Selective Estrogen Receptor Modulators Accelerate Cutaneous ...

0013-7227/08/$15.00/0 Printed in U.S.A.

Endocrinology 149(2):551–557 Copyright © 2008 by The Endocrine Society doi: 10.1210/en.2007-1042

Selective Estrogen Receptor Modulators Accelerate Cutaneous Wound Healing in Ovariectomized Female Mice Matthew J. Hardman, Elaine Emmerson, Laura Campbell, and Gillian S. Ashcroft Faculty of Life Sciences, University of Manchester, Manchester M13 9PT, United Kingdom A lack of systemic hormones in elderly postmenopausal women leads to delayed cutaneous wound healing. This effect can be reversed by systemic or topical estrogen replacement in both humans and rodent models. Over recent years selective estrogen receptor modulators have been developed in an attempt to achieve the beneficial effects of estrogen clinically, while minimizing the detrimental side effects. The effects of selective estrogen receptor modulators on the skin are poorly understood, and the effects on wound healing have not been assessed. In this study we treated 10-wk-old ovariectomized

mice with estradiol, tamoxifen (TAM), raloxifene (RAL), or vehicle and examined the effect on healing of full-thickness incisional wounds. Both TAM and RAL substantially accelerate healing, associated with a dampened inflammatory response and altered inflammatory cytokine profile. In vitro TAM and RAL demonstrate antiinflammatory activity comparable to estrogen. These results have significant implications for the clinical modulation of wound healing. (Endocrinology 149: 551–557, 2008)

T

HE ELDERLY PROPORTION of the population is steadily increasing. As we age, healing of acute cutaneous wounds becomes impaired (1–3), and in a subset of individuals severely impaired healing leads to the development of chronic wounds that cause substantial morbidity and mortality (4). In the United States alone, delayed wound healing is estimated to cost Health Services over $25 billion per annum (5). Considering the high prevalence and extended treatment time course of established ulcers, often many months, there is a distinct lack of effective management modalities for chronic wounds (6). To date, there are no commercially available treatments that specifically address delayed healing in elderly humans. Sex steroid hormones play an essential role in regulating skin maintenance and turnover. Estrogen maintains dermal thickness, promotes maintenance of extracellular matrix collagen levels and skin structural integrity (7), whereas androgens are implicated in the maintenance of various skin appendages (8). The reduction in estrogen that occurs at the menopause has pronounced effects on skin and the cutaneous healing response. In postmenopausal women delayed cutaneous healing is associated with increased inflammation, dysregulated protease activity, and reduced matrix deposition. Exogenous estrogen treatment, either systemically or topically, reverses this delayed healing by reducing inflammation, and stimulating matrix deposition and re-epithelialization (9, 10). Furthermore, recent evidence suggests that hormone replacement therapy (HRT) may prevent the

development of chronic wounds in postmenopausal women (11, 12). HRT has been used in the treatment of postmenopausal women for many decades. Historically, HRT has been prescribed for the symptomatic relief of subjective symptoms (e.g. hot flushes, night sweats, sleep patterns, mood changes, and vaginal dryness) in climacteric women, with an immediate improvement in quality of life (13). However, recent concerns have been raised over the long-term safety of current HRT modalities. The Women’s Health Initiative recently published the results of two separate randomized controlled trials, testing the effects of estrogen plus progestin and conjugated estrogen alone in postmenopausal women (14, 15). Both trials had to be terminated early when health risks were deemed to have exceeded benefits. Subsequent analysis indicates an increased risk of heart disease, breast cancer, stroke, and pulmonary embolism. In contrast, HRT reduced the risk of other forms of cancer and hip fracture. After the publication of these and other studies, there has been a substantial decrease in the rate of HRT prescription (16). However, current recommendations for the use of HRT are unclear (17). This indicates a need for evaluation of alternatives to HRT such as selective estrogen receptor modulators (SERMs). SERMs are a new class of drug, the majority of which are mixed agonists/antagonists, i.e. able to exert tissue-specific estrogenic or antiestrogenic activities (for a recent review, see Ref. 18). The two predominant estrogen receptor (ER) isoforms, ER␣ and ER␤, are differentially expressed across a range of tissues. It is this differential expression, in addition to differential coactivator, corepressor, and promoter levels, that leads to differing tissue-specific estrogenic effects. For example, the classical SERM tamoxifen (TAM) acts as an estrogen agonist in uterus and an estrogen antagonist in breast. This uterus agonist activity has been attributed to the relatively high levels of the steroid receptor coactivator 1 in uterus compared with breast (19). In contrast, raloxifene

First Published Online November 1, 2007 Abbreviations: ER, Estrogen receptor; HRT, hormone replacement therapy; MIF, migration-inhibitory factor; Ovx, ovariectomized; RAL, raloxifene; SERM, selective estrogen receptor modulator; TAM, tamoxifen. Endocrinology is published monthly by The Endocrine Society (http:// www.endo-society.org), the foremost professional society serving the endocrine community.

