Zhang et al. Stem Cell Research & Therapy (2015) 6:195 DOI 10.1186/s13287-015-0187-x
RESEARCH
Open Access
Roles of microRNA-34a targeting SIRT1 in mesenchymal stem cells Fengyun Zhang1,2, Jinjin Cui1,2, Xiaojing Liu3, Bo Lv1,2, Xinxin Liu1,2, Zulong Xie1,2 and Bo Yu1,2*
Abstract Introduction: Mesenchymal stem cell (MSC)-based therapies have had positive outcomes both in animal models of cardiovascular diseases and in clinical patients. However, the number and function of MSCs decline during hypoxia and serum deprivation (H/SD), reducing their ability to contribute to endogenous injury repair. MicroRNA-34a (miR-34a) is originally identified as a TP53-targeted miRNA that modulates cell functions, including apoptosis, proliferation, and senescence via several signaling pathways, and hence is an appealing target for MSC-based therapy for myocardial infarction. Methods: Bone marrow-derived MSCs were isolated from 60–80 g male donor rats. Expression levels of miR-34a were determined by qRT-PCR. The roles of miR-34a in regulating cell vitality, apoptosis and senescence were investigated using the cell counting kit (CCK-8) assay, flow cytometric analysis of Annexin V-FITC/PI staining and senescence-associated β-galactosidase (SA-β-gal) staining, respectively. The expression of silent information regulator 1 (SIRT1) and forkhead box class O 3a (FOXO3a) and of apoptosis- and senescence-associated proteins in MSCs were analyzed by western blotting. Results: The results of the current study showed that miR-34a was significantly up-regulated under H/SD conditions in MSCs, while overexpression of miR-34a was significantly associated with increased apoptosis, impaired cell vitality and aggravated senescence. Moreover, we found that the mechanism underlying the proapoptotic function of miR-34a involves activation of the SIRT1/FOXO3a pathway, mitochondrial dysfunction and finally, activation of the intrinsic apoptosis pathway. Further study showed that miR-34a can also aggravate MSC senescence, an effect which was partly abolished by the reactive oxygen species (ROS) scavenger, N-acetylcysteine (NAC). Conclusions: Our study demonstrates for the first time that miR-34a plays pro-apoptotic and pro-senescence roles in MSCs by targeting SIRT1. Thus, inhibition of miR-34a might have important therapeutic implications in MSC-based therapy for myocardial infarction.
Introduction Ischemic heart disease (IHD) is the leading cause of death worldwide, and the resulting heart failure aggravates a country’s health burden, particularly in developed countries [1]. Existing therapies are typically only able to slow, rather than reverse or prevent, the progression of heart failure. Furthermore, side effects remain the key
* Correspondence:
[email protected] 1 Key Laboratories of Education Ministry for Myocardial Ischemia Mechanism, The Second Affiliated Hospital of Harbin Medical University, 148 Baojian Road, Harbin 150086, P.R. China 2 Department of Cardiology, The Second Affiliated Hospital of Harbin Medical University, 148 Baojian Road, Harbin 150086, P.R. China Full list of author information is available at the end of the article
issue among these effective therapeutics [2]. In the last few years, bone marrow-derived mesenchymal stem cells (MSCs) have been found to function as one of the most suitable candidate seed cells for repairing and regenerating cardiomyocytes as well as restoring heart function, and have been widely studied [3, 4]. Transplantation of MSCs leads to improved neovascularization of ischemic myocardium and inhibition of myocardial fibrosis, in addition to an increase in the secretion of prosurvival growth factors, including vascular endothelial growth factor, insulin-like growth factor, and hepatocyte growth factor [4, 5]. Despite these advantages, the poor survival rate of MSCs within the first few days after engrafting in
© 2015 Zhang et al. Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Zhang et al. Stem Cell Research & Therapy (2015) 6:195
