Seed production temperature regulation of primary dormancy occurs

Download PDF
2 downloads 0 Views 4MB Size Report
Comment
Environmental changes during seed production are important drivers of lot-to-lot variation .... light regime at 22°C in a Sanyo MLR growth cabinet (Panasonic.
Research

Seed production temperature regulation of primary dormancy occurs through control of seed coat phenylpropanoid metabolism Dana R. MacGregor1,2, Sarah L. Kendall3, Hannah Florance1, Fabio Fedi1, Karen Moore1, Konrad Paszkiewicz1, Nicholas Smirnoff1 and Steven Penfield1,2 1

Biosciences, College of Life and Environmental Sciences, University of Exeter, Stocker Road, Exeter, EX4 4QD, UK; 2Department of Crop Genetics, John Innes Centre, Norwich Research

Park, Colney Ln, Norwich, Norfolk NR4, 7UH, UK; 3Department of Biology, University of York, Wentworth Way, York, YO10 5DD, UK

Summary Author for correspondence: Steven Penfield Tel: +44 1603 450862 Email: [email protected] Received: 11 July 2014 Accepted: 22 August 2014

New Phytologist (2015) 205: 642–652 doi: 10.1111/nph.13090

Key words: environmental response, flavonoids, germination, permeability, procyanidins, seed coat, seed dormancy, temperature.

 Environmental changes during seed production are important drivers of lot-to-lot variation

in seed behaviour and enable wild species to time their life history with seasonal cues. Temperature during seed set is the dominant environmental signal determining the depth of primary dormancy, although the mechanisms though which temperature changes impart changes in dormancy state are still only partly understood.  We used molecular, genetic and biochemical techniques to examine the mechanism through which temperature variation affects Arabidopsis thaliana seed dormancy.  Here we show that, in Arabidopsis, low temperatures during seed maturation result in an increase in phenylpropanoid gene expression in seeds and that this correlates with higher concentrations of seed coat procyanidins. Lower maturation temperatures cause differences in coat permeability to tetrazolium, and mutants with increased seed coat permeability and/or low procyanidin concentrations are less able to enter strongly dormant states after exposure to low temperatures during seed maturation.  Our data show that maternal temperature signalling regulates seed coat properties, and this is an important pathway through which the environmental signals control primary dormancy depth.

Introduction The degree of primary dormancy is established during seed maturation and governs the behaviour of the seed after shedding, or even whilst still attached to the mother plant. The initiation of seed dormancy is coordinated in zygotic tissues by a network of transcription factors that also perform overlapping roles in the control of embryonic identity, storage reserve accumulation and the onset of desiccation tolerance, including FUSCA3 (FUS3), LEAFY COTYLEDON 1 (LEC1) and ABSCISIC ACID INSENSTIVE 3 (ABI3; Holdsworth et al., 2008). Numerous genetic studies have shown that changes in hormone concentrations, especially ABA and GAs are also essential for entry into primary dormancy. In addition, there are pathways that operate independently of hormone biosynthesis that are essential for entry into or maintenance of primary dormant states. The most important of these in Arabidopsis is accumulation of the DELAY OF GERMINATION 1 (DOG1) protein (Bentsink et al., 2006). DOG1 acts during maturation where the depth of primary dormancy correlates with the abundance of the DOG1 protein in mature seeds (Nakabayashi et al., 2012). 642 New Phytologist (2015) 205: 642–652 www.newphytologist.com

In addition to developmental pathways in zygotic tissues, the seed coat plays a critical role in the control of dormancy in many species. In such seeds, dormancy is known as coat imposed, and dormancy can be removed or reduced by simple removal of or damage to the seed coat. In various species the seed coat has been shown to restrict germination by regulating permeability to either water (Wyatt, 1977), oxygen (Corbineau & C^ome, 1993) or germination inhibitors that leach from the seed (Edwards, 1968). Arabidopsis thaliana seeds display coat-imposed dormancy, and mutants that have altered seed coat development or pigmentation exhibit reduced dormancy when set under glasshouse conditions (Debeaujon et al., 2000). transparent testa (tt) mutants show reduced accumulation of condensed tannins in the inner integument of seed coats and have a maternally inherited increased germination phenotype, confirming that the alteration in germination is a result of the reduced accumulation in the seed coat (Shirley et al., 1995; Debeaujon et al., 2000, 2003). These results confirm observations in many species that more intense coat pigmentation is associated with decreases in permeability and more dormant states. Diverse environmental signals during seed set elicit profound variation in primary dormancy, with temperature being the most Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

New Phytologist important cue. Across many species, lowering the temperature during seed set causes an increase in seed primary dormancy at seed maturity (Fenner, 1991). Arabidopsis seeds share this behaviour, and a key mechanism proposed has been the lowtemperature promotion of DOG1 transcript accumulation during late seed maturation (Chiang et al., 2011; Kendall et al., 2011). In addition, low temperature has been shown to increase the ABA/GA ratio in seeds, and DOG1, ABA synthesis and normal GA signalling are all necessary for inducing stronger dormancy after low-temperature treatments (Kendall et al., 2011). These low-temperature-induced differences persist in mature Arabidopsis seeds in which seed coat tissues are no longer living, demonstrating that they occur in zygotic tissues. Here we show that low temperatures during seed maturation cause an increase in gene expression of enzymes in flavonoid and procyanidin biosynthetic pathways. The expression changes correlate with an increase in procyanidin accumulation, altered permeability of seeds, and altered primary dormancy. Mutants with high seed coat permeability and/or low procyanidin concentrations cannot enter highly dormant states after maturation at low temperatures. Our data show that, in addition to signalling pathways in zygotic tissues, temperature signalling in maternal tissues also plays an important role in the environmental regulation of seed dormancy.