551

552

Endocrinology, February 2008, 149(2):551–557

(RAL) behaves as an antagonist in both tissues due to the preferential recruitment of corepressors (20). TAM, the first SERM to be identified in the 1960s, was approved by the Food and Drug Administration in 1977, and has been used extensively for the treatment and subsequent prevention of breast cancer due to its antagonistic activity in the breast (21). Subsequent studies have demonstrated maintained bone density in TAM-treated rats (22). These results have since been confirmed in humans by the National Surgical Adjuvant Breast and Bowel Project P-1 study (23). Unfortunately, in this study the agonistic activity of TAM in uterus translates into a 5-fold increase in endometrial cancer in postmenopausal women. TAM also increases the risk of deep-vein thrombosis and pulmonary embolism. In contrast, RAL was first identified as treatment for osteoporosis (24) and later shown to be effective at preventing breast cancer (25), without the increased risk of endometrial cancer associated with TAM treatment. RAL was approved by the Food and Drug Administration for treatment of osteoporosis in 1998. Unfortunately, RAL is ineffective at treating many of the subjective symptoms (e.g. hot flushes) experienced by women immediately after menopause. The skin is a relatively complex organ composed of multiple tissues, each with different levels and ratios of ER isoform expression. Significantly, we have recently shown that a specific polymorphism in the human ER␤ isoform correlates with an increased incidence of chronic wounds (26). Thus, it is somewhat surprising that, to date, there has been no published study addressing the potential benefits of SERMs for cutaneous wound healing. In this study we report the effects of two highly characterized SERMs, TAM and RAL, both currently approved for use in humans, on wound healing in a mouse model of human age-associated delayed healing. Materials and Methods Wounding, histology, and immunohistochemistry Ten-week-old female C57/Bl6 mice with intact ovaries and 10-wk-old C57/Bl6 mice that had undergone ovariectomy 1 month previously were anesthetized and wounded following our established protocol (27) (in accordance with home office regulations). Briefly, two equidistant 1-cm full-thickness skin incisional wounds were made through both skin and panniculus carnosus muscle, and left to heal by secondary intention. Wounds were excised and bisected at d 3 after wounding, and one half of the sample was processed for histology, allowing the midpoint of the wound to be compared between groups. The remaining one half of each wound was flash frozen and stored at ⫺80 C before RNA extraction. One day before wounding (d ⫺1), ovariectomized (Ovx) mice were injected sc on the ventral abdominal wall with 100 ␮l 10 ␮m TAM citrate (Tocris, Ellisville, MO) or 10 ␮m RAL hydrochloride (Tocris) dissolved in 5% dimethylsulfoxide/95% corn oil or vehicle alone. For each compound two further injections were administered, one immediately before wounding (d 0) and a final injection 1 d after wounding (d 1). These doses have previously been pharmacologically active in rodents (28, 29). Histological sections were prepared from wound tissue fixed in 10% buffered formal saline and embedded in paraffin. Five-micrometer sections were stained with hematoxylin and eosin or subjected to immunohistochemistry with rat anti-Ly6G, rat anti-Mac-3, rat anti-CD74 (BD Biosciences, PharMingen, Oxford, UK), anti-macrophage-inhibitory factor (MIF) goat polyclonal antibody (R&D Systems, Abingdon, UK), anti-ER␣ rabbit polyclonal antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), or mouse monoclonal anti-ER␤ (Serotec, Oxfordshire, UK), and the appropriate biotinylated secondary antibody followed by ABC-peroxidase reagent (Vector Laboratories, Peterborough, UK) with

Hardman et al. • TAM and RAL Accelerate Wound Healing

Novared substrate and counterstaining with hematoxylin. Control slides stained with secondary antibody in isolation or control IgG were negative. Total cell numbers and wound area were quantified with Image Pro Plus software (MediaCybernetics, Silver Spring, MD) as previously described (27).