infarcted hearts leads to only marginal functional improvement [6, 7]. The harsh microenvironment of the infarcted myocardium produces high levels of oxidative stress, which makes a great contribution to cellular senescence and causes a sharp decline in the proliferative capacity and regenerative potential of MSCs [8]. There is thus an urgent need to identify a strategy to protect the cells against the hostile microenvironment created by ischemia, hypoxia, the inflammatory response, and pro-apoptotic and pro-senescence factors in order to improve the efficacy of MSC transplantation therapy. MicroRNAs (miRNAs) are endogenous ~22-nucleotide RNAs that have emerged as negative regulators of gene expression, acting by targeting mRNAs for cleavage or translational repression, which occurs primarily through base pairing to the 3′ untranslated regions (UTRs) of target mRNAs [9, 10]. With rapid advances in understanding of the regulation and roles of these small, noncoding RNAs in cardiac pathology, the therapeutic potential of regulation of miRNAs in cardiac disease settings is considered high [9, 11]. Among the known miRNAs, expression of miR-34a was found to be elevated in mouse hearts after myocardial infarction (MI) [12] and in cardiac tissue from patients with heart disease [13], while inhibition of the expression of miR-34a alleviated apoptosis and senescence in myocardial cells [14, 15] and other cell lines [16–18]. However, the precise role of miR-34a in MSCs has not been unraveled to date. Silent information regulator 1 (SIRT1), one of the potential targets of miR-34a [19], is an NAD-dependent deacetylase that regulates apoptosis in response to oxidative and genotoxic stress and plays a critical role in regulating cell cycle, senescence, and metabolism [19–21]. Initially identified as a longevity gene, SIRT1 has recently been implicated as a novel modulator of myocyte homeostasis, playing a key role in cardiomyopathy through the deacetylation of forkhead box O transcription factor 3a (FOXO3a) [20], which was also acknowledged as the transcription factor most closely related to the antioxidative protective effects associated with longevity [22, 23]. Further study showed in endothelial progenitor cells (EPCs) that SIRT1 has a pivotally protective role in the regulation of EPC apoptosis induced by H2O2, and that SIRT1 exerted this protective effect by inhibiting FOXO3a via FOXO3a ubiquitination and subsequent degradation [24]. However, it is entirely unknown whether SIRT1 affects biological activities in MSCs; and if so, what role FOXO3a plays in this process. In the current study, we tested the hypothesis that overexpression of miR-34a increases cellular susceptibility to hypoxia and serum deprivation (H/SD)-induced apoptosis and aggravates cell senescence, and investigated the underlying mechanisms. The results showed that miR-34a played a crucial role in a plethora of
Page 2 of 13
biological processes via regulation of SIRT1/FOXO3a and the reactive oxygen species (ROS) pathway in MSCs. Inhibition of miR-34a might therefore be a promising therapeutic strategy for enhancing the biological functions of MSCs, thus demonstrating great therapeutic potential in clinical transplantation.
Materials and methods Ethics statement
Male Sprague–Dawley rats weighing 60–80 g were obtained from the Laboratory Animal Science Department of the Second Affiliated Hospital of Harbin Medical University, Heilongjiang, P.R. China. All experimental animal procedures were approved by the Local Ethical Committee on Animal Care and Use of Harbin Medical University. MSC culture
MSCs were cultured using the whole bone marrow adherent method, as described previously [25]. Briefly, total bone marrow was harvested from the femora of rats and was plated into 25 cm2 culture flasks at a concentration of 106 cells/ml in Iscove’s modified Dulbecco’s medium (IMDM; HyClone-Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10 % fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) and 1 % penicillin/ streptomycin (Beyotime Institute of Biotechnology, Nantong, China), at 37 °C with 5 % CO2. After 3 days of incubation, the medium was changed and then replaced every 3 days thereafter. Approximately 7–9 days after seeding, the cells became 70–80 % confluent. The adherent cells were released from the dishes using 0.25 % trypsin (Beyotime Institute of Biotechnology, Beijing, China) and expanded at a 1:2 or 1:3 dilution. MSCs at passage 3–5 were used in all experiments. MSCs were characterized by flow cytometric analysis for the expression of the typical markers CD90, CD29, and CD44 (all from BD Biosciences, Franklin Lakes, NJ, USA), and the absence of the hematopoietic markers CD45 (eBioscience, San Diego, CA, USA) and CD34 (Santa Cruz Biotechnology, Inc., Dallas, TX, USA), as reported previously [25]. Cell viability assay
The viability of MSCs was determined using the cell counting kit-8 (CCK-8) assay (Beyotime Institute of Biotechnology, Beijing, China) in accordance with the manufacturer’s protocols. Cells were seeded into a 96-well plate (3000 cells per well), and their growth was measured following addition of 10 μl CCK-8 into the culture medium for 2 hours. The absorbance of each well was quantified at 450 nm (Tecan Infinite M200 microplate reader; LabX, Austria). All data were calculated from triplicate samples.
