Selection and Characterization of a Mutant of Feline ... - Europe PMC

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 1996, p. 953–957 0066-4804/96/$04.0010 Copyright q 1996, American Society for Microbiology

Vol. 40, No. 4

Selection and Characterization of a Mutant of Feline Immunodeficiency Virus Resistant to 29,39-Dideoxycytidine HOLLY K. MEDLIN,1 YA-QI ZHU,1 KATHRYN M. REMINGTON,1 TOM R. PHILLIPS,2 AND THOMAS W. NORTH1* Division of Biological Sciences, The University of Montana, Missoula, Montana 59812,1 and Department of Neuropharmacology, The Scripps Research Institute, La Jolla, California 920372 Received 7 December 1995/Returned for modification 8 January 1996/Accepted 29 January 1996

We have selected and plaque purified a mutant of feline immunodeficiency virus (FIV) that is resistant to 2*,3*-dideoxycytidine (ddC). This mutant was selected in cultured cells in the continuous presence of 25 mM ddC. The mutant, designated DCR-5c, was fourfold resistant to ddC, threefold resistant to 2*,3*-dideoxyinosine, and more than fourfold resistant to phosphonoformic acid. DCR-5c displayed little or no resistance to (2)-b2*,3*-dideoxy-3*-thiacytidine, 3*-azido-3*-deoxythymidine, or 9-(2-phosphonylmethoxyethyl)adenine. Reverse transcriptase purified from DCR-5c was less susceptible to inhibition by ddCTP, phosphonoformic acid, ddATP, or azido-dTTP than the wild-type FIV reverse transcriptase. Sequence analysis of DCR-5c revealed a single base change (G to C at nucleotide 2342) in the reverse transcriptase-encoding region of FIV. This mutation results in substitution of His for Asp at codon 3 of FIV reverse transcriptase. The role of this mutation in ddC resistance was confirmed by site-directed mutagenesis. resistance phenotypes that were selected in vitro were AZTresistant mutants of FIV (32). These mutants were phenotypically similar to AZT-resistant mutants of HIV-1 isolated from patients (19, 32). We have subsequently reported mutants of FIV that are resistant to ddI or the combination of AZT plus ddI (11). These ddI-resistant mutants of FIV were phenotypically different from HIV-1 mutants obtained from patients (38) or selected in vitro (10) in that they were not crossresistant to ddC (11). To extend this work, we have selected mutants of FIV that are resistant to ddC. We report here a mutation conferring ddC resistance that is located near the N terminus of RT in a domain not previously associated with resistance to RT inhibitors.

The rapid emergence of drug-resistant variants of human immunodeficiency virus type 1 (HIV-1) presents a formidable barrier to successful treatment of AIDS (34, 40). The most widely used therapeutic agents are nucleoside analogs whose active forms, the corresponding nucleotide analogs, inhibit reverse transcriptase (RT) (6). Four nucleoside analogs have been approved and used clinically to treat AIDS, namely, 39azido-39-deoxythymidine (AZT), 29,39-dideoxyinosine (ddI), 29,39-dideoxycytidine (ddC), and 29,39-dideoxy-29,39-didehydrothymidine (d4T). However, variants of HIV-1 that are resistant to these drugs, or combinations of these drugs, emerge in treated patients and are believed to be responsible for drug failures (8, 19, 21, 34, 37, 38, 40). The problem is not limited to nucleoside analogs or even to inhibitors of RT. HIV-1 mutants resistant to nonnucleoside inhibitors of RT, such as nevirapine (35), or to protease inhibitors (4, 15) have been isolated from treated patients. Numerous HIV-1 mutants resistant to RT or protease inhibitors have also been selected in cell culture systems (cf. references 9, 10, 16, 18, and 27). Resistance of HIV-1 to RT and protease inhibitors has been traced to mutations in genes encoding the HIV-1 RT and protease, respectively (36). In order to study emergence of drug-resistant mutants and the mechanisms of resistance, we have developed model systems that use feline immunodeficiency virus (FIV). FIV is a lentivirus that causes a naturally occurring AIDS in domestic cats that is strikingly similar to AIDS in humans (28, 29). FIV also causes immunosuppressive disease and neuropathogenesis in experimentally infected specific-pathogen-free cats (1, 2, 7, 30, 31, 41), which affords an excellent opportunity for in vivo experimentation. FIV has been particularly useful for studies of viral resistance to nucleoside analogs because its RT is similar to the HIV-1 RT in physical properties, catalytic activity, and sensitivity to the active forms of AZT, ddI, ddC, and d4T (5, 22, 23). The first reported lentivirus mutants with drug