Research 643

temperatures, and left to set seed until dehiscence began. Seed was then harvested, with poorly filled seeds being excluded from germination trials using a 250 lm sieve (Fisher Scientific UK Ltd, Loughborough, UK). Freshly harvested seeds were sown directly onto water-agar (0.9% Sigma Aldrich, cat. no. A1296) and coldstratified at 4°C in the dark using a Sanyo MIR-154 incubator (Panasonic UK, Bracknell, UK) for the desired length and/or put directly into a 12 : 12 h white light (80–100 lmol m 2 s 1) : dark light regime at 22°C in a Sanyo MLR growth cabinet (Panasonic UK) for germination. Germination was scored as the emergence of the radicle through the seed coat using a Leica MZ6 stereomicroscope (Leica, Milton Keynes, UK). A minimum of 20 seeds from five individual seed batches, each from independent plants, were used. Germination frequency (%) was calculated as the percentage of seeds germinating in each individual seed batch. For Fig. 3(e), seeds were stratified for 1 wk at 4°C on MS agar (cat. no. M0221; Melford Laboratories) and 0.9% agar (Sigma Aldrich, cat. no. A1296) with no sucrose added to the media source based on MacGregor et al. (2008). MS media with supplemented GA and norflurazon (NOR) were at 100 lM GA4 (Sigma Aldrich, cat. no. G7276) or 50 lM NOR (cat. no. PS1044; Greyhound Chromatography and Allied Chemicals, Birkenhead, UK) dissolved in 100% methanol. Transcriptomics and quantitative PCR (qPCR)

Materials and Methods Plant material and growth conditions Arabidopsis thaliana (L.) Heynh ecotypes Columbia (Col-0), Landsberg erecta (Ler), C24, Wassilewskija (Ws) and Enkheim (En-2) were used in this study. ap2-1 (NASC ID: N29 Jofuku et al., 1994), tt4-1 (N85; Shirley et al., 1995), tt5-1 (N86; Shirley et al., 1995), tt6-1 (N87; Shirley et al., 1995), tt7-1 (N88; Shirley et al., 1995), fls1-3 (N799657; Kuhn et al., 2011), tt3-1 (N84; Koornneef, 1981), tt18-5 (N799663; Kuhn et al., 2011), f36 (N323; Devic et al., 1999), tt10-1 (N110; Koornneef, 1981), tt8-3 (N891; Nesi et al., 2000), and tt2-1 (N83; Koornneef, 1981) mutants have been described elsewhere and were obtained from the Nottingham Arabidopsis Stock Centre located at the School of Biosciences, University of Nottingham, Loughborough, UK. tt15-3 corresponds to SALK_021175C (N661762) and has not been previously characterised. ban-1 was a kind gift from Isabelle Debeaujon (Albert et al., 1997). tt19-2 and ban-4 were a kind gift from Satoshi Kitamura (Kitamura et al., 2010). Seeds surface-sterilized in 5% bleach in ethanol were stratified at 4°C for 2–4 d on MS agar plates (4.4 g l 1 Murashige and Skoog (MS) basal salt mixture, cat. no. M0221; Melford Laboratories Ltd, Ipswich, UK). Seedlings were grown at 22°C for 10–14 d with 12 : 12 h light : dark cycles before being transplanted to soil (John Innes Seed Compost; St Bridget’s Nurseries & Garden Centres, Exeter, UK) in P40s. Plants were grown until flowering at 22°C under standard long days using fluorescent white light at 80–100 lmol m 2 s 1 until anthesis of the first flowers. Once flowering, plants were transferred to growth cabinets running the same conditions, but with the indicated seed maturation Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

Microarray data were reported previously (Kendall et al., 2011) and are available at NASC (NASCARRAYS-594) and Gene Expression Omnibus with series number GSE28747. Data were downloaded and averaged, and the standard error was calculated for the selected genes. For RNA sequencing, Col green cotyledon seeds matured at 20 and 15°C were dissected from siliques between 5 and 7 h after dawn and frozen in liquid nitrogen. RNA was extracted as previously described (Penfield et al., 2005). Preliminary analyses of the data were performed using the Tophat and Cufflinks based on the protocol published by Trapnell et al. (2012). The TAIR10 reference sequence was used. The Cufflinks package was used to quantify gene and isoform abundance using the -G flag. The cuffcompare and cuffdiff components of Cufflinks were used to quantify gene and isoform differential expression (Trapnell et al., 2012). Further analysis was performed using the cummeRbund package (Trapnell et al., 2012). These data have been deposited in the National Center for Biotechnical Information’s (NCBI) Gene Expression Omnibus (Edgar et al., 2002; Barrett et al., 2013) and are accessible through GEO series accession number GSE61061 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc= GSE61061). The expression of genes of interest was confirmed using quantitative reverse transcription polymerase chain reaction (qRT-PCR). Quantitative reverse transcription PCR was performed on RNA extracted as described for the RNA sequencing experiment using Col green cotyledon seeds matured at 22, 18 or 16°C harvested in biological triplicate at 5 h after dawn. One microgram of RNA was converted into cDNA using with Invitrogen’s SuperScript® II Reverse Transcriptase (cat. no. New Phytologist (2015) 205: 642–652 www.newphytologist.com

New Phytologist

644 Research

18064-014) and Oligo(dT) 12–18 Primer (cat. no. 18418012). qPCR was performed on the resulting cDNA using Agilent Technologies’ Brilliant III Ultra-Fast SYBRâ Green qPCR Master Mix (cat. no. 600883; Agilent Technologies LDA UK Ltd, Life Sciences & Chemical Analysis Group, Stockport, UK) and ROX reference dye on a Stratagene Mx3000P Real-Time PCR System (Agilent) with the recommended settings for SYBR Green (with dissociation curve). Data were analysed with MxPro – Mx3005P v4.10 software (Agilent). The transcript abundances were normalized to UBQ10 (At4g05320) and CACS (At5g46630). Accession numbers and primer sequences Sequence data from this article can be found in the Arabidopsis Genome Initiative or GenBank/EMBL databases using the accession numbers outlined in the following. Primer sequences used were as follows: TT4 (AT5G13930) with qTT4-F TCGCCGA GAACAATCGTGGA and qTT4-R CGGCGGCGCCATCAC TGAAA (Catala et al., 2007); TT5 (AT3G55120) with qPCR_ TT5_F GGAGGCGGTTCTGGAATCTATC and qPCR_ TT5_R TCGTCCTTGTTCTTCATCATTAGC (Grunewald et al., 2007); TT7 (AT5G07990) with qPCR_TT7_F TAGCCGACCACCAAACTC and qPCR_TT7_R AGCGTTCCA ACCTCTTCC (this study); F3H (AT3G51240) with qPCR_ TT6_F TCGTCTCTAGTCACCTCCAG and qPCR_TT6_R TCACTTTCACCCAACCTTCC (this study); TT8 (AT4G0 9820) with qTT8-F TGAATCAACCCATACGTTAGACA and qTT8-R GGGGTGTGACATGAGAAGTGT (Qi et al., 2011); DFR (AT5G42800) with qDFR-F TGGTGGTCGG TCCATTCAT and qDFR-R GAGAGAGCGCGGTGATAA GG (Qi et al., 2011); LDOX (AT4G22880) with qLDOX-F TCCGGGTTTGCAGCTTTTC and qLDOX-R ATCAGGAA CACATTTTGCAGTGA (Qi et al., 2011); BAN (AT1G6 1720) with qBAN-F ACATTTGCTGTGCTTACAACACAAGT and qBAN-R CGAAAGCCTTCATTGATAAGTTTTTGCG (Baudry et al., 2004); TT10 (AT5G48100) with tt10_F CAAT GCATTGGCATGGTGTAGAG and tt10_R CTCACATCCC TCTTCCACCAC (Liang et al., 2010); UBQ10 (AT4G05320) with UBQ10_F CACACTCCACTTGGTCTTGCGT and UB Q10_R TGGTCTTTCCGGTGAGAGAGTC (Gould et al., 2013); and CACS (AT5G46630) with CACS_F ACTCAGGAA GGTGTACGGTCA and CACS_R TGCATTTGGAACAGG TTTGT (Nelson et al., 2009). Measurement of seed coat permeability by tetrazolium uptake The tetrazolium staining protocol was based on Debeaujon et al. (2000). In short, freshly harvested seeds were incubated in water or a 1% (w/v) aqueous solution of 2,3,5-triphenyltetrazolium chloride (Sigma Aldrich, cat. no. T8877-5G) in 96-well plates in the dark at 30°C. At 24, 48 and 72 h after the start of incubation, aliquots of seed were transferred to acetate paper, the liquid was removed from them and the seeds were scanned at 12 000 pixel resolution. New Phytologist (2015) 205: 642–652 www.newphytologist.com

