Selective Promoter Recognition by Chlamydial ... - Semantic Scholar

2 downloads 0 Views 1MB Size Report
and Peter Rice and Rick Gourse for useful suggestions and discus- sions. We thank .... Ross, W., K. K. Gosink, J. Salomon, K. Igarashi, C. Zou, A. Ishihama, K.
JOURNAL OF BACTERIOLOGY, Nov. 2006, p. 7364–7377 0021-9193/06/$08.00⫹0 doi:10.1128/JB.01014-06 Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Vol. 188, No. 21

Selective Promoter Recognition by Chlamydial ␴28 Holoenzyme䌤† Li Shen,1* Xiaogeng Feng,1 Yuan Yuan,2 Xudong Luo,1 Thomas P. Hatch,3 Kelly T. Hughes,4 Jun S. Liu,2 and You-xun Zhang1 Department of Medicine, Boston Medical Center, Boston University School of Medicine, Boston, Massachusetts 021181; Department of Statistics, Harvard University, Cambridge, Massachusetts 021382; Department of Molecular Sciences, University of Tennessee, Memphis, Tennessee 381633; and Department of Biology, University of Utah, Salt Lake City, Utah 841124 Received 11 July 2006/Accepted 15 August 2006

The ␴ transcription factor confers the promoter recognition specificity of RNA polymerase (RNAP) in eubacteria. Chlamydia trachomatis has three known sigma factors, ␴66, ␴54, and ␴28. We developed two methods to facilitate the characterization of promoter sequences recognized by C. trachomatis ␴28 (␴28Ct). One involved the arabinose-induced expression of plasmid-encoded ␴28Ct in a strain of Escherichia coli defective in the ␴28 structural gene, fliA. The second was an analysis of transcription in vitro with a hybrid holoenzyme reconstituted with E. coli RNAP core and recombinant ␴28Ct. These approaches were used to investigate the interactions of ␴28Ct with the ␴28Ct-dependent hctB promoter and selected E. coli ␴28 (␴28Ec)-dependent promoters, in parallel, compared with the promoter recognition properties of ␴28EC. Our results indicate that RNAP containing ␴28Ct has at least three characteristics: (i) it is capable of recognizing some but not all ␴28ECdependent promoters; (ii) it can distinguish different promoter structures, preferentially activating promoters with upstream AT-rich sequences; and (iii) it possesses a greater flexibility than ␴28EC in recognizing variants with different spacing lengths separating the ⴚ35 and ⴚ10 elements of the core promoter. Unlike Escherichia coli, which has seven ␴ factors, Chlamydia encodes only three known ␴ factors (22, 42, 52): ␴66, encoded by rpoD; ␴54, encoded by rpoN; and C. trachomatis ␴28 (␴28Ct), encoded by rpsD (also called fliA or whiG). The role of each ␴ factor during the developmental cycle of Chlamydia is not clear. Studies of molecular mechanisms in Chlamydia are challenging due to the difficulty of propagation and the inability to genetically manipulate this intracellular bacterium. As a result, the promoter specificities of the chlamydial ␴ factors have been investigated only in vitro, and only a few chlamydial promoters have been characterized (9, 16, 33, 50, 53, 58). It is presumed that ␴66, a homologue of E. coli ␴70, is the major ␴ factor and is responsible for the transcription of housekeeping genes (16, 26). Indeed, several essential genes in Chlamydia have been transcribed in vitro by RNAP containing ␴66 (9, 34, 50, 53, 55). Much less is known about the target genes and the promoter sequences recognized by chlamydial ␴54 and ␴28. Two ␴54-promoter-like sequences have been identified upstream of the putative open reading frames CT652.1 and CT683 in Chlamydia, which are constitutively transcribed during the developmental cycle (35, 39). While several late-stage genes are dependent on ␴66 for their expression (12), a ␴28Ctdependent promoter has been identified upstream of the latestage-expression hctB gene (58). This gene encodes a histonelike protein, which is believed to be involved in the conversion of the RB to EB forms of Chlamydia (5). Transcription of the rpsD gene, which encodes ␴28Ct, is heat responsive (49). Thus, ␴28Ct may play a role in controlling the differentiation of Chlamydia and its adaptation response during adverse environmental conditions. Specifically, our interests are in the mechanism of ␴28Ct activation of transcription. Previously, we demonstrated that