MATERIALS AND METHODS Chemicals. Triton X-100, dCTP, dTTP, aminoethyl carbazole, phosphonoformic acid (PFA), oligo(dC)10–15, and ddC were purchased from Sigma Chemical Co., St. Louis, Mo. AZT was provided by Burroughs Wellcome Co., Research Triangle Park, N.C.; ddI was provided by the Developmental Therapeutics Branch, Division of AIDS, National Institute of Allergy and Infectious Diseases; 9-(2-phosphonylmethoxyethyl)adenine (PMEA) was provided by Gilead Sciences, Inc., Foster City, Calif.; and (2)-b-29,39-dideoxy-39-thiacytidine (3TC) was provided by Raymond Schinazi of Emory University, Atlanta, Ga. Poly(rA)oligo(dT)10 and poly(rI) were purchased from Pharmacia LKB, Piscataway, N.J. [5,-59-3H]dCTP and [methyl-3H]dTTP were obtained from Dupont-New England Nuclear, Boston, Mass. International Bio Technologies phenol for DNA extractions was purchased from VWR Scientific. GeneAmp PCR core reagents were purchased from Perkin-Elmer Cetus, Norwalk, Conn. The Taq DyeDeoxy Terminator Cycle Sequencing Kit was purchased from Applied Biosystems, Foster City, Calif. EcoRI was purchased from Promega, Madison, Wis., and NsiI was from American Applied Biotechnology (Aurora, Colo.). All other chemicals were reagent grade or better. Cells and virus. Virus produced from a molecular clone of the Petaluma strain of FIV, 34TF10 (39), was used as wild-type FIV for these studies. Wild-type and mutant strains of FIV were grown and maintained in Crandell feline kidney (CrFK) cells as previously described (25). FIV mutants resistant to ddC were maintained in medium that contained 25 mM ddC; the medium was replaced every 2 days with fresh medium containing 25 mM ddC. Focal infectivity assay (FIA). FIV infectivity in the presence or absence of inhibitors was determined by an FIA as described previously (32). Data were plotted as percentage of control foci (no drug) versus inhibitor concentration. Concentrations required to inhibit focus formation by 50% (IC50) were obtained

* Corresponding author. Phone: (406) 243-2118. Fax: (406) 2434304. 953

954

MEDLIN ET AL.