For Fig. 2, the 1% aqueous solution of tetrazolium was spiked with 20 lM paclobutrazol (PAC, Sigma Aldrich, cat. no. 46046) 100 lM GA4 (Sigma Aldrich, cat. no. G7276) or 3 or 30 lM ABA (Sigma Aldrich, cat. no. A1049) dissolved in 100% methanol. Analysis of seed coat flavonoids Soluble proanthocyanidins (PAs) were extracted from freshly harvested, flash-frozen seedlings on a protocol adapted from Routaboul et al. (2012) with the following changes. The extraction solvent used was methanol/acetone/water/acetic acid (30/42/28/ 0.05, v/v/v/v). The first extraction was spiked with 3.6 lg of umbelliferone as an internal standard. The two extracts were pooled and dried to completion using a Scanvac centrifuge (LaboGene ApS Industrivej, Lynge, Denmark) for vacuum concentrator and a Scanvac Cool Safe condenser. The dried soluble extract and the insoluble PAs remaining in the pellet were kept at 20°C until required. The soluble PAs were redissolved in 300 ll of the extraction buffer, 200 ll of which was sent for high-pressure liquid chromatography electrospray ionization triple quadrupole MS/MS (LC-ESI-QQQ-MS/MS) analysis as described previously (Page et al., 2012). Of the remaining 100 ll, 10 ll was used for colourimetic acid butanol analysis according to Porter et al. (1985) using 600 ll of butanol–HCl reagent (butanol-concentrated HCl, 95 : 5, v/v) and 20 ll of the ferric reagent (2% ferric ammonium sulphate in 2N HCl). Soluble anthocyanins were then measured at 550 nm after heating the samples to > 95°C for 60 min.

Results Previously we produced transcriptomic data from mature Arabidopsis (Landsberg erecta) seeds set at either 10 or 20°C in order to understand mechanisms through which temperature variation during seed maturation affects germination physiology (Kendall et al., 2011). Further analysis of this dataset revealed that in addition to the effects previously revealed, we found that the transcripts of many flavonoid biosynthetic pathway genes were up-regulated in response to low temperature, including the regulatory MYB and basic helix–loop–helix (bHLH) transcription factors TT2 and TT8 (Nesi et al., 2000, 2001; Fig. 1a). In order to examine whether these changes were also observed in seeds developing at two temperatures that caused large changes in dormancy, we performed RNA sequencing using green cotyledon stage seeds set at either 15 or 20°C (Columbia; see the Materials and Methods section). This analysis confirmed that transcript abundances of multiple enzymes of the flavonoid pathway were elevated in response to low temperature in developing seeds, again including the regulatory transcription factors, and the procyanidin-synthesising enzyme BANYULS (BAN; Devic et al., 1999; Fig. 1b). The gene expression changes for many of these flavonoid biosynthesis genes were then confirmed by qPCR in whole developing Col-0 seeds set at 22 or 16°C; these results confirmed the increase in gene expression of TT8, DFR, LDOX, BAN and TT10 at 16°C compared with 22°C (Fig. 1c). Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

New Phytologist

Research 645

8 6 4 2 0

Ler T=10°C

(b)

Ler T=20°C

8 6 4 2 0

TT4 TT5 TT7 F3H TT8 TTG1 TT2 TTG2 DFR FLS LDOX BAN TT19 TT15 TT10

RNA Seq. (FPKM)

TT7 F3H TT8 TTG1 TT2 TTG2 DFR FLS LDOX BAN TT16 TT19 TT10

75 60 45 30 15 0

TT4 TT5

Microarray Value

(a)

Col T=15°C

Col T=20°C

6

Col T=16°C

* *

* *

* *

* *

* *

DFR

LDOX

BAN

TT10

* *

TT8

*

F3H

0

*

TT7

2

TT5

4

TT4

Normalized Expression

(c)

Col T=22°C

Fig. 1 Lowering seed maturation temperature increases flavonoid pathway gene expression in Arabidopsis wildtype seeds. (a) Microarray data from Kendall et al. (2011) comparing dry Landsberg erecta (Ler) seeds matured at 10 or 20°C for genes involved in flavonoid biosynthesis. Data are averages of three biological replicates  SE normalized to the 20°C data. (b) RNA sequencing data comparing Columbia (Col-0) seeds at the green cotyledon stage matured at 15 or 20°C for genes involved in flavonoid biosynthesis. Data are averages of three biological replicates  SE normalized to the 20°C data. Data are deposited in the National Center for Biotechnical Information’s (NCBI) Gene Expression Omnibus (Edgar et al., 2002; Barrett et al., 2013) and are accessible through GEO Series accession number GSE61061 (http://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSE61061). (c) Quantitative reverse transcription polymerase chain reaction (qRT-PCR) comparing Col-0 seeds at green cotyledon stage matured at 16 or 22°C for genes involved in flavonoid biosynthesis. Data are averages of three biological replicates  SE normalized to the 20°C data. Significant differences by a Student’s t-test: *, P < 0.05; **, P < 0.01.

