S7 Table. Descriptive statistics of POOLseq sequence read ... - PLOS

Recommend Documents

S7 Table. Descriptive statistics for KOF indices. - PLOS

129. Trade Globalization. 56.35. 19.82. 22.12. 89.21. 129. Financial Globalization. 71.69. 21.46. 18.08. 99.32. 129. Social Globalization. 74.42. 8.30. 50.34.

Table S7 - PLOS

*Lefty2 (Ebaf, Lefta, AV214969,. MGC98569, 6030463A22Rik, left- right determination, factor A). TGFb signalling, growth factor activity, cell growth, growth, axial ...

Table 1 DESCRIPTIVE STATISTICS

b) China Financial Policy Research Centre, and School of Finance, Renmin Uinversity ... This paper examines the cross-sectional relation between corporate ..... We then compute the annual Amihud ratio as an average of daily Amihud ratios ...

S7 Table - PLOS

Amoebiasis (4). 7124 3592 3586 5055. C=106; E=0.44; R=9.11;. adjP=0.0028. Type I diabetes mellitus. (3). 7124 3592 4049. C=43; E=0.18; R=16.85;. adjP= ...

Table S7 - PLOS

Genes with increased expression in B. anthracis Sterne (34F2) in CO2 (MGM + 0.8% bicarbonate). *SEQUENCE ID GENE INFO. Fold difference. GBAA0167.

S7 Table. - Plos

... D); Pristimantis hernandezi (EN, D); Pristimantis ignicolor (EN, D); Pristimantis incanus ...... D); Marmosops handleyi (CR, D); Monodelphis unistriata (CR, U); ...

S7 Table. - PLOS

Left Lateral Occipital Cortex inferior division. -61 -95 -17 ... Left Temporal Occipital Fusiform Cortex. -45 -63 -17 ... Right Juxtapositional Lobule Cortex. 3. 1. 47.

S7 Table. - PLOS

S7 Table. Full single-level regression models for post-consumption levels of product endorsement. ... Stepwise regression was conduced twice, using either.

S7 Table - PLOS

KCTD8 Fwd AACCAGTACCGCGACGACAA. IFIT2 Fwd. CCCTGCCGAACAGCTGAGAA. KCTD8 Rev AGCTCATTACAGGAAGTCCCACT IFIT2 Rev.

Table S7 - PLOS

4.90E-07. 0.000126. ATPases involved in chromosome partitioning. COG0294. 1.42. 21.82. 3.53E-05. 0.008489. Dihydropteroate synthase and related enzymes.

S7 Table. - PLOS

sequences. D-hordeins (6). BAA11642.1. 318 D hordein. H. vulgare ssp. vulgare. 8. BAK04239.1. 318 Predicted protein. H. vulgare ssp. vulgare. 8. AFM77735.1.

table s7 - PLOS

APO S581L GLYCYL-TRNA SYNTHETASE MUTAN. LGRI .... HUMAN ARGININOSUCCINATE SYNTHASE IN COMPLEX WITH ASPARTATE AND CITRULLINE.

S7 Table. - PLOS

1.04. (0.82â1.32). Other. 1. (0.86â1.16). 0.96. (0.84â1.10). 1.07. (0.85â1.36). 0.96. (0.81â1.14). 0.87. (0.62â1.22). 0.92. (0.80â1.06). Absence of spouse=Ref. 1. 1.

Table S7 - PLOS

signature in Caenorhabditis elegans Dauer larvae and long-lived daf-2 mutants implicates detoxification system in longevity assurance. J Biol Chem 279:.

S7 Table - PLOS

Stout. 57. 48. 12 - 267. 30 (55). 54. Imperial Stout. 86. 79. 14 - 475. 105 (126). 83. Sour ales. 30. 21. 14 - 116. 6 (82). 7. Fruit/Vegetable/Spice. 56. 49. 12 - 127.

S7 Table - PLOS

Table S7. Regulated metabolites by FABP5 in ADSC (CE-TOFMS). ID. Compound name. Ratio. P. A_0024 Glycerol 3-phosphate. 2.0. 0.001. A_0044 ...

Table S1a Descriptive statistics of core variables - Plos

14.62 3.35 266.09. 48.03. Italy. 4,037. 10.1%. 5.36. 14.93. 35.90. 30.60. 13.21. 44.09. 38.10. 10.52. 5.15. 2.13. 10.61 4.01 248.62. 44.76. Japan. 5,516. 1.5%.

S7 Table. KEGG pathways - PLOS

1 4.80E-04 1.80E-02. Ribosome. 14 1.4 1.20E-03 3.50E-02. Basal transcription factors. 8 0.8 1.90E-03 4.70E-02. Purine metabolism. 19 1.9 2.60E-03 5.50E-02.

Table S1. Descriptive statistics of students' GPA scores across ... - PLOS

Descriptive statistics of students' GPA scores across the whole period of their studies. All students. Females. Males. < Â¯GHS i >i. 3.85 (0.53). 3.99 (0.53) 3.73 ...

Table Descriptive statistics of SSRs variables

Additional file 7 Matrix of correlation coefficients and 1-tailed tests between SSRs. Mono-. Di-. Tri-. Tetra-. Penta-. Hexa-. Mono-. **. **. **. **. **. Di-. 0.790a. **. **.

Table 2: Descriptive Statistics for UK firms

services. Clustering of FDI into Economic Zones in China provide another sort of effect, namely, network externalities which generate the prospect of knowledge ...

Supplementary Table 1. Descriptive statistics for all

95% CI. P. Cochran's. Q Test P. I2. Cases Controls rs3764650. ABCA$. 19. 1046520. G ...... vom Alzheimer Typ, der Multiinfarkt- (oder vaskulÃ¤ren) Demenz und.

Table 2: Descriptive Statistics for UK firms

He is currently Visiting Professor, Stanford Graduate School of Business. Published ...... computer, and software techno

Table 1 Descriptive Statistics - Semantic Scholar

be known as stochastic frontier analysis, the latter as data envelopment analysis (DEA). The .... Descriptive statistics appear in Table 1. One thing is very clear ...

S7 Table. Descriptive statistics of POOLseq sequence read ... - PLOS

Download PDF

3 downloads 0 Views 52KB Size Report

Comment

S7 Table. Descriptive statistics of POOLseq sequence read data for field-caught mosquitoes from Malawi. Sample name. Untrimmed reads. Trimmed reads.

S7 Table. Descriptive statistics of POOLseq sequence read data for field-caught mosquitoes from Malawi. Sample name

Untrimmed reads

Trimmed reads

R1/R2 pairs 1

MWI-Chikwawa91,499,782 90,976,162 45,240,390 2014 MWI-Chikwawa100,946,514 100,344,549 49,951,213 2002 1 Forward (R1) and reverse (R2) read pairs after trimming. 2 Reads unpaired after trimming (% of total trimmed reads).

R0 reads (%) 2 495,382 (0.54%) 442,123 (0.44%)