Peritoneal macrophage isolation and culture Peritoneal macrophages were isolated from untreated mice by ip lavage with ice-cold sterile PBS, and pooled for subsequent studies. Cell viability was determined by trypan blue. Cells were resuspended at a concentration of 106 cells per ml in serum-free phenol-red free DMEM and treated with lipopolysaccharide (1 mg/ml) and indicated concentrations of 17␤-estradiol (Sigma-Aldrich, St. Louis, MO), TAM citrate, or RAL hydrochloride (Tocris). Cells were washed, 0.5 ml TRIzol (Invitrogen Corp., Carlsbad, CA) was added per well, and they were stored at ⫺80 C before RNA extraction.

RNA isolation and quantitative PCR cDNA was transcribed from 1 ␮g RNA (Promega RT kit and AMVreverse transcriptase; Roche, Welwyn Garden City, UK). Quantitative real-time PCR was performed using the SYBR green core kit (Eurogentec, Southampton, UK) following manufacturer’s instructions and an Opticon quantitative PCR thermal cycler (MJ Research, Inc., Waltham, MA). For each primer set, an optimal dilution was determined, and melting curves were used to determine product specificity. Each sample was serially diluted over three orders of magnitude, and all samples were run on the same 96-well plate. Expression ratios were determined relative to a standard sample and normalized using a value derived from four separate control primer sets to 18s rRNA and the housekeeping genes Gapdh, Ywahz, and Hprt. Primer sequences are listed in Table 1.

Statistical analysis Statistical differences were determined using ANOVA (multiple groups) or Mann-Whitney U tests for nonparametric data. A P value of less than 0.05 was considered significant. Simfit (University of Manchester, Manchester, UK) was used to calculate the Spearman’s coefficient where appropriate.

Results TAM and RAL accelerate impaired wound healing

Wounds from Ovx female mice represent a validated model of human age-associated delayed healing, with increased inflammation, reduced matrix deposition, and reduced re-epithelialization (9, 27). These findings were recapitulated in this study. Full-thickness dorsal incisional wounds in mice deficient in estrogen (Ovx) exhibited substantially delayed healing compared with littermates with intact ovaries (Fig. 1, A and B, intact vs. Ovx). Similarly, Ovx mice treated with exogenous estrogen at the time of wounding display significantly accelerated wound healing, reduced wound area, and accelerated re-epithelialTABLE 1. Primers used for real-time PCR Gene

Left primer

Right primer

18S Gapdh Ywhaz Hprt CD163 MIF IL6 TNF ER␣ ER␤

AGTCCCTACCCTTTGTACACA CCCACTAACATCAAATGGGG TTCTTGATCCCCAATGCTTC TGCTCGAGATGTCATGAAGG CTTGTACCCACAGCAGGGAT CTGGCACCCCACAACTTACT CCGGAGAGGAGACTTCACAG CTCTTCAAGGGCCAAGGCTG AATGAAATGGGTGCTTCAGG GAGTAGCCGGAAGCTGACAC

GATCCAAGGGCCTCACTAAAC TCTCCATGGTGGTGAAGACA TTCTTGTCATCACCAGCAGC AATCCAGCAGGTCAGCAAAG AGCTCCACTCTTCCCTCACA CCTGGCAAGGTAGAGTGAGC TCCACGATTTCCCAGAGAAC GGTATGAAGTGGCAAATCGG AAGGACAAGGCAGGGCTATT CTGCTGCTGGGAAGAGATTC



553

FIG. 1. TAM and RAL accelerate impaired wound healing in Ovx mice. A, Representative hematoxylin and eosin-stained sections of full-thickness incisional wounds (d 3) from mice with intact ovaries, Ovx mice, and Ovx mice treated with systemic estrogen (E), TAM, or RAL (arrows indicate wound margins). Bar, 400 ␮m. B and C, Systemic administration of TAM or RAL accelerates healing by an equal extent to systemic estrogen replacement at physiological levels, quantified by a statistically significant reduction in wound area (B) and increase in re-epithelialization vs. untreated Ovx mice. Results are shown mean ⫾ SEM (n ⫽ 6 per group). P ⬎ 0.05 (black asterisk) and P ⬎ 0.01 (red asterisk) with respect to the Ovx group.

ization (Fig. 1, A–C, Ovx vs. estrogen). Systemic treatment with either TAM or RAL also resulted in a statistically significant acceleration of healing, reduced wound areas, and accelerated re-epithelialization (Fig. 1, A–C, Ovx vs. TAM vs. RAL). To our knowledge this is the first time that a SERM compound has been reported to alter the cutaneous healing response.