Therefore low temperature increases expression of genes involved in flavonoid biosynthesis in seed tissues. This observation is in accordance with previous observations in Arabidopsis vegetative tissues (Leyva et al., 1995), and this gene expression change is sensitive to as little as a 5°C decrease in environmental temperature during seed set. Seed coat pigmentation is determined by flavonoid concentrations and both have previously been correlated with permeability to tetrazolium dye (Debeaujon et al., 2000). Therefore we investigated the potential to use tetrazolium uptake as a method for Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

analysing seed coat permeability differences in Arabidopsis seeds set at different temperatures. Although previous reports demonstrate an insignificant amount of uptake in wildtype seeds (Debeaujon et al., 2000; Beisson et al., 2007; Vishwanath et al., 2013) we found that tetrazolium uptake and reduction were observable in intact, mature, wildtype Arabidopsis seeds (Fig. 2a). The appearance of red formazan products increased in seeds incubated in the dark at 30°C (germination inhibiting conditions) for up to 72 h (Fig. 2). The tetrazolium uptake rate is clearly independent of any germination-associated changes to seed coat integrity, because the addition of the GA-biosynthesis inhibitor PAC or high concentrations of ABA had no effect on uptake and conversion of tetrazolium (Fig. 2a–c), although ABA is known to inhibit germination rates at a lower concentration (Finkelstein & Lynch, 2000). Tetrazolium staining in wildtype seeds first began to appear close to the micropyle, suggesting that the dye enters the seed through the micropylar pore (Fig. 2b). This pattern was observed even in the presence of PAC and therefore was not related to testa rupture. Staining rates were also stable during and after at least 4 months of dry storage (Fig. 2d), demonstrating that not only are tetrazolium uptake rates stable over time, but that rates are reproducible in the same genotype over multiple individual determinations carried out at different times, and are not affected by short periods of dry storage. We used tetrazolium uptake rates to compare the permeability of seeds of four Arabidopsis accessions matured at 16 or 22°C (Fig. 3). As described previously (Penfield & Springthorpe, 2012), lowering the temperature during maturation resulted in increases in primary dormancy in all four accessions, as evidenced by lower germination at harvest and reduced germination responses to short periods of cold stratification (Fig. 3a). Lowering the temperature during seed set caused a reduction in tetrazolium uptake in all four accessions (Fig. 3b). There was also a higher overall amount of formazan production in Col and Ler compared with C24 or Ws, which may be related to the lower dormancy of these accessions. Further analysis shows that seed maturation temperature affected the frequency and intensity of staining in embryo tissues (Fig. 3c,d). Changes in staining could result from reduced entry of tetrazolium, or from reduced reduction of tetrazolium inside plants cells: the latter could theoretically result from changes in viability or metabolism brought about by variation in the seed production temperature. Therefore we conducted two key control experiments to discriminate between these possibilities. First, we found that staining differences were not caused by reductions in viability, because all seed lots germinated at high frequency when placed on MS plates supplemented with GA and an ABA biosynthesis inhibitor (Fig. 3e; Kendall et al., 2011). Secondly, the differences in staining are not the result of differential abilities of the embryos to reduce tetrazolium, as when the embryos are dissected out of the seed coat before incubation with tetrazolium, seed maturation temperature no longer has an effect on the extent of staining (Fig. 3f). Therefore we concluded that temperature during seed maturation can affect seed coat permeability to tetrazolium in Arabidopsis. Because temperature during seed production affected tannin biosynthetic gene expression and because tannins are known to New Phytologist (2015) 205: 642–652 www.newphytologist.com

New Phytologist

646 Research

(a)

(c)

(d)

(b)

Fig. 2 Wildtype Arabidopsis seeds take up and reduce tetrazolium dye, preferentially at the micropyle end, and this is independent of germination or time of dry storage. (a) Images of representative freshly harvested wildtype seed batches matured at 22°C and incubated in water, tetrazolium (TZ + MeOH), or TZ with 20 lM paclobutrazol (TZ + PAC), for 24, 48, or 72 h at 30°C in darkness. (b) Higher magnification of Columbia (Col) seeds set at T = 22°C incubated in TZ for 48 h (48 h TZ + MeOH from Fig. 2a). (c) Images of representative freshly harvested Col and Landsberg erecta (Ler) wildtype seed batches matured at 22°C and incubated in TZ (TZ + MeOH), TZ with 3 lM ABA (TZ + 3 ABA), or TZ with 30 lM ABA (TZ + 30 ABA) for 48 h. (d) A population of Ler seeds matured under glasshouse conditions were repeatedly incubated in TZ for 48 h. Images are representative of at least three biological replicate seed batches.

regulate seed permeability, we hypothesized that temperature caused a change in flavonoid content of seeds during seed maturation. To investigate whether the changes in gene expression and altered permeability are underpinned by a change in flavonoid content, we used two quantifying assays: a colourimetric assay based on the hydrolysis of PAs to anthocyanidins for soluble and insoluble PAs, and high-pressure LC electrospray ionization triple quad MS/MS (LC-ESI-QQQ-MS/MS) to profile the soluble flavonoid content of our wildtype seeds (Porter et al., 1985; Page et al., 2012). Col, Ler, C24 and WS whole mature seeds set at 16 and 22°C were analysed for flavonoid compounds (Fig. 4). tt4-1 seeds matured at 16°C were used as a negative control. The colourimetric assay demonstrated that all accessions exhibited a significantly decreased soluble-PA content with increased temperature, but no differences were observed between maturation temperatures when insoluble PAs were profiled (Fig. 4a). For the LC-ESI-QQQ-MS/MS profiles, the results differed in subtle ways between each accession, but clear accession-independent effects were also uncovered (Fig. 4b). In Col, decreasing the maturation temperature correlated with a large decrease in cyanidins and a marked increase in procyanidins. The other three standard accessions all showed large increases in procyanidin content at the lower temperature, the monomers that polymerize to form condensed tannin. As procyanidins are only synthesized in seed coat tissues of seeds, and because seed maturation temperature specifically alters procyanidin content in mature seeds across all accessions, seed maturation temperature must affect seed coat procyanidin synthesis, probably through transcript abundance regulation of the enzymes required for tannin synthesis (Fig. 1). It has previously been shown that tt mutants demonstrate reduced dormancy when set under standard conditions, but that other mutants with high permeability but normal pigmentation, such as apetala2-1 (ap2-1), show only slightly altered New Phytologist (2015) 205: 642–652 www.newphytologist.com

