MJ, Cunningham KA. Distribution of serotonin 5-HT2C receptors in the ventral tegmental area. Neuroscience 2007; 146: 286–297. 41 Kishore S, Stamm S. Regulation of alternative splicing by snoRNAs. Cold Spring Harb Symp Quant Biol 2006; 71: 329–334. 42 Marion S, Weiner DM, Caron MG. RNA editing induces variation in desensitization and trafficking of 5-hydroxytryptamine 2c receptor isoforms. J Biol Chem 2004; 279: 2945–2954. 43 Herrick-Davis K, Grinde E, Niswender CM. Serotonin 5-HT2C receptor RNA editing alters receptor basal activity: implications for serotonergic signal transduction. J Neurochem 1999; 73: 1711–1717. 44 Kimura A, Stevenson PL, Carter RN, Maccoll G, French KL, Paul SJ et al. Overexpression of 5-HT2C receptors in forebrain leads to elevated anxiety and hypoactivity. Eur J Neurosci 2009; 30: 299–306.

45 Harada K, Yamaji T, Matsuoka N. Activation of the serotonin 5-HT2C receptor is involved in the enhanced anxiety in rats after single-prolonged stress. Pharmacol Biochem Behav 2008; 89: 11–16. 46 Martinez RC, Carvalho-Netto EF, Ribeiro-Barbosa ER, Baldo MV, Canteras NS. Amygdalar roles during exposure to a live predator and to a predator-associated context. Neuroscience 2011; 172: 314–328. 47 Burghardt NS, Bush DE, McEwen BS, LeDoux JE. Acute selective serotonin reuptake inhibitors increase conditioned fear expression: blockade with a 5-HT(2C) receptor antagonist. Biol Psychiatry 2007; 62: 1111–1118. 48 Serretti A, Mandelli L, Giegling I, Schneider B, Hartmann AM, Schnabel A et al. HTR2C and HTR1A gene variants in German and Italian suicide attempters and completers. Am J Med Genet B Neuropsychiatr Genet 2007; 144B: 291–299. 49 Virkkunen M, Goldman D, Linnoila M. Serotonin in alcoholic violent offenders. Ciba Found Symp 1996; 194: 168–177. 50 Klaassen T, Riedel WJ, van Praag HM, Menheere PP, Griez E. Neuroendocrine response to meta-chlorophenylpiperazine and ipsapirone in relation to anxiety and aggression. Psychiatry Res 2002; 113: 29–40. 51 Lidberg L, Tuck JR, Asberg M, Scalia-Tomba GP, Bertilsson L. Homicide, suicide and CSF 5-HIAA. Acta Psychiatr Scand 1985; 71: 230–236. 52 Jordan BA, Devi LA. G-protein-coupled receptor heterodimerization modulates receptor function. Nature 1999; 399: 697–700. 53 Herrick-Davis K, Grinde E, Harrigan TJ, Mazurkiewicz JE. Inhibition of serotonin 5-hydroxytryptamine2c receptor function through heterodimerization: receptor dimers bind two molecules of ligand and one G-protein. J Biol Chem 2005; 280: 40144–40151. 54 Karpa KD, Lin R, Kabbani N, Levenson R. The dopamine D3 receptor interacts with itself and the truncated D3 splice variant d3nf: D3-D3nf interaction causes mislocalization of D3 receptors. Mol Pharmacol 2000; 58: 677–683. 55 Scarselli M, Novi F, Corsini GU, Maggio R. Functional rescue of the inactive splice variant of the dopamine D3 receptor D3nf. Brain Res 2003; 987: 244–247. 56 Pritchard LM, Logue AD, Taylor BC, Ahlbrand R, Welge JA, Tang Y et al. Relative expression of D3 dopamine receptor and alternative splice variant D3nf mRNA in high and low responders to novelty. Brain Res Bull 2006; 70: 296–303. 57 Schmauss C. Enhanced cleavage of an atypical intron of dopamine D3-receptor pre-mRNA in chronic schizophrenia. J Neurosci 1996; 16: 7902–7909. 58 Dracheva S, Elhakem SL, Marcus SM, Siever LJ, McGurk SR, Haroutunian V. RNA editing and alternative splicing of human serotonin 2C receptor in schizophrenia. J Neurochem 2003; 87: 1402–1412. 59 Guest PC, Salim K, Skynner HA, George SE, Bresnick JN, McAllister G. Identification and characterization of a truncated variant of the 5-hydroxytryptamine(2A) receptor produced by alternative splicing. Brain Res 2000; 876: 238–244. 60 Olsen MA, Nawoschik SP, Schurman BR, Schmitt HL, Burno M, Smith DL et al. Identification of a human 5-HT6 receptor variant produced by alternative splicing. Brain Res Mol Brain Res 1999; 64: 255–263. 61 Deraet M, Manivet P, Janoshazi A, Callebert J, Guenther S, Drouet L et al. The natural mutation encoding a C terminus-truncated 5-hydroxytryptamine 2B receptor is a gain of proliferative functions. Mol Pharmacol 2005; 67: 983–991. 62 Burns CM, Chu H, Rueter SM, Hutchinson LK, Canton H, Sanders-Bush E et al. Regulation of serotonin-2C receptor G-protein coupling by RNA editing. Nature 1997; 387: 303–308.

Supplementary Information accompanies the paper on the Molecular Psychiatry website (http://www.nature.com/mp)

& 2013 Macmillan Publishers Limited

Molecular Psychiatry (2013), 656 – 665

Suggest Documents