directly from the linear portion of these plots, by using a computer-generated regression line (32). Within an experiment, each point on dose-response curves represents the mean from four determinations. Results from two or more independent experiments were used to derive values for IC50 6 standard error. Plaque purification of ddC-resistant mutant. Plaque purification of mutant virus was carried out with a slight modification of the procedure that we described previously (33). Limiting dilutions of virus were used to infect CrFK cells in 24-well plates in the presence of 25 mM ddC. After 6 days, each supernatant was transferred to the corresponding well of a new plate which had been seeded with uninfected CrFK cells in medium containing 25 mM ddC. To enhance virus adsorption, serum-free medium containing 8 mg of DEAE-dextran per ml was added to these cells for 20 min prior to the transfer of supernatants. Cells in the original plates were stained and examined to identify wells that contained a single focus. Corresponding wells of the subculture plate were incubated until the cells reached confluency. The cells and supernatant from appropriate wells (corresponding to a well that contained a single focus of infection) were transferred to flasks and maintained in medium containing 25 mM ddC. Cultures were monitored weekly for virus production by FIA. Enzymes and enzyme assays. RT was purified from virions of mutant FIV by methods developed in this laboratory (23). Recombinant FIV RT (24) was used as the wild-type control. Assays for RT with poly(rA)-oligo(dT), poly(rI)-oligo (dC), or M13 DNA templates were performed as reported previously (22–24). Double-reciprocal plots were used to determine kinetic constants (Km and Ki) as reported previously (5, 22). Nucleic acid preparation and DNA sequence analysis. Total cellular DNA containing provirus was extracted from CrFK cells that were infected with wildtype or ddC-resistant FIV by procedures that we have described previously (33). After ethanol precipitation, DNA was resuspended in distilled water and used for amplification by PCR. Amplification of the RT-encoding region of the pol gene was performed by the Perkin-Elmer Cetus GeneAmp PCR protocol. Each 100-ml reaction mixture contained 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 200 mM (each) deoxynucleoside triphosphate (dATP, dTTP, dCTP, and dGTP), 4 mM MgCl2, 0.2 mM (each) primer, 2.5 U of AmpliTaq DNA polymerase, and 10 to 20 mg of target DNA. Reaction mixtures were overlaid with 50 to 100 ml of light mineral oil. The sense primer (59-GTAATGTTTGTGTCTTAGAAGATA ACTC-39) and the reverse complement primer (59-ATCATATCCTGCATCTTC TGACCT-39) were synthesized on an ABI 394 DNA synthesizer in the Murdock Molecular Biology Facility, University of Montana. The primers were chosen to amplify a 1,763-bp fragment of the FIV genome that contained nucleotides 2268 through 4031. PCR was run for 30 cycles, each cycle comprising 30 s of denaturation at 948C, 30 s of annealing at 628C, and 2 min of extension at 728C. After PCR, the product was run on a 0.8% low-melting-point agarose gel and visualized with ethidium bromide. A 1,763-bp fragment was purified with the QIAquick PCR Purification Kit (Qiagen Inc., Chatsworth, Calif.). DNA was sequenced in the Murdock Molecular Biology Facility, University of Montana, with a Taq DyeDeoxy Terminator sequencing kit, and analyzed on a model 373A automated DNA sequencer (Applied Biosystems). Sequencing was performed in the forward and reverse directions with two or more primers covering each 250-bp section of the RT-encoding region and flanking regions. Site-directed mutagenesis. To facilitate mutational analysis, we constructed a 34pol cassette virus from the infectious molecular clone, FIV 34TF10 (39). This was constructed by modification of the EcoRI site in the polylinker of FIV 34TF10, enabling use of the natural EcoRI site of the virus for the pol cassette. The EcoRI site in the polylinker was changed from GAATTC to GAATTG. This modification was achieved by PCR with four synthetic primers. Primer 144 was the most 59 and spanned the DraIII site of the pUC 119 portion of the 34TF10 clone (59-GATTGGGTGTGATGGTTCACGTAGTGGG-39). Primer 145 was an antisense primer that spanned the EcoRI site of the vector’s polylinker and changed this site (59-GAATTGACTGGCCGTCGTCGTTTTAC-39, base change underlined). Primer 146 was a sense primer that matched primer 145 at the EcoRI site and was also designed to alter the natural EcoRI site (59-GTAAAACGAC GGGCCAGTCAATTC-39, base change underlined). Primer 147 was the most 39 and spanned the SacI site of the virus (59-CAATGACTTGATTATGGAGCTC GATG-39). Primer pairs 144-145 and 146-147 were used for PCR to amplify DNA from the 34TF10 target. Amplified DNA products were gel purified, combined, and reamplified with primers 144 and 147. The resulting PCR product and 34TF10 were cleaved with DraII and SacI, and the digests were gel purified and then ligated. The desired mutation was confirmed by sequence analysis. After transfection into CrFK cells, 34pol cassette produced FIV that was indistinguishable from FIV 34TF10. To introduce the mutation at codon 3 of the FIV RT, an 1,164-bp fragment corresponding to nucleotides 1740 to 2904 was amplified from DCR-5c with primer 16 (GATCCTATATAAATGTCATCC) and primer 41 (GGATCAGGA CCAGTGTGT). The PCR product and 34pol cassette were each cleaved with EcoRI and NsiI. The resulting 803-bp fragment from DCR-5c, corresponding to nucleotides 1871 to 2674 of the FIV genome, was ligated into the cleaved 34pol cassette. DNA sequence analysis was used to confirm the presence of the desired mutation. This construct was introduced into the J5 strain of Escherichia coli JM109, and the resulting plasmid DNA was used to transfect CrFK cells for production of virus.

ANTIMICROB. AGENTS CHEMOTHER. TABLE 1. Screening of DCR-2c for susceptibility to antiviral compoundsa Mean IC50 (mM) 6 SE DCR-2c

Compound 34TF10 b

ddC ddIb AZT PFA PMEA 3TC

4.9 6 0.7 5.5 6 0.8 0.34 113 0.47 0.58

Round 1

Round 2

30 6 2 21 6 1 0.62 .400 0.37 0.75

25 6 1 23 6 2 0.50 .400 0.44 0.65

a Values were determined by FIA and represent four determinations per experiment. b Values from two or more experiments. All other data are each from a single experiment.