germination behaviour (Debeaujon et al., 2000). In order to determine whether low coat permeability was necessary for the strong primary dormancy associated with seeds set at low temperatures, we set highly permeable ap2-1 and tt seeds at 16 and 22°C (Fig. 5a). After maturation at low temperature, ap2-1 seeds showed a clear reduced dormancy phenotype compared with the wildtype, indicating that AP2 is required in order to enter into low-temperature-induced, strongly dormant states. At 16°C this phenotype was only revealed during cold stratification treatments, demonstrating that other processes also act together with the seed coat to induce strong dormancy states. By contrast, tt4-1 mutants showed reduced dormancy when set at 22°C and largely wildtype behaviour when set at 16°C. We could confirm that tt4-1 mutants, in common with ap2-1 mutants, retain high permeability to tetrazolium when set at 16°C, showing that lack of permeability does not underlie the wildtype germination of tt4-1 mutants in this assay (Fig. 5b). Because this phenotype was surprising, and because various flavonols have been previously suggested to have developmental roles in Arabidopsis (Debeaujon et al., 2000; Albert et al., 1997; Kleindt et al., 2010), we set multiple tt mutants together with their corresponding wildtypes at 16°C, with mutants specifically affected in PA synthesis or utilization, and the fls1-3 mutant which shows a severe reduction in flavonol concentrations, but normal PA synthesis (Kuhn et al., 2011; Fig. 6). Mutants in early steps in the flavonoid pathway (tt4tt7) in general showed very low dormancy, with the exception of tt4-1 which had only a very weak dormancy reduction (Figs 5, 6). The flavonol-deficient fls1-3 mutant showed wildtype degrees of dormancy, indicating that flavonols are not necessary for dormancy control. By contrast, three alleles of BANYULS/ANTHOCYANIDIN REDUCTASE all showed low dormancy, demonstrating that PAs are required for seed Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

New Phytologist

Research 647 (a)

(b)

(c)

(d)

(e)

(f)

Fig. 3 Lowering the seed maturation temperature decreases seed coat permeability as measured by tetrazolium (TZ) uptake in Arabidopsis. (a) The germination frequency for seeds of the indicated wildtypes matured at 16 or 22°C before stratification at 4°C. Data are averages of at least four biological replicate seed batches  SE. Significant differences by Student’s t-test on arcsine-transformed germination data: *, P < 0.05; **, P < 0.01. (b) Images of representative, freshly harvested wildtype seed batches matured at 16 or 22°C and incubated in TZ for the indicated time periods. (c) Images of Landsberg erecta (Ler) seed batches matured at 16 or 22°C and ripened afterwards at room temperature for 3 and 4 months, respectively, that were incubated in water or 1% TZ in water for 48 h. (d) Embryos from the seeds in (c) that were dissected out of the seed coat. (e) The germination frequency for seeds of the indicated wildtypes matured at 16 or 22°C sown on MS (dark grey bars) or MS supplemented with GA and norflurazon (NOR) (light grey bars) after 1 wk of cold stratification at 4°C. Data are averages of four or more biological replicates  SE and show that after dormancy-breaking treatments all seed lots show high viability. (f) Embryos from Ler matured at 16 or 22°C that were dissected out of the seed coat before incubation in TZ for 24 h. Differences in uptake observed between seeds matured at different temperatures are only observable in the presence of the seed coat, showing that the ability to reduce tetrazolium does not vary between the lots. Ws, Wassilewskija. Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

New Phytologist (2015) 205: 642–652 www.newphytologist.com

648 Research

New Phytologist

(a)

(b)

Fig. 4 Seed maturation temperature effects on flavonoid accumulation in mature Arabidopsis seeds. (a) Quantification of soluble and insoluble proanthocyanidin (PA) content in seeds assessed by acid butanol analysis. Blue bars, T = 16°C; red bars, T = 22°C. Data are averages of four or more biological replicates  SE. Significant differences by Student’s t-test to T = 16°C: *, P < 0.05; **, P < 0.01. (b) Flavonoids measured using LC electrospray ionization triple quad MS/MS analysis. Data from the various species of each type of flavonoid have been summed and normalized to an internal standard and the mg of seeds used. Presented are means  SE of four or more biological replicate seed batches. ND, not done. Significant differences by Student’s t-test: *, P < 0.05; **, P < 0.01. Col, Columbia; Ler, Landsberg erecta; Ws, Wassilewskija; En-2, Enkheim.

dormancy and contradicting an earlier report that an allele of BAN resulted in low germination (Albert et al., 1997). However, both leucanthocyanidin dioxygenase (ldox/tt18) and dihydroflavonol reductase (dfr/tt3-1) mutants showed only weak reduced dormancy phenotypes, demonstrating that some mutants with low PA concentrations can enter strongly dormant states (see the Discussion section).

Discussion In this work, we link environmental temperature during seed set to changes in seed coat permeability to tetrazolium dye and dormancy, and show that the mechanism operates, at least in part, through temperature-dependent changes in phenylpropanoid gene expression and procyanidin content of seed coats. Arabidopsis mutants known to have both high testa permeability and maternal-acting seed germination phenotypes in general show reduced dormancy when set at low temperature compared with the wildtype (Fig. 5), revealing that maternal temperature signalling during seed set is important for primary dormancy control, as well as pathways in the zygote itself. Under field conditions, Arabidopsis seeds are commonly set New Phytologist (2015) 205: 642–652 www.newphytologist.com

during spring when mean environmental temperatures are similar to our low-temperature laboratory treatments, so our findings are likely to be generally relevant to plants growing in field conditions. In addition to Arabidopsis, many other species exhibit a correlation between decreased temperature during seed set and increased primary dormancy at seed maturity (Fenner, 1991). Coat colour has been linked to germination potential across multiple angiosperms, as have other seed coat properties such as myxospermy (Toorop et al., 2012) and coat thickness (Pourrat & Jacques, 1975). Therefore, it is likely that our observations extend beyond Arabidopsis and that these processes will be important for the life history of wild plants, as well as for the germination of crop seed produced commercially for sale. Although it was previously reported that wildtype seeds were relatively impermeable to tetrazolium dye (Debeaujon et al., 2000; Papi et al., 2002; : Beisson et al., 2007; Vishwanath et al., 2013), we have shown observable staining of four different accessions of wildtype seeds and a correlation between the temperature at which the seeds are set and their staining intensity. Even seeds that are relatively impermeable at the higher temperatures, such as Ws, take up and reduce tetrazolium after prolonged Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