FIG. 2. TAM and RAL treatment decrease wound inflammatory cell numbers in Ovx mice. A, Both compounds reduce wound neutrophil numbers to a lesser extent than in estrogen-treated wounds. B, Representative Ly6G immunohistochemistry. C, Both compounds are potently antiinflammatory with respect to macrophages, reducing cell numbers comparable to estrogen. D, Representative Mac-3 immunohistochemistry. E, Wound CD163 expression is reduced in estrogen-, TAM-, and RAL-treated wounds, with TAM promoting the most pronounced reduction. Results are shown mean ⫾ SEM (n ⫽ 6 per group). Bar, 60 ␮m. P ⬎ 0.05 (black asterisk) and P ⬎ 0.01 (red asterisk) with respect to the Ovx group.

TAM and RAL modulate the inflammatory response

Both in vivo and in vitro estrogen is potently antiinflammatory. Previous studies in humans and rodent models demonstrate that estrogen reduces both neutrophil and macrophage numbers within the wound tissue (9, 10, 27). In the current study, wounds from Ovx mice (lacking estrogen) displayed increased numbers of Ly-6G positive and Mac-3 positive cells corresponding to neutrophils and macrophages, respectively (Fig. 2, A–D). In mice treated with estrogen, neutrophil and macrophage numbers displayed a statistically significant reduction. In mice treated with either TAM or RAL, wound macrophage numbers were reduced to a statistically significant level (Fig. 2, C and D). Estrogen, TAM, and RAL are equally antiinflammatory with respect to macrophages (Fig. 2, C and D), whereas TAM and RAL did not inhibit neutrophil influx into the wound site (Fig. 2, A and B). This observation is particularly interesting in light of the quantitatively comparable acceleration of healing demonstrated by all three treatments (Fig. 1) and suggests that the observed between-treatment difference in neutrophil numbers does not impact on healing outcome (i.e. wound area

and re-epithelialization). Although all three compounds reduced infiltrating macrophage numbers to an equal extent, we did see differences in the levels of macrophage expressed genes (Fig. 2E; data not shown). CD163 expression is confined to cells of the macrophage lineage and highly expressed in “alternatively activated” antiinflammatory macrophages (30). Interestingly, TAM was found to most potently reduce CD163 gene expression, whereas estrogen displayed the least reduction, possibly indicating a switch toward resolution of inflammation (Fig. 2E). The dampened inflammatory response observed in TAM and RAL treated mice prompted us to examine wound expression of key proinflammatory cytokines, validated markers of the inflammation modulating activity of estrogen (27, 31), and other hormones such as dehydroepiandrosterone (32) and testosterone (33). TAM or RAL inhibited wound expression of the proinflammatory cytokines MIF, IL6, and TNF to an equal extent to estrogen in wounds from Ovx mice, indicating comparable antiinflammatory activity (Fig. 3, A–C). We have recently shown

554



FIG. 3. Wound cytokine expression is reduced after SERM treatment. A–C, TAM and RAL potently inhibit expression of the proinflammatory cytokines MIF, IL6, and TNF␣. This reduction in expression translates into an equivalent reduction in the number of wound cells expressing protein [compare A, MIF expression with D, quantification of MIF wound protein immunolocalization (E)]. F and G, TAM and RAL also reduce the number of wound cells expressing the putative MIF receptor, CD74. Results are shown mean ⫾ SEM (n ⫽ 6 per group). Bar, 50 ␮m. P ⬎ 0.05 (black asterisk) and P ⬎ 0.01 (red asterisk) with respect to the Ovx group.

Because both TAM and RAL significantly reduced the wound inflammatory response in vivo, we used an in vitro system to investigate the direct effects on macrophage function, specifically proinflammatory gene expression. Nonactivated mouse peritoneal macrophages were isolated, pooled, and then cultured in the presence of lipopolysaccharide alone or in combination with increasing concentrations of estrogen, TAM, or RAL. All three compounds dose dependently reduced macrophage expression of MIF and TNF (Fig. 4), mirroring the observations for these proinflammatory cytokines in vivo (Fig. 3). In line with data from wound tissue, at the highest concentration tested (100 nm), TAM inhibited MIF expression to a greater extent than an equal concentration of estrogen or RAL. In contrast, TAM was less effective than estrogen at inhibiting TNF␣ expression (Fig. 4).