Chlamydia trachomatis is an obligate intracellular bacterial pathogen of humans. It is the major cause of bacterial sexually transmitted diseases in the United States and the leading cause of preventable blindness worldwide (47). A unique developmental cycle, characterized by the conversion of a metabolically inactive but infectious elementary body (EB) to an intracellularly replicating but noninfectious reticulate body (RB) and the return to the EB form at the end of the cycle, makes Chlamydia distinct from other intracellular bacteria (37). Little is known about how gene expression is regulated in Chlamydia, but some control is effected at the level of transcription by ␴ factors and other transcriptional regulators (1, 16, 39). By binding to the RNA polymerase (RNAP) core enzyme (composed of subunits ␣2␤␤⬘␻), the ␴ factors confer on the enzyme the ability to recognize specific DNA elements (promoters) located upstream of the transcription start site and interact with another transcriptional regulator(s) (10, 15, 20, 57). Based on the homology of amino acids, ␴ factors can be classified into two groups: those similar to E. coli primary ␴ factor ␴70 and those similar to ␴54 (␴N) (32). Members of the ␴70 family contain ␴70, ␴28, and most of the other alternative ␴ factors. Four conserved functional domains (regions 1 to 4) with subdomains have been proposed for members of the ␴70 family. Of these domains, regions 2.4 and 4.2 of ␴70 are involved in the recognition of the ⫺10 and ⫺35 elements of the promoters, respectively (20, 32).

* Corresponding author. Mailing address: Department of Medicine, Boston Medical Center, Boston University School of Medicine, Boston, MA 02118. Phone: (617) 414-5278. Fax: (617) 414-5280. E-mail: [email protected]. † Supplemental material for this article may be found at http://jb .asm.org/. 䌤 Published ahead of print on 25 August 2006. 7364

VOL. 188, 2006

PROMOTER RECOGNITION BY CHLAMYDIAL ␴28 RNA POLYMERASE

7365

TABLE 1. Names and descriptions of plasmids Plasmid

pLC3 pLF28 pLE28 pS28H pES28H pRVB pCG pPgroE::cat-gfp pPgroEEc::cat-gfp pPflgK::cat-gfp pPhctB::cat-gfp pPtar::cat-gfp pPycgR::cat-gfp pMT504 pGLC pGPgroEEc pGPgroE pGPflgK pGPtar pGPycgR pGPhctB pGPhctB⌬UP pGPhctB-2 pGPtar⫹ pGPlacUV5 pGPlacUV5⫹ pGS9 pGS10 pGS11 pGS13 pGS14

Description

Source

A low-copy-number expression vector; a recombinant of pBAD24 and pACYC184; the origin of replication of p15A, Tcr pLC3 carrying chlamydial rpsD pLC3 carrying E. coli fliA A derivative of pBAD24; expression vector with an N-terminal His6 tag; carries 5⬘ chlamydial rpsD; Apr A derivative of pBAD24; expression vector with an N-terminal His6 tag; carries E. coli fliA; Apr A recombinant of pRV1 and pBR322; ColE1; Apr A promoter probe vector containing promoterless cat::gfp; the origin of replication of ColE1; Apr pCG with the promoter region of chlamydial groE (PgroE) pCG with the promoter region of E. coli groE (PgroEEc) pCG with the promoter region of E. coli flgK (PflgK) pCG with the promoter region of chlamydial hctB (PhctB) pCG with the promoter region of E. coli tar (Ptar) pCG with the promoter region of E. coli ycgR (PycgR) A cloning vector containing a promoterless guanine (G)-less cassette and a chalmydial rRNA P1-controlled G-less cassette; Apr A cloning vector containing a promoterless guanine (G)-less cassette and an E. coli fliC promoter-controlled G-less cassette; Apr pGLC with the promoter region of E. coli groE (PfliC and PgroEEc) pGLC with the promoter region of chlamydial groE from serovar F pGLC with the promoter region of E. coli flgK (PfliC and PflgK) pGLC with the promoter region of E. coli tar (PfliC and Ptar) pGLC with the promoter region of E. coli ycgR (PfliC and PycgR) pGLC with the promoter region of chlamydial hctB from serovar F A derivate of pGPhctB deleting the upstream sequence of the PhctB ⫺35 region A derivate of pGPhctB fusing a DNA sequence upstream of Ptar to the core promoter of PhctB A derivate of pGPtar fusing a DNA sequence upstream of PhctB to the core promoter of Ptar pGLC with the promoter region of E. coli PlacUV5 A derivate of pGPlacUV5 containing the upstream DNA ⫺65 to ⫺38 sequence fused to core the promoter of PlacUV5 A derivate of pGPhctB containing 9 bp between the ⫺35 and ⫺10 regions A derivate of pGPhctB containing 10 bp between the ⫺35 and ⫺10 regions A derivate of pGPhctB containing 11 bp between the ⫺35 and ⫺10 regions A derivate of pGPhctB containing 13 bp between the ⫺35 and ⫺10 regions A derivate of pGPhctB containing 14 bp between the ⫺35 and ⫺10 regions