New Phytologist

Research 649

(a)

(b)

Fig. 5 Arabidopsis mutants with high permeability have low dormancy. (a) The germination frequency for seeds of Landsberg erecta (Ler, blue diamonds), tt4-1 (red squares) and ap2-1 (green triangles) mutants at 16 or 22°C. Data are averages of four or more biological replicates  SE. Significant differences by Student’s t-test on arcsine-transformed germination data: *, P < 0.05; **, P < 0.01. (b) Images of representative freshly harvested wildtype, tt4-1 and ap2-1 seeds matured at 16 or 22°C and incubated in tetrazolium (TZ) for the time indicated (in h).

incubations, tetrazolium forming the red formazan pigment (Fig. 2). The production of the red formazans was not the result of testa rupture, because uptake took place under conditions that inhibited progression to germination and was similar in the presence of germination inhibitors that inhibit testa rupture (Fig. 2). The relative amount of formazan production correlated with temperature during seed set and with dormancy, suggesting that it captures relevant properties of the seed coat that contribute to the regulation of germination vigour. Our control experiments clearly rule out the possibility that differences in staining are the result of temperature effects on viability or on the ability of the seeds to reduce tetrazolium salts (Fig. 3). In Arabidopsis, coat permeability is compromised in developmental mutants such as aberrant testa shape (ats) and ap2 (Debeaujon et al., 2000), as well as in mutants unable to synthesize secondary metabolites that form the barriers to penetration, such as tt mutants and mutants deficient in wax ester biosynthesis in seeds (Beisson et al., 2007). In our experiments, the majority of the mutants that we tested that alter procyanidin concentrations had a low dormancy phenotype at the low maturation temperature (Fig. 6); this is in agreement with previous work demonstrating that a subset of these mutants also had altered dormancy at warmer temperatures (Debeaujon et al., 2000). However, we also found that some tt mutants (tt4, tt3 and tt18) showed only very weak reduced dormancy when matured at 16°C, although phenotypes are apparent after warmer seed maturation temperatures (Figs 5, 6, Supporting Information Fig. S1). Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

The tt4-1 mutants remain highly permeable to tetrazolium despite wildtype degrees of dormancy when set at 16°C. Given that neither the tt4 nor the tt5 mutant is capable of tannin synthesis, this appears to argue against a role for tannins alone in the control of dormancy. Our profiling analysis demonstrated that only procyanidins, the precursors of tannins, were reliably increased in seeds by low maturation temperatures in all accessions tested (Fig. 4), suggesting that increases in these compounds are specifically associated with more dormant states. This conclusion is further supported by the fact that multiple ban mutants show low dormancy when set at 16°C (Fig. 6). This result was surprising, given that Albert et al. (1997) showed that a single ban allele had decreased germination, but is consistent with results in multiple species that show that tannin accumulation is negatively related to germination. Other mutants specifically defective in PA movement of the vacuole also show clear dormancy phenotypes when set at 16°C, including tt15 and tt19 (Fig. 6). Together these results show unequivocally that PAs are necessary for dormancy induction by cool temperatures during seed maturation. The fact that some tt mutants, including some with no evidence of PA accumulation such as tt4 (Fig. 4), show only very weak phenotypes is surprising. Some flavonols have been proposed to have developmental or signalling roles in plants, but we can rule out flavonols as causes of dormancy phenotypes because the flavonol-deficient line fls3-1 (Kuhn et al., 2011) showed wildtype germination behaviour (Fig. 6). One possible New Phytologist (2015) 205: 642–652 www.newphytologist.com

New Phytologist

650 Research

(a)

(b)

(c)

Fig. 6 Mutations in the flavonoid biosynthesis pathway that alter procyanidin concentrations have low dormancy. (a) Flavonoid biosynthesis pathway (after Routaboul et al., 2012). (b) The germination frequency for Arabidopsis seeds of the indicated wildtypes and mutants matured at 16°C before stratification at 4°C for the indicated times. Data are averages of at least four biological replicate seed batches  SE. Significant differences by Student’s t-test on arcsine-transformed germination data: *, P < 0.05; **, P < 0.01. (c) Close-ups of seeds in (b). The scale is equivalent across images and each bar represents 3 mm. Col, Columbia; Ler, Landsberg erecta; Ws, Wassilewskija; En-2, Enkheim.

New Phytologist (2015) 205: 642–652 www.newphytologist.com

Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

New Phytologist explanation is that, in tt4 mutants, carbon entry into the flavonoid pathways is completely blocked, and that carbon may be rerouted towards the synthesis of other phenolic compounds which can substitute for procyanidins in germination inhibition. Another is that accumulating intermediates in tt mutants can substitute for PAs, either by being themselves polymerized into colourless multimers or by substituting for PAs in interactions with other molecules. Another feature of our dataset is that tt10 mutants, defective in PA polymerization (Pourcel et al., 2005), also show no germination phenotype. This again suggests that high degrees of polymerization are not required for PAs to exert an effect on dormancy. Differences in germination vigour, for instance between tt4-1 and tt5-1 mutants, is not reflected in differences in permeability to tetrazolium (Fig. 5); this contrasts with the wild-type situation, where these two phenotypes are strongly correlated (Fig. 3). In wildtype seeds, tetrazolium appears to enter through the micropylar pore resulting in staining of the embryo (Fig. 2). In transparent testa seeds the route of entry may differ; this highlights the need for the development of new methods in which chemical ingress into seeds can be monitored. Seed coat permeability is important for dormancy in many species, restricting water and oxygen uptake. In Arabidopsis it has been hypothesized that the seed coat is also a barrier to the uptake of salts (Gou et al., 2009), but in terms of dormancy control it has been shown that during imbibition the seed coat is dispensable (Bethke et al., 2007). This raises the possibility that the seed coat does not act during imbibition to promote dormancy. Arabidopsis seeds are permeable to water and to plant hormones with large molecule sizes such as GAs and brassinosteroids, but are unable to take up x-gluc, the substrate of the b-glucuronidase (GUS) reporter gene, or luciferin (Penfield et al., 2004). However, a rational basis for predicting the ability of a given compound to enter a seed is lacking. So far in Arabidopsis or crop species, it remains unclear as to what, if any, compounds must enter or leave the seed to produce more or less dormant states. Instead, we find that when set at 16°C, the tt4-1 and tt5-1 mutants have similar permeability but different dormancy states (Fig. 5). This shows that coat permeability at harvest, although correlating with dormancy, is not the only cause of different dormancy states in Arabidopsis. The temperature regulation of phenylpropanoid metabolism in seeds parallels that observed previously in seedlings and leaves (Leyva et al., 1995). In seedlings, cold can up-regulate anthocyanin biosynthesis via a complex web of transcription factors shared with the red light signal transduction pathway, a process that is also influenced by GA content (Catala et al., 2011; Zhang et al., 2011). Further work will be necessary to unravel maternal environmental signalling pathways active during seed maturation to control dormancy.