Zhang et al. Stem Cell Research & Therapy (2015) 6:195
Page 3 of 13
MSC H/SD treatment
RNA extraction and quantitative RT-PCR
Apoptosis was induced by H/SD in vitro, which was designed to mimic the in vivo conditions of ischemia in the myocardium and was carried out as reported previously [26]. Briefly, MSCs were washed and cultured with serum-free IMDM and incubated in a 5 % CO2/95 % N2 incubator (controlled atmosphere chamber; PLAS-Labs, Lansing, MI, USA) for 6 hours. MSCs incubated in a 5 % CO2/95 % O2 incubator were used as the normoxic control and cultured in complete medium.
For analysis of miR-34a expression, total RNA was extracted from the MSCs using TRizol reagent (Invitrogen, Shanghai, China) and reverse-transcribed into cDNA according to the manufacturer’s instructions. Quantitative RT-PCR (qRTPCR) was performed to analyze the level of miR-34a with the miRcute miRNA First-Strand cDNA Synthesis Kit and the miRcute miRNA qPCR Detection Kit (SYBR Green; Tiangen, Beijing, China). All primers for miR-34a and U6 for the TaqMan miRNA assays were purchased from Gene Pharma. Relative gene expression levels were calculated by comparing the △Ct values between control and experimental conditions for each PCR target using the following equation:
Measurement of apoptosis
Apoptosis was determined by staining cells with Annexin V–fluorescein isothiocyanate (FITC) and counterstaining with propidium iodide (PI) using the Annexin V–FITC/PI apoptosis detection kit (BD PharMingen, San Diego, CA, USA). Briefly, 0.5 × 106 cells were washed twice with phosphate-buffered saline (PBS) and stained with 5 μl Annexin V–FITC and 5 μl PI in 1× binding buffer (BD PharMingen) for 15 minutes at room temperature in the dark. Analyses were performed using bivariate flow cytometry in a BD FACSCanto II equipped with BD FACSDiva software (Becton-Dickinson, San Jose, CA, USA). Target gene prediction
To identify the potential targets of miR-34a that mediated its pro-apoptotic role in MSCs, bioinformatics algorithms including miRBase (University of Manchester, Manchester, UK), TargetScan (David Bartel Lab, Whitehead Institute for Biomedical Research, MA, USA), PicTar (Rajewsky lab, NY, USA and Max Delbruck Centrum, Berlin, DE), and miRanda (Computational Biology Center at MSKCC, NY, USA) were applied. Cell transfection
Before transfection, MSCs were replanted into six-well plates at a density of 2 × 105 cells per well and incubated overnight. For overexpression or inhibition of miR-34a, cells were transfected with different concentrations of miR-34a mimic or miR-34a inhibitor (both from Invitrogen, Carlsbad, CA, USA). For small interfering RNA (siRNA)-mediated gene knockdown, 100 nM SIRT1 siRNA (GenePharma Co., Ltd, Shanghai, China) was transfected into cells. As controls, cells were transfected with negative control (NC) mimic, NC inhibitor of miR-34a (both from Invitrogen,Carlsbad, CA, USA), or scrambled siRNA (siRNA-NT) of SIRT1 (GenePharma Co., Ltd, Shanghai, China). All miRNAs and siRNA were transfected into MSCs using a commercial transfection reagent (X-treme siRNA Transfection Reagent; Roche Applied Science, Penzberg, Germany) according to the manufacturer’s protocol. Forty-eight or 72 hours after transfection, cells were harvested for further analysis.
