S7 Table. The relative expression levels of mRNAs evaluated ... - PLOS

Recommend Documents

S7 Table. Relative expression of JA signalling-related genes ... - PLOS

Table S7. Comparison of the accumulation levels between RC ... - PLOS

RC-ath-miR2112. 37.2 ath-miR2112-3p. 176.84. RC-osa-miR156a. 1906.13 osa-miR156a. 387568.35. RC-osa-miR156c. 1906.13 osa-miR156c. 387568.35.

table s7 - PLOS

APO S581L GLYCYL-TRNA SYNTHETASE MUTAN. LGRI .... HUMAN ARGININOSUCCINATE SYNTHASE IN COMPLEX WITH ASPARTATE AND CITRULLINE.

S7 Table. - PLOS

Table S7 - PLOS

S7 Table. - PLOS

sequences. D-hordeins (6). BAA11642.1. 318 D hordein. H. vulgare ssp. vulgare. 8. BAK04239.1. 318 Predicted protein. H. vulgare ssp. vulgare. 8. AFM77735.1.

Table S7 - PLOS

4.90E-07. 0.000126. ATPases involved in chromosome partitioning. COG0294. 1.42. 21.82. 3.53E-05. 0.008489. Dihydropteroate synthase and related enzymes.

S7 Table. - PLOS

Left Lateral Occipital Cortex inferior division. -61 -95 -17 ... Left Temporal Occipital Fusiform Cortex. -45 -63 -17 ... Right Juxtapositional Lobule Cortex. 3. 1. 47.

S7 Table. - PLOS

S7 Table. Full single-level regression models for post-consumption levels of product endorsement. ... Stepwise regression was conduced twice, using either.

S7 Table - PLOS

KCTD8 Fwd AACCAGTACCGCGACGACAA. IFIT2 Fwd. CCCTGCCGAACAGCTGAGAA. KCTD8 Rev AGCTCATTACAGGAAGTCCCACT IFIT2 Rev.

S7 Table - PLOS

S7 Table. - Plos

Table S7 - PLOS

Genes with increased expression in B. anthracis Sterne (34F2) in CO2 (MGM + 0.8% bicarbonate). *SEQUENCE ID GENE INFO. Fold difference. GBAA0167.

Table S7 - PLOS

signature in Caenorhabditis elegans Dauer larvae and long-lived daf-2 mutants implicates detoxification system in longevity assurance. J Biol Chem 279:.

S7 Table - PLOS

Stout. 57. 48. 12 - 267. 30 (55). 54. Imperial Stout. 86. 79. 14 - 475. 105 (126). 83. Sour ales. 30. 21. 14 - 116. 6 (82). 7. Fruit/Vegetable/Spice. 56. 49. 12 - 127.

S7 Table - PLOS

S7 Table: Relative variable importance for linear mixed ... - PLOS

urban. 0.12. 0.18. 0.15. 0.12. 0.13. MOF. 0.18. 0.18. 0.44. 0.40. 0.16. AIA. 0.76. 0.28. Protein. 0.28. 0.28. 0.28. 0.28. 1.00. 0.28. 0.28. Starch. 0.29. 0.29. 0.29. 0.29.

Relative microRNA levels Relative mRNA levels - PLOS

S7 Table. KEGG pathways - PLOS

1 4.80E-04 1.80E-02. Ribosome. 14 1.4 1.20E-03 3.50E-02. Basal transcription factors. 8 0.8 1.90E-03 4.70E-02. Purine metabolism. 19 1.9 2.60E-03 5.50E-02.

S5 Table. Relative normalized expression levels of host candidate ...

Relative normalized expression levels of host candidate genes for survival (GN trait ... domain containing 3 ... 30.2 SH3-domain GRB2-like endophilin B2.

Table S2. Relative expression of honeybee immune genes in ... - PLOS

Table S2. Relative luciferase mRNA levels and luciferase ... - PLOS

Table S8. Absolute expression levels of genes analyzed by ... - PLOS

3,173. 1,682. Opn. 47,673. 17,290. 67,588. 32,388. CXCL2. 0,056. 0,006. 0,008. 0,004. CXCL9. 0,309. 0,033. 1,464. 0,875. CXCL10. 0,309. 0,033. 0,502. 0,268.

Biochemical Characterization and Relative Expression Levels of ...

Apr 30, 2011 - We measured expression and used biochemical characterization of multiple carbohydrate esterases by the xylanolytic ... nose moieties, may link with other esters, forming various types ..... Conserved hypothetical protein. 12.

S7 Table. The relative expression levels of mRNAs evaluated ... - PLOS

Download PDF

3 downloads 0 Views 99KB Size Report

Comment

LOC_Os02g57280 (Brown planthopper-induced resistance protein 6). 22.545 0.359 20.959. 0.279. 0.002. 0.205. LOC_Os01g53020 (heat shock protein DnaJ).

S7 Table. The relative expression levels of mRNAs evaluated by qPCR assay RI Genes LOC_Os09g19280 (RPM1) LOC_Os02g40190 (EFR) LOC_Os08g34740 (SGT1) LOC_Os02g33180 (RAR1) LOC_Os03g18850 (PR1 ) LOC_Os06g48590 (MPK4) LOC_Os03g55164 (WRKY33) LOC_Os03g49640 (MEKK1) LOC_Os06g05520 (MEK1) LOC_Os09g29840 (HSP90) LOC_Os11g40970 (Probable LRR receptor-like serine/threonine-protein kinase LOC_Os02g40200 (Probable LRR receptor-like serine/threonine-protein kinase ) LOC_Os01g71340 (Glucan endo-1,3-beta-glucosidase) LOC_Os07g35680 (Cysteine-rich receptor-like protein kinase 8 ) LOC_Os02g57280 (Brown planthopper-induced resistance protein 6) LOC_Os01g53020 (heat shock protein DnaJ) LOC_Os04g21820 (Wall-associated receptor kinase 5 ) LOC_Os10g04570 (Putative disease resistance protein RGA4)

CT values 29.619 22.516 23.902 24.142 30.289 28.364 28.132 22.630 28.549 28.376 28.770 30.263 24.098 28.454 22.545 29.770 28.590 23.194

CK Std. Dev. 0.010 0.069 0.076 0.035 0.237 0.124 0.255 0.563 0.236 0.512 0.357 0.079 0.448 0.068 0.359 0.466 0.165 0.560

CT values 26.530 21.014 22.638 22.625 26.541 27.598 26.887 21.007 27.222 27.593 26.518 26.581 22.675 27.220 20.959 26.518 27.531 21.538

Std. Dev. 0.046 0.327 0.563 0.237 0.237 0.524 0.356 0.537 0.369 0.026 0.365 0.537 0.057 0.037 0.279 0.369 0.560 0.579

p-value 0.000 0.002 0.025 0.001 0.000 0.000 0.005 0.000 0.000 0.001 0.003 0.000 0.003 0.001 0.002 0.002 0.009 0.005

Fold change (RI/CK) 0.072 0.230 0.271 0.227 0.048 0.382 0.274 0.211 0.259 0.378 0.137 0.051 0.229 0.261 0.205 0.064 0.295 0.195

50