Acknowledgements This work was funded by a BBSRC studentship to S.L.K. and by BBSRC research grant number BB/L003198/1 to D.R.M. and S.D.P. We thank Isabelle Debeaujon and Satoshi Kitamura for their kind gifts of seeds. We thank Min Chen and Isabelle Camu Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust

Research 651

for useful discussions, and Christine Sambles for help with processing the RNA sequencing.

References Albert S, Delseny M, Devic M. 1997. BANYULS, a novel negative regulator of flavonoid biosynthesis in the Arabidopsis seed coat. Plant Journal 11: 289–299. Barrett T, Wilhite SE, Ledoux P, Evangelista C, Kim IF, Tomashevsky M, Marshall KA, Phillippy KH, Sherman PM, Holko M. 2013. NCBI GEO: archive for functional genomics data sets-update. Nucleic Acids Research 41 (Database issue): D991–D995. Baudry A, Heim MA, Dubreucq B, Caboche M, Weisshaar B, Lepiniec L. 2004. TT2, TT8, and TTG1 synergistically specify the expression of BANYULS and proanthocyanidin biosynthesis in Arabidopsis thaliana. Plant Journal 39: 366–380. Beisson F, Li Y, Bonaventure G, Pollard M, Ohlrogge JB. 2007. The acyltransferase GPAT5 is required for the synthesis of suberin in seed coat and root of Arabidopsis. Plant Cell 19: 351–368. Bentsink L, Jowett J, Hanhart CJ, Koornneef M. 2006. Cloning of DOG1, a quantitative trait locus controlling seed dormancy in Arabidopsis. Proceedings of the National Academy of Sciences, USA 103: 17042–17047. Bethke PC, Libourel IG, Aoyama N, Chung YY, Still DW, Jones RL. 2007. The Arabidopsis aleurone layer responds to nitric oxide, gibberellin, and abscisic acid and is sufficient and necessary for seed dormancy. Plant Physiology 143: 1173–1188. Catala R, Medina J, Salinas J. 2011. Integration of low temperature and light signaling during cold acclimation response in Arabidopsis. Proceedings of the National Academy of Sciences, USA 108: 16475–16480. Chiang GC, Bartsch M, Barua D, Nakabayashi K, Debieu M, Kronholm I, Koornneef M, Soppe WJ, Donohue K, De Meaux J. 2011. DOG1 expression is predicted by the seed-maturation environment and contributes to geographical variation in germination in Arabidopsis thaliana. Molecular Ecology 20: 3336–3349. Corbineau F, C^ome D. 1993. The concept of dormancy in cereal seeds. Proceedings of the 4th International Workshop on seeds, basic and applied aspects of seed biology. Angers, France, July 20–24, 29. Debeaujon I, Leon-Kloosterziel KM, Koornneef M. 2000. Influence of the testa on seed dormancy, germination, and longevity in Arabidopsis. Plant Physiology 122: 403–414. Debeaujon I, Nesi N, Perez P, Devic M, Grandjean O, Caboche M, Lepiniec L. 2003. Proanthocyanidin-accumulating cells in Arabidopsis testa: regulation of differentiation and role in seed development. Plant Cell 15: 2514–2531. Devic M, Guilleminot J, Debeaujon I, Bechtold N, Bensaude E, Koornneef M, Pelletier G, Delseny M. 1999. The BANYULS gene encodes a DFR-like protein and is a marker of early seed coat development. Plant Journal 19: 387–398. Edgar R, Domrachev M, Lash AE. 2002. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Research 30: 207–210. Edwards MM. 1968. Dormancy in seeds of Charlock: III. Occurrence and mode of action of an inhibitor associated with dormancy. Journal of Experimental Botany 19: 601–610. Fenner M. 1991. The effects of parental environment on seed germinability. Seed Science Research 1: 75–81. Finkelstein RR, Lynch TJ. 2000. Abscisic acid inhibition of radicle emergence but not seedling growth is suppressed by sugars. Plant Physiology 122: 1179– 1186. Gou JY, Yu XH, Liu CJ. 2009. A hydroxycinnamoyltransferase responsible for synthesizing suberin aromatics in Arabidopsis. Proceedings of the National Academy of Sciences, USA 106: 18855–18860. Gould PD, Ugarte N, Domijan M, Costa M, Foreman J, MacGregor D, Rose K, Griffiths J, Millar AJ, Finkenst€adt B et al. 2013. Network balance via CRY signalling controls the Arabidopsis circadian clock over ambient temperatures. Molecular Systems Biology 9: 650. New Phytologist (2015) 205: 642–652 www.newphytologist.com