␴28Ct, when associated with E. coli core RNAP, was able to recognize the E. coli ␴28 (␴28EC)-dependent promoter of fliC (PfliC), the flagellar filament gene, in vitro (49). However, ␴28Ct was unable to restore the motility to an E. coli mutant defective in the ␴28 structural gene fliA. These results suggest that ␴28Ct recognizes a subset of ␴28EC-dependent promoters but not the promoters of all genes that are required for motility in E. coli. Because it is not possible to study chlamydial ␴ factor specificity in Chlamydia in vivo, we have taken advantage of the different ways that ␴28Ct is able to recognize different ␴28EC promoter sequences in order to characterize the range of promoter elements that may be recognized by ␴28Ct and to identify potential upstream enhancing elements. By microarray analysis and sequence analysis, we report that RNAP containing ␴28Ct (RNAP-␴28Ct) shares a basic promoter recognition capability with that of RNAP containing ␴28EC (RNAP-␴28EC). However, we also found, as we predicted, that not all ␴28EC promoters are recognized by ␴28Ct. Specifically, ␴28EC promoters recognized by ␴28Ct tend to have an AT-rich sequence upstream of the ⫺35 promoter element. We confirmed many of our in vivo findings with E. coli by in vitro transcription studies with the chlamydial ␴28Ct-dependent hctB promoter

49 49 49 49 49 This study This study This This This This This This 53

study study study study study study

49 This 49 This This This This This This

study study study study study study study

This study This study This study This This This This This

study study study study study

and selected ␴28EC-dependent promoters. We also demonstrated by in vitro transcription analysis that ␴28Ct tolerates greater variation in spacer lengths between the ⫺10 and ⫺35 regions of the hctB promoter than does ␴28EC. MATERIALS AND METHODS Bacterial strains and growth conditions. C. trachomatis strain F/IC-Cal-3 (ATCC VR-346) was propagated in mouse fibroblast L929 (ATCC CCL-1) suspension cultures. EBs were purified by centrifugation through discontinuous Renografin (E. R. Squibb & Sons, Princeton, NJ) as described previously (49). E. coli TOP10 (Invitrogen) was used in cloning experiments. The E. coli strain YK4104 (F⫺ araD139 lacU139 rpsL thi pyrC46 gyrA thyA his fliA) (gift from Robert Macnb, Yale University) (27) was used for complementation studies of the ␴28 structural gene fliA. E. coli strains were routinely grown in Luria-Bertani (LB) medium supplemented with appropriate antibiotics. Plasmids construction. Plasmids used in this study are listed in Table 1. Oligonucleotides containing target sequences and cloning sites were synthesized by Invitrogen (Carlsbad, CA). Promoter activity in E. coli was assessed using a promoter-probe vector, pCG (Fig. 1), which carries a promoter-less cat-gfp operon. Two cloning strategies were used. First, the promoter regions of chlamydial hctB (PhctB) and groE (PgroE) were amplified by PCR using PfuUltra high-fidelity DNA polymerase (Stratagene, La Jolla, CA). Genomic DNA from purified EBs of C. trachomatis F/IC-Cal-13 was used as a template for PCR. The PCR product was digested with BamHI and EcoRV and then cloned into pCG through BamHI and EcoRV sites. In the second strategy, the promoter regions

7366

SHEN ET AL.