RESULTS Selection of ddC-resistant FIV. A ddC-resistant mutant of FIV was selected by passage of FIV in CrFK cells in the continuous presence of an inhibitory concentration of ddC (25 mM). For the first round of selection, culture supernatant that contained approximately 450 focus-forming units of FIV grown from the molecular clone, 34TF10, was used to infect each of two 25-cm2 flasks of CrFK cells (approximately 1 3 105 to 2 3 105 cells). These infected cells were maintained in the continuous presence of 25 mM ddC and were assayed weekly by FIA until virus production was detected. Although cells were infected, as determined by immunostaining for viral antigens, infectious virus in the supernatants was not detectable until 17 weeks postinfection. This was considerably longer than the 3 to 8 weeks it has taken for emergence of other drug-resistant mutants (resistant to AZT, ddI, or PFA) in this system (11, 32, 33). Virus from each of the two cultures were screened for resistance to ddC. The culture which contained virus that had the highest level of resistance to ddC (four- to sixfold), designated DCR-2c, was used for a second round of infection. Fresh CrFK cells were infected with approximately 200 focus-forming units of DCR-2c, maintained in the continuous presence of 25 mM ddC, and monitored for virus production by FIA. By 4 weeks postinfection, virus production was detectable. DCR-2c populations obtained from each round of selection were screened for drug susceptibilities, and these phenotypic properties are summarized in Table 1. Virus from both rounds of selection demonstrated four- to sixfold resistance to ddC, cross-resistance to ddI and PFA, and little or no resistance to 3TC, AZT, or PMEA (Table 1). Plaque purification of ddC-resistant mutant. Plaque purification was performed to minimize potential heterogeneity within the DCR-2c population. Initial attempts at plaque purification, by procedures that we reported previously (33), were unsuccessful. In those attempts, we identified numerous wells that contained single foci but were unable to culture virus from the supernatants. In subsequent experiments, we used DEAEdextran to enhance virus adsorption in attempts to culture virus from these supernatants. Supernatants from 18 wells, each identified as having a single focus of infection, were analyzed, and only one of these yielded detectable virus. The mutant that was obtained, designated DCR-5c, was used for further characterization. This mutant was phenotypically similar to DCR-2c. Like the DCR-2c parent population, DCR-5c displayed fourfold resistance to ddC (Fig. 1) and was crossresistant to ddI and PFA but displayed wild-type sensitivity to AZT, PMEA, and 3TC (Table 2). It should be noted that the

VOL. 40, 1996

ddC-RESISTANT FIV

955

TABLE 3. Kinetic constants for wild-type FIV and DCR-5c RTsa Inhibitor

ddATP ddCTP AZTTP PFA

Substrateb

dATP dCTP dTTP dTTP

FIV RT

DCR-5c RT

Km (mM)

Ki (nM)

Km (mM)

Ki (nM)

1.4 6 0.2 6.7 6 0.1 5.0 6 0.1 5.0 6 0.1

14.4 6 0.5 53 6 4.8 1.6 6 1.0 358 6 21

0.5 6 0.1 15 6 3.5 6.3 6 1.0 6.3 6 1.0

80.8 6 3 312 6 50 10.7 6 0.7 694 6 17

a Values are reported as the mean 6 standard error of the mean of at least three determinations. The mode of inhibition of each enzyme by ddATP, ddCTP, or AZTTP was competitive with respect to substrate. Inhibition of each enzyme by PFA was noncompetitive with respect to substrate. b Templates used were M13 DNA for reactions with ddATP, poly(rI)-oligo(dC) for reactions with ddCTP, and poly(rA)-oligo(dT) for reactions with AZTTP or PFA.

FIG. 1. Inhibition of FIV 34TF10 (■) and DCR-5c (F) by ddC. Results are from three experiments with four determinations per experiment. Bars represent standard errors of the mean and are omitted where the standard error was too small to be shown.

IC50 in Table 1 were from screening of the mutant populations, whereas the data in Table 2 are from three experiments and four determinations per experiment. RT. RT was purified from DCR-5c and compared with wildtype recombinant FIV RT with respect to inhibition by ddCTP and other inhibitors. For these experiments, we used a recombinant FIV RT produced in E. coli as the wild-type enzyme; we have previously shown that this enzyme is indistinguishable from virion-derived FIV RT in susceptibility to nucleotide analogs (24). RTs from both DCR-5c and wild-type FIV were inhibited by ddCTP in a manner that was competitive with respect to dCTP. Kinetic constants for these enzymes are shown in Table 3. The Ki for inhibition of DCR-5c RT by ddCTP was sixfold higher than for inhibition of wild-type FIV RT. The Km of the mutant enzyme for dCTP was also higher (slightly more than twofold) than that of the wild-type RT. The increase in the Ki/Km ratio was approximately threefold higher for the DCR-5c RT, relative to the wild-type FIV RT. This decreased susceptibility to ddCTP is comparable with the fourfold resistance of the mutant virus to ddC. The RT from DCR5c also displayed decreased susceptibility to inhibition by ddATP (the active form of ddI) and by PFA. This enzyme was also sixfold resistant to azido-dTTP (AZTTP), which is sur-