New Phytologist

652 Research Grunewald W, De Smet I, Lewis DR, L€ofke C, Jansen L, Goeminne G, Bossche RV, Karimi M, De Rybel B, Vanholme B et al. 2012. Transcription factor WRKY23 assists auxin distribution patterns during arabidopsis root development through local control on flavonol biosynthesis. Proceedings of the National Academy of Sciences, USA 109: 1554–1559. Holdsworth MJ, Bentsink L, Soppe WJ. 2008. Molecular networks regulating Arabidopsis seed maturation, after-ripening, dormancy and germination. New Phytologist 179: 33–54. Jofuku KD, den Boer BG, Van Montagu M, Okamuro JK. 1994. Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. Plant Cell 6: 1211–1225. Kendall SL, Hellwege A, Marriot P, Whalley C, Graham IA, Penfield S. 2011. Induction of dormancy in Arabidopsis summer annuals requires parallel regulation of DOG1 and hormone metabolism by low temperature and CBF transcription factors. Plant Cell 23: 2568–2580. Kitamura S, Matsuda F, Tohge T, Yonekura-Sakakibara K, Yamazaki M, Saito K, Naurmi I. 2010. Metabolic profiling and cytological analysis of proanthocyanidins in immature seeds of Arabidopsis thaliana flavonoid accumulation mutants. Plant Journal 62: 549–559. Kleindt CK, Stracke R, Mehrtens F, Weisshaar B. 2010. Expression analysis of flavonoid biosynthesis genes during Arabidopsis thaliana silique and seed development with a primary focus on the proanthocyanidin biosynthetic pathway. BMC Research Notes 3: 255. Koornneef M. 1981. The complex syndrome of ttg mutants. Arabidopsis Information Server 18: 45–51. Kuhn BM, Geisler M, Bigler K, Ringli C. 2011. Flavonols accumulate asymmetrically and affect auxin transport in Arabidopsis. Plant Physiology 156: 585–595. Leyva A, Jarillo JA, Salinas J, Martinez-Zapater JM. 1995. Low temperature induces the accumulation of phenylalanine ammonia-lyase and chalcone synthase mRNAs of Arabidopsis thaliana in a light-dependent manner. Plant Physiology 108: 39–46. MacGregor DR, Deak KI, Ingram PA, Malamy JE. 2008. Root system architecture in Arabidopsis grown in culture is regulated by sucrose uptake in the aerial tissues. Plant Cell 20: 2643–2660. Nakabayashi K, Bartsch M, Xiang Y, Miatton E, Pellengahr S, Yano R, Seo M, Soppe WJ. 2012. The time required for dormancy release in Arabidopsis is determined by DELAY OF GERMINATION1 protein levels in freshly harvested seeds. Plant Cell 24: 2826–2838. Nelson DC, Riseborough J-A, Flematti GR, Stevens J, Ghisalberti EL, Dixon KW, Smith SM. 2009. Karrikins discovered in smoke trigger arabidopsis seed germination by a mechanism requiring gibberellic acid synthesis and light. Plant Physiology 149: 863–873. Nesi N, Debeaujon I, Jond C, Pelletier G, Caboche M, Lepiniec L. 2000. The TT8 gene encodes a basic helix-loop-helix domain protein required for expression of DFR and BAN genes in Arabidopsis siliques. Plant Cell 12: 1863–1878. Nesi N, Jond C, Debeaujon I, Caboche M, Lepiniec L. 2001. The Arabidopsis TT2 gene encodes an R2R3 MYB domain protein that acts as a key determinant for proanthocyanidin accumulation in developing seed. Plant Cell 13: 2099–2114. Page M, Sultana N, Paszkiewicz K, Florance H, Smirnoff N. 2012. The influence of ascorbate on anthocyanin accumulation during high light acclimation in Arabidopsis thaliana: further evidence for redox control of anthocyanin synthesis. Plant, Cell & Environment 35: 388–404. Papi M, Sabatini S, Altamura MM, Hennig L, Sch€a fer E, Costantino P, Vittorioso P. 2002. Inactivation of the Phloem-Specific dof zinc finger GeneDAG1 affects response to light and integrity of the testa of Arabidopsis seeds. Plant Physiology 128: 411–417. Penfield S, Josse EM, Kannangara R, Gilday AD, Halliday KJ, Graham IA. 2005. Cold and light control seed germination through the bHLH transcription factor SPATULA. Current Biology 15: 1998–2006.

New Phytologist (2015) 205: 642–652 www.newphytologist.com

Penfield S, Rylott EL, Gilday AD, Graham S, Larson TR, Graham IA. 2004. Reserve mobilization in the Arabidopsis endosperm fuels hypocotyl elongation in the dark, is independent of abscisic acid, and requires PHOSPHOENOLPYRUVATE CARBOXYKINASE1. Plant Cell 16: 2705– 2718. Penfield S, Springthorpe V. 2012. Understanding chilling responses in Arabidopsis seeds and their contribution to life history. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 367: 291–297. Porter LJ, Hrstich LN, Chan BG. 1985. The conversion of procyanidins and prodelphinidins to cyanidin and delphinidin. Phytochemistry 25: 223–230. Pourcel L, Routaboul JM, Kerhoas L, Caboche M, Lepiniec L, Debeaujon I. 2005. TRANSPARENT TESTA10 encodes a laccase-like enzyme involved in oxidative polymerization of flavonoids in Arabidopsis seed coat. Plant Cell 17: 2966–2968. Pourrat Y, Jacques R. 1975. The influence of the photoperiodic conditions received by the mother plant on morphological and physiological charactersistics of Chenopodium polyspermum seeds. Plant Science Letters 4: 274–279. Qi T, Song S, Ren Q, Wu D, Huang H, Chen Y, Fan M, Peng W, Ren C, Xie D. 2011. The Jasmonate-ZIM-domain proteins interact with the WD-Repeat/ bHLH/MYB complexes to regulate Jasmonate-Mediated anthocyanin accumulation and trichome initiation in Arabidopsis thaliana. Plant Cell 23: 1795–1814. Routaboul JM, Dubos C, Beck G, Marquis C, Bidzinski P, Loudet O, Lepiniec L. 2012. Metabolite profiling and quantitative genetics of natural variation for flavonoids in Arabidopsis. Journal of Experimental Botany 63: 3749–3764. Shirley BW, Kubasek WL, Storz G, Bruggemann E, Koornneef M, Ausubel FM, Goodman HM. 1995. Analysis of Arabidopsis mutants deficient in flavonoid biosynthesis. Plant Journal 8: 659–671. Toorop PE, Cuerva RC, Begg GS, Locardi B, Squire GR, Iannetta PP. 2012. Co-adaptation of seed dormancy and flowering time in the arable weed Capsella bursa-pastoris (shepherd’s purse). Annals of Botany 109: 481–489. Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg SL, Rinn JL, Pachter L. 2012. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nature Protocols 7: 562–578. Vishwanath SJ, Kosma DK, Pulsifer IP, Scandola S, Pascal S, Joubes J, Dittrich-Domergue F, Lessire R, Rowland O, Domergue F. 2013. Suberin-associated fatty alcohols in Arabidopsis: distributions in roots and contributions to seed coat barrier properties. Plant Physiology 163: 1118–1132. Wyatt JE. 1977. Seed coat and water absorption properties of seed of near-isogenic snap bean lines differing in seed coat color. Journal of the American Society for Horticultural Science 102: 478–480. Zhang Y, Liu Z, Liu R, Hao H, Bi Y. 2011. Gibberellins negatively regulate low temperature-induced anthocyanin accumulation in a HY5/HYH-dependent manner. Plant Signaling & Behavior 6: 632–634.

Supporting Information Additional supporting information may be found in the online version of this article. Fig. S1 tt3 and tt18 have low dormancy at warmer maturation temperatures. Please note: Wiley Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office.

Ó 2014 The Authors New Phytologist Ó 2014 New Phytologist Trust