FIG. 1. pCG vector for assaying in vivo promoter activity. pCG is a derivative of pRV1 (50). The PvuI/AvaI fragment, which contains rrnB T1 multiple cloning sites (MCS), chlamydial tuf ribosomal binding site 1 (RBS1), and the reporter cat gene from pRV1, was ligated with the PuvI/AvaI fragment of pBR322, which contains the ColE1 replication origin and rop, resulting in pRVB. pRVB was then modified by (i) replacement of the MCS; (ii) insertion of an enhanced E. coli RBS (RBS2), an improved gfp gene, encoding GFP (36), and the second reporter gene directly downstream of the cat gene; and (iii) addition of a synthetic spf terminator (spfT) downstream of the gfp gene, creating pCG. Thus, pCG contains the MCS convenient for cloning test promoters, promoterless cat-gfp, the ColE1 replicon, a bla gene allowing ampicillin selection, the transcriptional terminator rrnB T1, preventing readthrough into the cat-gfp operon, and spfT, preventing interference from opposing transcription. The sites used for cloning test promoters in this study are underlined.

of the E. coli flgK, ycgR, tar, or groE gene (PflgK, PycgR, Ptar, or PgroEEc, respectively) were separately generated by annealing two complementary oligonucleotides, which were designed to incorporate XbaI restriction sites near the 5⬘ end and a blunt end near the 3⬘ end. The annealed double-stranded DNA was inserted into pCG at the XbaI and EcoRV restriction sites. The resulting constructs contained the different promoters upstream of the cat-gfp reporter genes. Plasmids used for in vitro transcription analysis were constructed by inserting the annealed double-strand DNA fragments, which contained wild-type or mutant promoter regions, into the XbaI and EcoRV sites of pGLC (49) or pMT504 (53). The resulting constructs each contained a test promoter and an internal control promoter (E. coli PfliC in pGLC derivatives and the chlamydial rRNA P1 in pMT504 derivatives) (Table 1). The final cloned inserts were confirmed by restriction mapping and nucleotide sequencing. The expression plasmids pLF28 and pLE28, which encode ␴28Ct and the ␴28EC, respectively, were described previously (49). RNA extraction and gene array chip hybridization. Total RNA was isolated from cells grown in LB medium supplemented with 0.02% (wt/vol) arabinose at 30°C using the QIAGEN RNeasy kit (QIAGEN, Valencia, CA). RNA concentrations were determined spectrophotometrically at 260 nm. The E. coli GeneChip antisense genomic array (Affymetrix, Clara, CA) with oligonucleotides representing 4,200 E. coli open reading frames and 1,350 intergenic sequences was used for analysis of mRNA expression profiles according to the specifications of the manufacturer. Briefly, cDNA was prepared from 10 ␮g of total RNA through randomly primed reverse transcription using SuperScript II (Invitrogen, Carlsbad, CA). The cDNA was purified using a QIAquick PCR purification column (QIAGEN, Valencia, CA) and then fragmented to a size range of 50 to 200 bases by treatment with DNase I (1 U/␮g cDNA) at 37°C for 10 min. Inactivation of the enzyme followed (98°C for 10 min). Fragmented cDNA was biotin labeled using an Enzo BioArray terminal labeling kit with biotin-ddUTP (Enzo Scientific, Farmingdale, NY). Biotinylated cDNA was hybridized to Affymetrix E. coli antisense genome arrays on a rotor (60 rpm) for 16 h at 45°C.