Both estrogen and SERMs act though binding to homodimeric and heterodimeric ERs. In addition, SERMs have the potential to selectively induce ER isoforms in a specific target tissue further amplifying effects on downstream gene expression. Indeed, the regulation of ER may represent a mechanism for controlling differential effects of SERMs on cells. Thus, we examined the effect of estrogen, TAM, or RAL treatment on wound ER␣ and ER␤ gene

A Relative expression

TAM and RAL modulate macrophage proinflammatory cytokine expression

TAM and RAL alter tissue-specific ER expression

MIF

1.6 1.4 1.2 1 0.8

∗

0.6 0.4

∗∗

∗∗

0.2 0

-

10 100 E2 (nM)

1

B Relative expression

that MIF, a small atypical proinflammatory cytokine, acts as a central regulator of all aspects of healing (27). In light of MIF’s key role in the wound repair process, we next looked at expression of MIF protein in wound tissue and at the expression of the putative MIF receptor CD74 (34). In correlation with gene expression changes, we observed a highly statistically significant reduction in wound MIF expressing cells after treatment with either estrogen, TAM, or RAL (Fig. 3, D and E). However, we now observed differences between treated mouse groups. TAM treated wounds had significantly less MIF expressing cells than estrogen or RAL treated wounds (300% reduction TAM vs. RAL). In contrast, TAM displayed an opposite effect on the number of cells expressing the putative MIF receptor, CD74 (Fig. 3, F and G, 250% increase TAM vs. estrogen).

10 100 TAM (nM)

1

10 100 RAL (nM)

TNF

1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0

∗∗ -

10

100

E2 (nM)

∗∗ 1

10

100

TAM (nM)

1

10

100

RAL (nM)

FIG. 4. TAM and RAL display potent antiinflammatory activity in vitro, directly down-regulating macrophage cytokine expression. A, Both SERMs dose dependently decreased macrophage MIF expression more effectively than estrogen at an equal molar concentration. B, Conversely, estrogen and RAL down-regulate TNF␣ expression to a greater extent than TAM. Results are shown mean ⫾ SEM (n ⫽ 4 per group). *, P ⬎ 0.05 and **, P ⬎ 0.01 with respect to the untreated group.


expression and cellular protein levels. Within the wound, estrogen preferentially induced dermal cellular expression of ER␤, a novel finding (Fig. 5, E and G). This differential induction of cellular ER␤ was particularly interesting in the context of our previous studies demonstrating the importance of ER␤ in human wound healing (26). In addition, differential ER induction implies de novo cellular ER␤ induction as opposed to influx of new ER␤ expressing cells, e.g. inflammatory cells. Interestingly, TAM nonsignificantly induced dermal ER␣ gene and protein expression (Fig. 5, A and D), whereas RAL specifically induced ER␤ gene expression (Fig. 5H). Contrastingly, in the epidermis, both TAM and RAL dramatically increased the proportion of keratinocytes expressing ER␤ protein (Fig. 5F), again a novel finding. This contrasts with a small reduction in ER␣ protein expressing keratinocytes (Fig. 5B). This change in receptor profile may be an important contributing factor in the increased re-epithelialization observed in TAM and RAL treated wounds (Fig. 1C). Discussion

Based on observations of the effects of SERMs in other tissues, in addition to our own work demonstrating the potent effects of estrogen on delayed wound healing, we hypothesized that the SERM compounds TAM and RAL would significantly modulate the wound healing response. In this study we used a highly characterized murine wound healing model to test this hypothesis. Our results clearly demonstrate the beneficial effects of TAM and RAL on wound healing. Indeed, we are encouraged by the efficacy of both compounds after systemic administration over a relatively short 3-d period. Our knowledge of the role of different ER isoforms in

FIG. 5. SERM-specific ER isoform induction. A, At the protein level, TAM nonsignificantly increases dermal ER␣ expression (C), in contrast to no increase in RAL treated wounds. B, In the epidermis both SERMs decrease ER␣ expressing cell numbers, whereas estrogen (E) has the opposite effect. D, At the level of gene expression, total wound ER␣ levels are substantially increased by estrogen and TAM alone. Note that this represents a summation of (A) and (B). E and F, Estrogen and both SERMs strongly induce increased wound ER␤ protein levels (G). For TAM and RAL, this effect is particularly pronounced in the epidermis and far greater than the response to estrogen. H, At the level of gene expression, total wound ER␤ levels are increased in estrogen and RAL treated wounds. Results are shown mean ⫾ SEM (n ⫽ 6 per group). Bar, 45 ␮m. P ⬎ 0.05 (black asterisk) and P ⬎ 0.01 (red asterisk) with respect to the Ovx group.