TABLE 2. Sensitivities of FIV 34TF10 and DCR-5c to antiviral compounds as determined by FIAa Compound

ddC ddI AZT PFA PMEA 3TC

prising in view of the normal AZT sensitivity displayed by the virus. Nucleotide sequence analysis. Sequence analyses of the RTencoding regions of the pol gene from DCR-5c and FIV 34TF10 were performed, and the results are shown in Fig. 2. A single point mutation, G to C at position 2342, was the only difference between the mutant and FIV 34TF10. This mutation resulted in the replacement of Asp with His at codon 3 of the FIV RT. We have introduced this G-to-C mutation at position 2342 into the FIV 34pol cassette by site-directed mutagenesis. The resulting mutant displayed threefold resistance to ddC, confirming the role of this mutation in conferring the drug resistance phenotype. In order to determine whether this mutation was genetically stable, we passaged DCR-5c for two rounds in the absence of ddC. Virus from each of these passages displayed threefold resistance to ddC, demonstrating that it retained the ddCresistant phenotype. DISCUSSION Selection of ddC-resistant mutants of FIV proved to be more difficult than selection of mutants resistant to other antiviral agents that have been used in this system (AZT, ddI) (11, 32, 33). It took 17 weeks for virus to emerge in the initial round of selection with a concentration of ddC that was five times the IC50 for wild-type FIV. In contrast, we typically detect virus within 8 weeks in the first round of selection with AZT, PFA, or ddI at concentrations 10 times their respective IC50. Thus, it appears that FIV resistance to ddC emerges more slowly than resistance to these other antiviral agents, at least in this cell culture system. Despite this slow emergence, the mutants we ultimately selected, DCR-2c and DCR-5c, grew to titers comparable with those of wild-type FIV and 5- to 10-fold higher than titers of many of the other drug-resistant mutants we have studied. The FIV mutants that we isolated, like the ddC-resistant

Mean IC50 (mM) 6 SE FIV 34TF10

DCR-5c

3.5 6 0.6 3.0 6 0.4 0.3 6 0.2 78 6 9 0.3 6 0.1 0.5 6 0.1

13 6 0.6 9.8 6 0.5 0.5 6 0.1 .600 0.5 6 0.1 0.8 6 0.1

a Values are from three experiments, with four determinations per experiment.

FIG. 2. Nucleotide and deduced amino acid sequence of the region of the FIV pol gene surrounding position 2342. The entire RT-encoding region was sequenced from FIV 34TF10 and from DCR-5c. The indicated sequence is the published sequence for the plasmid containing the 34TF10 molecular clone (39). The only change in the RT-encoding region of DCR-5c was the indicated change in codon 3.

956

MEDLIN ET AL.

mutants of HIV-1 that have been reported, had relatively lowlevel resistance to ddC. The FIV mutants were three- to sixfold resistant to ddC; the HIV-1 mutants range from four- to sixfold resistant (8, 9, 13). The ddI-resistant mutants of FIV (11) and HIV-1 (10, 38) display a similar low-level resistance to ddI. In contrast, many of the AZT-resistant mutants of FIV (32, 33) and HIV-1 (18–20) are more than 40-fold resistant to AZT. These ddC-resistant FIV mutants were also similar to the HIV-1 mutants in that they were cross-resistant to ddI but were not altered in susceptibility to AZT. The FIV mutants were also cross-resistant to PFA but not to PMEA or 3TC. RT purified from DCR-5c had a Ki and a Ki/Km ratio about six and three times higher, respectively, than the wild-type FIV RT. This level of resistance correlates well with the fourfold resistance to ddC of the mutant virus. In this respect, DCR-5c is also similar to the ddC-resistant mutant of HIV-1 described by Gu et al. (12), which has a K-65-R mutation and a ddCTPresistant RT. Interestingly, the RT from DCR-5c was also resistant to AZTTP, but the virus is not cross-resistant to AZT. A similar lack of correlation between virus susceptibility to AZT and RT susceptibility to AZTTP has been shown for many AZT-resistant mutants of HIV-1 and FIV, which have RTs that are not resistant to AZTTP (18, 20, 32). We have previously reported AZT-resistant mutants of FIV that phenotypically revert very rapidly when they replicate in the absence of AZT (33). In contrast, DCR-5c remained phenotypically stable when passaged in the absence of ddC. This genetic stability makes DCR-5c a better candidate than the previous mutants for future in vivo studies to evaluate how mutations conferring drug resistance affect pathogenicity of the virus. The ddC-resistant mutant that we have characterized has a single base change resulting in substitution of His for Asp at codon 3 of FIV RT. This mutant is different from any of those previously reported for HIV-1, which have been selected in the presence of ddC, ddI, or 3TC. These variants have mutations in codon 65, 69, 74, 75, or 184 (36). On the basis of the X-ray crystal structure of HIV-1 RT (14, 17) and the amino acid sequence homology of the HIV-1 and FIV RTs (26, 39), this mutation is predicted to be in the thumb domain of RT, possibly on the inner side of the thumb in the vicinity of the template-primer binding domain (13a). If so, the mechanism of resistance might be similar to that reported by Boyer et al. (3) for dideoxynucleotide-resistant HIV-1 RT with mutations at codons 74 and 89 (in the fingers subdomain). Boyer et al. showed that these mutant RTs had dideoxynucleoside triphosphate resistance that was dependent upon positioning of the template primer in the active site of RT. The assignment of the codon 3 mutation to ddC resistance was confirmed by site-directed mutagenesis of FIV. This is the first assignment of a drug resistance to the extreme N-terminal domain of FIV RT or HIV-1 RT. ACKNOWLEDGMENTS This work was supported by Public Health Service grant AI28189 from the National Institute of Allergy and Infectious Diseases to T.W.N. and by grants MH47680 from the National Institute of Mental Health and RR10712 from the National Institutes of Health to T.R.P. We thank Stephen H. Hughes and Bradley D. Preston for helpful discussion and Rachel A. LaCasse, Douglas G. McBroom, and Robert A. Smith for helpful discussion and critical review of the manuscript. We also thank Joan Strange and the Murdock Molecular Biology Facility for DNA sequence analysis and oligonucleotide synthesis. REFERENCES 1. Ackley, C. D., J. K. Yamamoto, N. Levy, N. C. Pedersen, and M. D. Cooper. 1990. Immunologic abnormalities in pathogen-free cats experimentally infected with feline immunodeficiency virus. J. Virol. 64:5652–5655.