J. BACTERIOL. The chips were washed, stained, and scanned the following day according to the Affymetrix microarray protocol. Sequences and computational analyses. The E. coli K-12 genomic sequence (2) was obtained from GenBank (accessionr no. NC0009134). To define genes that are likely to be in the same transcription unit (TU) (under the control of a common promoter), the genes were grouped as a TU by using the E. coli transcription regulatory databases, called RegulonDB (http://regulondb.ccg .unam.mx/index.html) (46) and EcoCyc (http://EcoCyc.org) (24). C. trachomatis D/UW-3/Cx genomic sequences (52) were obtained from STD Sequence Databases (http://www.stdgen.lanl.gov/). DNA motif searches were performed using BioProspector (http://robotics.stanford.edu/⬃xsliu/BioProspector/) (30). Signal intensities for each feature on the microarrays were subjected to quantile normalization (3). Only features with a minimum signal intensity of 100 pixels in the high-voltage scan were considered for further analysis. Results from three independent experiments were averaged for each strain. The accuracy and statistical significance of the expression profiles were determined by analysis of variance (http://lgsun.grc.nia.nih.gov/ANOVA/). Differentially expressed genes were selected based on false discovery rates (FDRs) of ⱕ0.05 (significant) (FDR ⫽ P ⫻ n/rank, where P is the P value, n is the total number of genes, and rank is the rank of a gene ordered in increasing P values) and a change in expression level (n-fold) of ⱖ3 for the first gene in a TU. Genes with an FDR value of ⬎0.05 were not considered to be regulated and were assigned not significant status, regardless of their differential expression levels. Determination of promoter activity in E. coli. In vivo promoter activity was determined by measurement of the chloramphenicol (CAT) and green fluorescent protein (GFP) reporter genes in an E. coli fliA mutant strain, YK4104. This strain does not encode a functional ␴28 due to a frameshift mutation in the fliA open reading frame (38). Cells harboring an appropriate plasmid(s) were grown overnight in LB medium supplemented with 0.4% (wt/vol) glucose at 30°C. Cultures were diluted 1:100 in fresh LB medium to an optical density at 600 nm (OD600) of 0.3, and then the expression of ␴28Ct or ␴28EC was induced by adding 0.02% (wt/vol) arabinose to the culture. To quantify the fluorescence intensity of GFP expressed in E. coli, 200-␮l portions of cultured cells were collected at different times, washed once with 0.1 M phosphate-buffered saline (pH 7.4), resuspended in 100 ␮l phosphate-buffered saline, and subjected to fluorescence examination in a 96-well plate (Costar, Corning, NY) using a fluorescence microplate reader GENios (TECAN, Grodig/Salzburg, Austria). Cell densities at 600 nm were also determined. The relative fluorescence unit (RFU) was used as a measure of GFP expression [RFU ⫽ ¦(fluorescence intensity of test strains ⫺ fluorescence intensity of the strain carrying pCG)¦/¦(OD600 of test strain ⫺ OD600 of strain carrying pCG)¦, where pCG contained cat-gfp lacking a promoter and was used as the intrinsic background fluorescence control]. CAT assays were carried out as described previously (50). Determination of promoter activity in vitro. N-terminally His-tagged ␴28Ct and ␴28EC were purified as described after overexpression in E. coli YK4104 from the vectors pS28H and pES28H (49), respectively. RNAP holoenzyme containing ␴28 (RNAP-␴28Ct or RNAP-␴28EC) was made by addition of a fourfold excess of purified ␴28Ct or ␴28EC to E. coli RNAP core enzyme (Epicenter, Madison, WI). Holoenzyme saturated with E. coli ␴70 (RNAP␴70) was purchased from Epicenter. To allow for open-complex formation, assays were carried out by preincubating RNAP holoenzyme (20 nM) with pGLC or pMT504-derived supercoiled plasmid DNA (Table 1) (1 ␮g) in buffer (10 mM Tris-HCl, pH 8.0, 200 mM NaCl, 5 mM dithiothreitol) for 5 min at 37°C. Transcription was initiated by adding 400 ␮M ATP, 400 ␮M UTP, 1.2 ␮M CTP, 0.20 ␮M [␣-32P]CTP (3,000 ␮Ci/mmol), 100 ␮M 3⬘-Omethylguanosine 5⬘-triphosphate (Amersham Pharmacia Biotech), and 100 ␮g/ml heparin. Reaction mixtures were incubated for 15 min at 37°C, and reactions were stopped by the addition of a solution of 95% (vol/vol) formamide, 0.025% (wt/vol) xylene cyanol, 0.025% (wt/vol) bromophenol blue, and 0.5 mM EDTA (pH 8.0). Transcripts made by RNAP were detected using 6% (wt/vol) polyacrylamide–7 M urea in polyacrylamide gel electrophoresis. Signal intensities from autoradiographs were determined with Bio-Rad Quantity One software (Bio-Rad, Hercules, CA). Primer extension analysis. Primer extension analysis was performed as described previously (50). Primer hctB-pe1 (5⬘-TCTTGTGCTGCATTTCTTTTG T-3⬘) was labeled with [␣-32P]ATP (Amersham Biosciences, Piscataway, NJ) using T4 polynucleotide kinase (New England Biolabs, Beverly, MA) and annealed with total RNA isolated from E. coli YK4104 carrying plasmid pPhctB::catgfp and pLF28 or pLE28. The primer was extended with reverse transcriptase (Promega, Madison, WI) at 42°C for 1 h, and the products were subjected to electrophoresis on a DNA sequencing gel. A comparison DNA