555

tissue function is far from complete. This is especially true for the skin, an organ composed of multiple tissue types, each with different ratios of ERs and ER-binding cofactors. Multiple studies have investigated the role of ER isoforms in stably transfected cell systems. These have tended to show that different estrogenic compounds induce very different patterns of gene expression. For example, Kian Tee et al. (35) found that in stably transfected nonreproductive U2OS osteosarcoma cells, few genes were commonly regulated by estrogen and TAM (18%) or estrogen and RAL (17%), whereas substantially more were commonly regulated between the two SERMs (37%). In line with these findings from gene expression studies, we report between-treatment differences for wound inflammatory cell type composition, cytokine expression, and ER isoform induction. However, somewhat unexpectedly, all three compounds globally accelerate delayed wound healing to a relatively comparable degree. This suggests that crucial underlying pathways and events are similarly regulated by all three treatments. Although a plethora of literature is available assessing the antagonistic activity of TAM and RAL on estrogendependent gene expression or cellular function in reproductive tissues (particularly breast) and agonistic activity in bone (reviewed in Ref. 19), there is virtually no documentation of the agonistic activity of these compounds in the skin. The surprising finding from our study is that despite clearly different functions in some tissues (e.g. uterus), both TAM and RAL act as estrogen agonists (i.e. potently accelerate cutaneous wound healing) in the skin. Surazynski et al. (36) have shown that in vitro RAL treatment of human skin fibroblast cells results in stronger positive stimulatory effects on collagen biosynthesis than

556 Endocrinology, February 2008, 149(2):551–557

estrogen treatment. Collagen biosynthesis and deposition are an essential aspect of successful wound healing. Therefore, the results support the finding from this study that RAL treatment accelerates healing in a mouse model of human age-associated delayed healing. In a follow-up study, Haczynski et al. (37) reported the effects of fibroblast SERM treatment on ER isoform expression. These authors noted that in human fibroblasts, estrogen and TAM induced both ER isoforms (although the temporal profile differed), whereas RAL selectively induced ER␤. In this study we confirm these in vitro findings by demonstrating the same pattern of induction in vivo. Moreover, we show novel tissue-specific differences in skin ER isoform induction. For example, both TAM and RAL strongly induce epidermal ER␤ expression while reducing ER␣ expression. In the study by Kian Tee et al. (35), the authors found that the percentage of genes commonly induced by estrogen in both ER␣- and ER␤-transfected cells was very low (17%), i.e. ER␣ and ER␤ regulate different sets of genes with different functions. Our finding that estrogen, RAL, and, to a lesser extent, TAM specifically induce ER␤ is fascinating in light of our recent demonstration that in human an ER␤ polymorphism strongly correlates with delayed healing (26). Further work is now urgently required to determine whether subjects carrying this disease polymorphism will be able to respond to SERM treatment. In summary, we have demonstrated the clear beneficial effects of the SERMs TAM and RAL on cutaneous wound healing. These encouraging findings have exciting clinical implications. It should be possible to find an estrogenic compound that can be safely used to treat chronically delayed healing in the elderly. To this end we are currently investigating the effects of third-generation SERMs on wound healing. Acknowledgments Received August 2, 2007. Accepted October 22, 2007. Address all correspondence and requests for reprints to: Professor Gillian S. Ashcroft, Faculty of Life Sciences, University of Manchester, Michael Smith Building, Oxford Road, Manchester M13 9PT, United Kingdom. E-mail: [email protected]. This work was supported by Wellcome Trust, European Union (Estrogen Women Aging Project: LSHM-CT-2005-518245), Research Into Ageing. Disclosure Statement: The authors have nothing to disclose.

References 1. Ashcroft GS, Horan MA, Ferguson MW 1998 Aging alters the inflammatory and endothelial cell adhesion molecule profiles during human cutaneous wound healing. Lab Invest 78:47–58 2. Ashcroft GS, Horan MA, Herrick SE, Tarnuzzer RW, Schultz GS, Ferguson MW 1997 Age-related differences in the temporal and spatial regulation of matrix metalloproteinases (MMPs) in normal skin and acute cutaneous wounds of healthy humans. Cell Tissue Res 290:581–585 3. Ashcroft GS, Horan MA, Ferguson MW 1997 Ageing is associated with reduced deposition of specific extracellular matrix components, an upregulation of angiogenesis, and an altered inflammatory response in a murine incisional wound healing model. J Invest Dermatol 108:430 – 437 4. Phillips TJ 1994 Chronic cutaneous ulcers: etiology and epidemiology. J Invest Dermatol 102:38 – 41 5. US Department of Health and Human Services 2004 Guidance to surveyors for long term care facilities. World Wide Web URL: http://www.cms.hhs.gov