ANTIMICROB. AGENTS CHEMOTHER. 2. Barlough, J. E., C. D. Ackley, J. W. George, N. Levy, R. Acevedo, P. F. Moore, B. A. Rideout, M. D. Cooper, and N. C. Pedersen. 1991. Acquired immune dysfunction in cats with experimentally induced feline immunodeficiency virus infection: comparison of short-term and long-term infections. J. Acquired Immune Defic. Syndr. 4:219–227. 3. Boyer, P. L., C. Tantillo, A. Jacobo-Molina, R. G. Nanni, J. Ding, E. Arnold, and S. H. Hughes. 1994. Sensitivity of wild-type human immunodeficiency virus type 1 reverse transcriptase to dideoxynucleotides depends on template length; the sensitivity of drug-resistant mutants does not. Proc. Natl. Acad. Sci. USA 91:4882–4886. 4. Condra, J. H., W. A. Schieif, O. M. Blahy, L. J. Gabryelski, D. J. Graham, J. C. Quintero, A. Rhodes, H. L. Robbins, E. Roth, M. Shivaprakash, D. Titus, T. Yang, H. Teppler, K. E. Squires, P. J. Deutsch, and E. A. Emini. 1995. In vivo emergence of HIV-1 variants resistant to multiple protease inhibitors. Nature (London) 374:569–571. 5. Cronn, R. C., K. M. Remington, B. D. Preston, and T. W. North. 1992. Inhibition of reverse transcriptase from feline immunodeficiency virus by analogs of 29-deoxyadenosine-59-triphosphate. Biochem. Pharmacol. 44:1375– 1381. 6. DeClercq, E. 1992. HIV inhibitors targeted at the reverse transcriptase. AIDS Res. Hum. Retroviruses 8:119–134. 7. English, R. V., P. Nelson, C. M. Johnson, M. Nasisse, W. A. Tompkins, and M. B. Tompkins. 1994. Development of clinical disease in cats experimentally infected with feline immunodeficiency virus. J. Infect. Dis. 170:543– 552. 8. Fitzgibbon, J. E., R. M. Howell, C. A. Haberzettl, S. J. Sperber, D. J. Gocke, and D. T. Dubin. 1992. Human immunodeficiency virus type 1 pol gene mutations which cause decreased susceptibility to 29,39-dideoxycytidine. Antimicrob. Agents Chemother. 36:153–157. 9. Gao, Q., Z. Gu, J. Hiscott, G. Dionne, and M. A. Wainberg. 1993. Generation of drug-resistant variants of human immunodeficiency virus type 1 by in vitro passage in increasing concentrations of 29,39-dideoxycytidine and 29,39-dideoxy-39-thiacytidine. Antimicrob. Agents Chemother. 37:130–133. 10. Gao, Q., Z. Gu, M. A. Parniak, X. Li, and M. A. Wainberg. 1992. In vitro selection of variants of human immunodeficiency virus type 1 resistant to 39-azido-39-deoxythymidine and 29,39-dideoxyinosine. J. Virol. 66:12–19. 11. Gobert, J. M., K. M. Remington, Y.-Q. Zhu, and T. W. North. 1994. Multipledrug-resistant mutants of feline immunodeficiency virus selected with 29,39dideoxyinosine alone and in combination with 39-azido-39-deoxythymidine. Antimicrob. Agents Chemother. 38:861–864. 12. Gu, Z., R. S. Fletcher, E. J. Arts, M. A. Wainberg, and M. A. Parniak. 