Relative gene expression ¼ 2‐ðΔ Ct
sample‐Δ CT controlÞ
:
For several other genes, total cellular RNA was isolated and reverse-transcribed using the transcriptor First-Stand cDNA Synthesis Kit, according to the manufacturer’s instructions. qRT-PCR was carried out using the fast-start universal SYBR master and fluorescence quantitative PCR system [27]. The relative expression level of mRNAs was normalized to that of the internal control glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using the 2–ΔΔCt cycle threshold method. Table 1 presents all related gene sequences. Measurement of mitochondrial membrane potential
Mitochondrial membrane potential (ΔΨm) was measured using the JC-1 mitochondrial membrane potential assay kit (Beyotime Institute of Biotechnology, Beijing, China). JC-1 was widely used to assess changes in ΔΨm and mitochondrial permeability transition. After designated treatment, cells were incubated with JC-1 working dye for 20 minutes, then washed twice with cold JC-1 staining buffer and visualized under a fluorescence microscope (DMI4000B; Leica, Wetzlar, Germany). ROS staining
Cells were left untreated or pretreated with NAC, miR-34a mimic, siRNA-SIRT1, and miR-34a inhibitor separately or in combination and then stimulated with the diluted fluoroprobe 2′,7′-dichlorodihydrofluorescein diacetate (DCFHDA; Beyotime Institute of Biotechnology, Beijing, China) for 20 minutes at 37 °C with slight shaking every 5 minutes. After washing with serum-free culture medium, the cells were collected and examined by flow cytometry. Senescence-associated β-galactosidase staining
MSC senescence was determined by in situ staining for senescence-associated β-galactosidase (SA-β-gal) using a senescence cell histochemical staining kit (Beyotime Institute of Biotechnology, Beijing, China). Briefly, MSCs after treatment were first fixed for 30 minutes at room temperature in fixation buffer. After washing with
Zhang et al. Stem Cell Research & Therapy (2015) 6:195
Page 4 of 13
Table 1 Primers for quantitative RT-PCR and oligonucleotides Name
Sequence
Quantitative RT-PCR miR-34a
SIRT1
FOXO3a
U6 β-actin
Forward
5′-AAGGCCACGGATAGGTCCATA-3′
Reverse
5′-CGCTTTGGTGGTTCTGAAAGG-3′
Forward
5′-AAGGCCACGGATAGGTCCATA-3′
Reverse
5′-CGCTTTGGTGGTTCTGAAAGG-3′
Forward
5′-TGCCGATGGGTTGGATTT-3′
Reverse
5′-CCAGTGAAGTTCCCCACGTT-3′
Forward
5′-AAGGCCACGGATAGGTCCATA-3′
Reverse
5′-CGCTTTGGTGGTTCTGAAAGG-3′
Forward
5′-CCCAGCACAATGAAGATCAAGATCAT-3′
Reverse
5′-ATCTGCTGGAAGGTGTACAGCGA-3′
Oligonucleotide miR-34a mimic
UGGCAGUGUCUUAGCUGGUUGUU CAACCAGCUAAGACACUGCCAUU
NC mimic
UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
miR-34a inhibitor
UGGCAGUGUCUUAGCUGGUUGUU
NC inhibitor
CAGUACUUUUGUGUAGUACAA
siRNA-SIRT1
GCACCGAUCCUCGAACAAUTT AUUGUUCGAGGAUCGGUGCTT
siRNA-NT
UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
FOXO3a forkhead box O transcription factor 3a, miRNA microRNA, NC negative control, siRNA small interfering RNA, siRNA-NT scrambled siRNA, SIRT1 silent information regulator 1
PBS, cells were incubated with β-galactosidase staining solution for 16 hours at 37 °C without CO2. The reaction was stopped by the addition of PBS. Statistical analysis was performed by counting 600 cells for each sample. Protein extraction and western blot analysis
After designated treatment, cells were washed twice with ice-cold PBS, and the total protein concentration was analyzed using the bicinchoninic acid assay (BCA; Beyotime Institute of Biotechnology, Beijing, China) according to the manufacturer’s instructions. Total cell extracts (50 μg total protein) were resolved by sodium dodecyl sulfate (SDS)– 10 % polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride (PVDF) membranes. Nonspecific binding was inhibited by incubating the membranes with 8 % skimmed milk in Tris-buffered saline (TBS) with 0.5 % Tween-20. Subsequently, membranes were incubated with antibodies against SIRT1, FOXO3a, cleaved-caspase 3 (Cl.CASP3), cleaved-polyADP-ribose polymerase 1 (Cl.PARP1), cytochrome c, P53 (all from Cell Signaling Technology, Danvers, MA, USA), p16, γ-H2A.X (both from Abcam, Cambridge, MA, USA), p21 (Santa Cruz, CA, USA), and β-actin (Zhongshan Golden Bridge Biotechnology, Beijing, China) overnight at 4 °C at an appropriate dilution (1:1000). The membranes were washed with TBS with Tween-20 (TBS-T) and then incubated with peroxidase-conjugated Affinipure goat anti-rabbit IgG (H + L) and anti-mouse IgG (H + L)-labeled secondary
antibodies (Zhongshan Golden Bridge Biotechnology, Beijing, China) diluted at 1:5000 for 1 hour at 37 °C. Specific complexes were visualized on an X-ray film using ElectroChemi-Luminescence (ECL) detection with BeyoECL Plus (Beyotime Institute of Biotechnology, Beijing, China) following the manufacturer’s protocol. All data were obtained in triplicate, independent experiments. Statistical analysis
All data were analyzed using SPSS 19.0 (SPSS Inc., Chicago, IL, USA) and were expressed as mean ± standard deviation (SD). Comparisons between two groups were performed using Student’s t test, while the significance of differences between three or more experimental groups was determined by one-way analysis of variance. P