6. Hardman MJ, Ashcroft GS 2005 Hormonal influences on wound healing: a review of current experimental data. Wounds 17:313–320 7. Brincat M, Versi E, Moniz CF, Magos A, de Trafford J, Studd JW 1987 Skin collagen changes in postmenopausal women receiving different regimens of estrogen therapy. Obstet Gynecol 70:123–127 8. Akamatsu H, Zouboulis CC, Orfanos CE 1992 Control of human sebocyte proliferation in vitro by testosterone and 5-␣-dihydrotestosterone is dependent on the localization of the sebaceous glands. J Invest Dermatol 99:509 –511 9. Ashcroft GS, Dodsworth J, van Boxtel E, Tarnuzzer RW, Horan MA, Schultz GS, Ferguson MW 1997 Estrogen accelerates cutaneous wound healing associated with an increase in TGF-␤1 levels. Nat Med 3:1209 –1215 10. Ashcroft GS, Greenwell-Wild T, Horan MA, Wahl SM, Ferguson MW 1999 Topical estrogen accelerates cutaneous wound healing in aged humans associated with an altered inflammatory response. Am J Pathol 155: 1137–1146 11. Margolis DJ, Knauss J, Bilker W 2002 Hormone replacement therapy and prevention of pressure ulcers and venous leg ulcers. Lancet 359:675– 677 12. Berard A, Kahn SR, Abenhaim L 2001 Is hormone replacement therapy protective for venous ulcer of the lower limbs? Pharmacoepidemiol Drug Saf 10:245–251 13. American College of Physicians 1992 Guidelines for counseling postmenopausal women about preventive hormone therapy. Ann Intern Med 117: 1038 –1041 14. Rossouw JE, Anderson GL, Prentice RL, LaCroix AZ, Kooperberg C, Stefanick ML, Jackson RD, Beresford SA, Howard BV, Johnson KC, Kotchen JM, Ockene J, Writing Group for the Women’s Health Initiative Investigators 2002 Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results from the Women’s Health Initiative randomized controlled trial. JAMA 288:321–333 15. Anderson GL, Limacher M, Assaf AR, Bassford T, Beresford SA, Black H, Bonds D, Brunner R, Brzyski R, Caan B, Chlebowski R, Curb D, Gass M, Hays J, Heiss G, Hendrix S, Howard BV, Hsia J, Hubbell A, Jackson R, Johnson KC, Judd H, Kotchen JM, Kuller L, LaCroix AZ, Lane D, Langer RD, Lasser N, Lewis CE, Manson J, Margolis K, Ockene J, O’Sullivan MJ, Phillips L, Prentice RL, Ritenbaugh C, Robbins J, Rossouw JE, Sarto G, Stefanick ML, Van Horn L, Wactawski-Wende J, Wallace R, Wassertheil-Smoller S, Women’s Health Initiative Steering Committee 2004 Effects of conjugated equine estrogen in postmenopausal women with hysterectomy. JAMA 291:1701–1712 16. Udell JA, Fischer MA, Brookhart MA, Solomon DH, Choudhry NK 2006 Effect of the Women’s Health Initiative on osteoporosis therapy and expenditure in Medicaid. J Bone Miner Res 21:765–771 17. Pitkin J, Rees MC, Gray S, Lumsden MA, Marsden J, Stevenson J, Williamson J, British Menopause Society Council 2005 Managing the menopause: British Menopause Society Council consensus statement on hormone replacement therapy. J Br Menopause Soc 11:152–156 18. Jordan VC 2007 SERMs: meeting the promise of multifunctional medicines. J Natl Cancer Inst 99:350 –356 19. Riggs BL, Hartmann LC 2003 Selective estrogen-receptor modulators– mechanisms of action and application to clinical practice. N Engl J Med [Erratum (2003) 348:1192] 348:618 – 629 20. Boss SM, Huster WJ, Neild JA, Glant MD, Eisenhut CC, Draper MW 1997 Effects of raloxifene hydrochloride on the endometrium of postmenopausal women. Am J Obstet Gynecol 177:1458 –1464 21. Jordan VC 2003 Tamoxifen: a most unlikely pioneering medicine. Nat Rev Drug Discov 2:205–213 22. Jordan VC, Phelps E, Lindgren JU 1987 Effects of anti-estrogens on bone in castrated and intact female rats. Breast Cancer Res Treat 10:31–35 23. Fisher B, Costantino JP, Wickerham DL, Cecchini RS, Cronin WM, Robidoux A, Bevers TB, Kavanah MT, Atkins JN, Margolese RG, Runowicz CD, James JM, Ford LG, Wolmark N 2005 Tamoxifen for the prevention of breast cancer: current status of the National Surgical Adjuvant Breast and Bowel Project P-1 study. J Natl Cancer Inst 97:1652–1662 24. Delmas PD, Bjarnason NH, Mitlak BH, Ravoux AC, Shah AS, Huster WJ, Draper M, Christiansen C 1997 Effects of raloxifene on bone mineral density, serum cholesterol concentrations, and uterine endometrium in postmenopausal women. N Engl J Med 337:1641–1647 25. Cummings SR, Eckert S, Krueger KA, Grady D, Powles TJ, Cauley JA, Norton L, Nickelsen T, Bjarnason NH, Morrow M, Lippman ME, Black D, Glusman JE, Costa A, Jordan VC 1999 The effect of raloxifene on risk of breast cancer in postmenopausal women: results from the MORE randomized trial. Multiple outcomes of raloxifene evaluation. JAMA 281: 2189 –2197 26. Ashworth JJ, Smyth JV, Pendleton N, Horan M, Payton A, Worthington J, Ollier WE, Ashcroft GS 2005 The dinucleotide (CA) repeat polymorphism of estrogen receptor ␤ but not the dinucleotide (TA) repeat polymorphism of estrogen receptor ␣ is associated with venous ulceration. J Steroid Biochem Mol Biol 97:266 –270 27. Hardman MJ, Waite A, Zeef L, Burow M, Nakayama T, Ashcroft GS 2005 Macrophage migration inhibitory factor: a central regulator of wound healing. Am J Pathol 167:1561–1574