1994. The K65R mutant reverse transcriptase of HIV-1 cross-resistant to 29,39-dideoxycytidine, 29,39-dideoxy-39-thiacytidine, and 29,39-dideoxyinosine shows reduced sensitivity to specific dideoxynucleoside triphosphate inhibitors in vitro. J. Biol. Chem. 269:28118–28122. 13. Gu, Z., Q. Gao, H. Fang, H. Salomon, M. A. Parniak, E. Goldberg, J. Cameron, and M. A. Wainberg. 1994. Identification of a mutation at codon 65 in the IKKK motif of reverse transcriptase that encodes human immunodeficiency virus resistance to 29,39-dideoxycytidine and 29,39-dideoxy-39thiacytidine. Antimicrob. Agents Chemother. 38:275–281. 13a.Hughes, S. H. Personal communication. 14. Jacobo-Molina, A., J. Ding, R. G. Nanni, A. D. Clark, Jr., X. Lu, C. Tantillo, R. L. Williams, G. Kamer, A. L. Ferris, P. Clark, A. Hizi, S. H. Hughes, and E. Arnold. 1993. Crystal structure of human immunodeficiency virus type 1 reverse transcriptase complexed with double-stranded DNA at 3.0 Å resolution shows bent DNA. Proc. Natl. Acad. Sci. USA 90:6320–6324. 15. Jacobsen, H., K. Yasargil, D. L. Winslow, J. C. Craig, A. Krohn, I. B. Duncan, and J. Mous. 1995. Characterization of human immunodeficiency virus type 1 mutants with decreased sensitivity to proteinase inhibitor Ro 31-8959. Virology 206:527–534. 16. Kaplan, A. H., S. F. Michael, R. S. Wehbie, M. F. Knigge, D. A. Paul, L. Everit, D. J. Kempf, D. W. Norbeck, J. W. Erickson, and R. Swanstrom. 1994. Selection of multiple human immunodeficiency virus type 1 variants that encode viral proteases with decreased sensitivity to an inhibitor of the viral protease. Proc. Natl. Acad. Sci. USA 91:5597–5601. 17. Kohlstaedt, L. A., J. Wang, J. M. Friedman, P. A. Rice, and T. A. Steitz. 1992. Crystal structure at 3.5 Å resolution of HIV-1 reverse transcriptase complexed with an inhibitor. Science 256:1783–1790. 18. Larder, B. A., K. E. Coates, and S. D. Kemp. 1991. Zidovudine-resistant human immunodeficiency virus selected by passage in cell culture. J. Virol. 65:5232–5236. 19. Larder, B. A., G. Darby, and D. D. Richman. 1989. HIV with reduced sensitivity to zidovudine (AZT) isolated during prolonged therapy. Science 243:1731–1734. 20. Larder, B. A., and S. D. Kemp. 1989. Multiple mutations in HIV-1 reverse transcriptase confer high-level resistance to zidovudine (AZT). Science 246: 1155–1158. 21. Larder, B. A., S. D. Kemp, and D. J. M. Purifoy. 1989. Infectious potential of human immunodeficiency virus type 1 reverse transcriptase mutants with altered inhibitor sensitivity. Proc. Natl. Acad. Sci. USA 86:4803–4807. 22. North, T. W., R. C. Cronn, K. M. Remington, and R. T. Tandberg. 1990. Direct comparisons of inhibitor sensitivities of reverse transcriptases from

VOL. 40, 1996

23. 24. 25.

26.

27.

28. 29. 30.

31. 32.

feline and human immunodeficiency viruses. Antimicrob. Agents Chemother. 34:1505–1507. North, T. W., R. C. Cronn, K. M. Remington, R. T. Tandberg, and R. C. Judd. 1990. Characterization of reverse transcriptase from feline immunodeficiency virus. J. Biol. Chem. 265:5121–5128. North, T. W., G. L. Hansen, Y.-Q. Zhu, J. A. Griffin, and C.-K. Shih. 1994. Expression of reverse transcriptase from feline immunodeficiency virus in Escherichia coli. Antimicrob. Agents Chemother. 38:388–391. North, T. W., G. L. T. North, and N. C. Pedersen. 1989. Feline immunodeficiency virus: a model for reverse transcriptase-targeted chemotherapy for acquired immune deficiency syndrome. Antimicrob. Agents Chemother. 33: 915–919. Olmsted, R. A., V. M. Hirsch, R. H. Purcell, and P. R. Johnson. 1989. Nucleotide sequence analysis of feline immunodeficiency virus: genome organization and relationship to other lentiviruses. Proc. Natl. Acad. Sci. USA 86:8088–8092. Otto, M. J., S. Garber, D. L. Winslow, C. D. Reid, P. Aldrich, P. K. Jadhav, C. E. Pattersen, C. N. Hodge, and Y.-S. E. Cheng. 1993. In vitro isolation and identification of human immunodeficiency virus (HIV) variants with reduced sensitivity to C-2 symmetrical inhibitors of HIV type 1 protease. Proc. Natl. Acad. Sci. USA 90:7543–7547. Pedersen, N. C. 1993. The feline immunodeficiency virus, p. 181–219. In J. A. Levy (ed.), The retroviridae, vol. 2. Plenum Press, New York. Pedersen, N. C., E. W. Ho, M. L. Brown, and J. K. Yamamoto. 1987. Isolation of a T-lymphotrophic virus from domestic cats with an immunodeficiencylike syndrome. Science 235:790–793. Phillips, T. R., O. Prospero-Garcia, D. L. Puaoi, D. L. Lerner, H. S. Fox, R. A. Olmsted, F. E. Bloom, S. J. Henriksen, and J. H. Elder. 1994. Neurological abnormalities associated with feline immunodeficiency virus infection. J. Gen. Virol. 75:979–987. Podel, M. N., M. Oglesbee, L. Mathes, S. Krakowka, R. Olmstead, and L. Lafredo. 1993. AIDS-associated encephalopathy with experimental feline immunodeficiency virus infection. J. Acquired Immune Defic. Syndr.6:758–771. Remington, K. M., B. Chesebro, K. Wehrly, N. C. Pedersen, and T. W. North. 1991. Mutants of feline immunodeficiency virus resistant to 39-azido-39-deoxythymidine. J. Virol. 65:308–312.

ddC-RESISTANT FIV

957

33. Remington, K. M., Y.-Q. Zhu, T. R. Phillips, and T. W. North. 1994. Rapid phenotypic reversion of zidovudine-resistant feline immunodeficiency virus without loss of drug-resistant reverse transcriptase. J. Virol. 68:632–637. 34. Richman, D. D. 1993. Resistance of clinical isolates of human immunodeficiency virus to antiretroviral agents. Antimicrob. Agents Chemother. 37: 1207–1213. 35. Richman, D. D., D. Havlir, J. Corbeil, D. Looney, C. Ignacio, S. A. Spector, J. Sullivan, S. Cheeseman, K. Barringer, D. Pauletti, C. K. Shih, M. Myers, and J. Griffin. 1992. Nevirapine resistance mutations of human immunodeficiency virus type 1 selected during therapy. J. Virol. 68:1660–1666. 36. Schinazi, R., B. Larder, and J. Mellors. 1994. Mutations in HIV-1 reverse transcriptase and protease associated with drug resistance. Int. Antivir. News 2:72–75. 37. Shafer, R. W., M. J. Kozal, M. A. Winters, A. K. N. Iversen, D. A. Katzenstein, M. V. Ragni, W. A. Meyer, P. Gupta, S. Rasheed, R. Coombs, M. Katzman, S. Ficus, and T. C. Merigan. 1994. Combination therapy with zidovudine and didanosine selects for drug-resistant human immunodeficiency virus type 1 strains with unique patterns of pol gene mutations. J. Infect. Dis. 169:722–729. 38. St. Clair, M. H., J. L. Martin, G. Tudor-Williams, M. C. Bach, C. L. Vavro, D. M. King, P. Kellam, S. D. Kemp, and B. A. Larder. 1991. Resistance to ddI and sensitivity to AZT induced by a mutation in HIV-1 reverse transcriptase. Science 253:1557–1559. 39. Talbott, R. L., E. E. Sparger, K. M. Lovelace, W. M. Fitch, N. C. Pedersen, P. A. Luciw, and J. H. Elder. 1989. Nucleotide sequence and genomic organization of feline immunodeficiency virus. Proc. Natl. Acad. Sci. USA 86:5743–5747. 40. Wainberg, M. A., Z. Gu, Q. Gao, E. Arts, R. Geleziunas, S. Bour, R. Beaulieu, C. Tsoukas, J. Singer, and J. Montaner. 1993. Clinical correlates and molecular basis of HIV drug resistance. J. Acquired Immune Defic. Syndr. 6(Suppl. 1):S36–S46. 41. Yamamoto, J. K., E. Sparger, E. W. Ho, P. R. Andersen, T. P. O’Connor, C. P. Mandell, L. Lowenstine, R. Munn, and N. C. Pedersen. 1988. Pathogenesis of experimentally induced feline immunodeficiency virus infection in cats. Am. J. Vet. Res. 49:1246–1258.