28. Sanchez-Criado JE, de Las Mulas JM, Bellido C, Navarro VM, Aguilar R, GarridoGracia JC, Malagon MM, Tena-Sempere M, Blanco A 2006 Gonadotropin-secreting cells in ovariectomized rats treated with different oestrogen receptor ligands: a modulatory role for ER␤ in the gonadotrope? J Endocrinol 188:167–177 29. Evans MJ, Lai K, Shaw LJ, Harnish DC, Chadwick CC 2002 Estrogen receptor ␣ inhibits IL-1␤ induction of gene expression in the mouse liver. Endocrinology 143:2559 –2570 30. Moestrup SK, Møller HJ 2004 CD163: a regulated hemoglobin scavenger receptor with a role in the anti-inflammatory response. Ann Med 36:347– 354 31. Ashcroft GS, Mills SJ, Lei K, Gibbons L, Jeong MJ, Taniguchi M, Burow M, Horan MA, Wahl SM, Nakayama T 2003 Estrogen modulates cutaneous wound healing by downregulating macrophage migration inhibitory factor. J Clin Invest 111:1309 –1318 32. Mills SJ, Ashworth JJ, Gilliver SC, Hardman MJ, Ashcroft GS 2005 The sex steroid precursor DHEA accelerates cutaneous wound healing via the estrogen receptors. J Invest Dermatol 125:1053–1062


557

33. Gilliver SC, Ashworth JJ, Mills SJ, Hardman MJ, Ashcroft GS 2006 Androgens modulate the inflammatory response during acute wound healing. J Cell Sci 119:722–732 34. Leng L, Metz CN, Fang Y, Xu J, Donnelly S, Baugh J, Delohery T, Chen Y, Mitchell RA, Bucala R 2003 MIF signal transduction initiated by binding to CD74. J Exp Med 197:1467–1476 35. Kian Tee M, Rogatsky I, Tzagarakis-Foster C, Cvoro A, An J, Christy RJ, Yamamoto KR, Leitman DC 2004 Estradiol and selective estrogen receptor modulators differentially regulate target genes with estrogen receptors ␣ and ␤. Mol Biol Cell 15:1262–1272 36. Surazynski A, Jarzabek K, Haczynski J, Laudanski P, Palka J, Wolczynski S 2003 Differential effects of estradiol and raloxifene on collagen biosynthesis in cultured human skin fibroblasts. Int J Mol Med 12:803– 809 37. Haczynski J, Tarkowski R, Jarzabek K, Wolczynski S, Magoffin DA, Czarnocki KJ, Ziegert M, Jakowicki J, Jakimiuk AJ 2004 Differential effects of estradiol, raloxifene and tamoxifen on estrogen receptor expression in cultured human skin fibroblasts. Int J Mol Med 13:903–908

Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.