PROMOTER RECOGNITION BY CHLAMYDIAL ␴28 RNA POLYMERASE

VOL. 188, 2006

7367

TABLE 2. Cluster A genes upregulated by ␴28Ec and ␴28Ct Transcription unita

Transcription ratiob Gene

Function

␴28Ec/pLC3

␴28Ct/pLC3

fliC

68.046

14.365

Flagellin, filament structural protein

fliD-fliS-fliT

fliD fliS fliT

30.346 22.055 14.194

3.181 2.934 2.882

Flagellin, enables filament assembly Repressor of class 3 operons Repressor of class 3 operons

flgM-flgN

flgM flgN

23.431 11.679

22.065 11.008

Anti-FliA, anti-sigma factor Protein of flagellar biosynthesis

flgK-flgL

flgK flgL

18.720 25.817

19.925 30.061

Hook-filament junction protein Hook-filament junction protein

ycgR

ycgR

10.032

16.638

Hypothetical protein

yjdA yjcZ

38.842 5.092

22.019 3.694

Hypothetical protein (YjdA) Hypothetical protein

flxA

flxA

30.960

12.277

Hypothetical protein

ykfB

ykfB

16.263

9.590

Hypothetical protein

yfiD

yfiD

7.328

4.709

Alternate pyruvate formate lyase subunit

Known flagellar genes fliC

Other genes yjdA-yjcZ

a

Upregulated genes are in bold type. b Transcription ratios of the genes in a ␴28Ct- or ␴28Ec-expressing E. coli strain versus that in the vector-carrying strain.

ladder that was generated with the same primer using a DNA sequencing kit (USB Corporation, Cleveland, OH) was used as a control.

RESULTS Comparative transcription profiles of ␴28-dependent genes in E. coli. E. coli strain YK4104, which is defective in the ␴28 structural gene (fliA), was transformed with pLF28 (containing rpsD, the gene encoding ␴28Ct), pLE28 (containing fliA, the gene encoding ␴28EC), or pLC3 (the empty vector). Sigma factor gene expression was induced by the addition of arabinose, and total RNA was isolated and used for microarray analysis of the E. coli genome. Specific transcript levels from the ␴28-expressing cells were compared with that from pLC3carrying cells (i.e., transcription ratios, ␴28Ct/pLC3 versus ␴28EC/pLC3) to determine the influence of plasmid-encoded ␴28 upon transcription. We found 26 genes/operons (referred to herein as TUs) to be significantly upregulated by ␴28EC and 15 TUs to be significantly upregulated by ␴28Ct (see Materials and Methods for the criteria for significance). The TUs upregulated following the expression of ␴28 were clustered into three groups: cluster A, upregulated by both ␴28Ct and ␴28EC (Table 2); cluster B, upregulated only by ␴28EC (Table 3), and cluster C, upregulated only by ␴28Ct (Table 4). Thirteen genes in nine TUs were upregulated by both ␴28Ct and ␴28EC, most of which showed higher transcription ratios in the ␴28EC-expressing strain than in the ␴28Ct-expressing strain (Table 2). Of the genes recognized by both ␴28EC and ␴28Ct, eight have been identified previously as members of the class 3 flagellar regulon that is controlled by ␴28EC; these genes are involved in the late stage of flagellar assembly in a hierarchical regulatory cascade in E.

coli (7, 14, 25). Genes recognized by ␴28EC but not by ␴28Ct included 14 class 3 and 7 class 2 flagellar genes, which are controlled by both FlhD/FlhC proteins (the master regulator) and ␴28EC and encode components required for the early phase of flagellar assembly (7, 19, 31). Analysis of the putative DNA recognition sites by ␴28Ct in E. coli. We investigated potential conserved DNA elements upstream of ␴28-upregulated genes in E. coli. To do so, 300 bp of sequence immediately upstream of the ATG start codons of the first gene in each predicted TU was retrieved to construct sequence sets that were likely to contain regulatory elements. Almost all of the known regulatory sites in E. coli K-12 are located within this range (6). Using the motif search program BioProspector (30), we conducted a de novo search for motifs that contained two 8-bp blocks separated by a gap ranging from 10 to 14 bp within the sequence sets, as ␴28EC recognizes promoters with a consensus of TAAAGTTT-N11-GCCG ATAA (18). The highest-scoring motif was found to be TAA AGTTT-NX-GCCGATAA. This motif is preceded by seven of the nine TUs in cluster A (Table 2), including the five flagellum genes, flxA and ykfB (not known to be a ␴28-activated gene), and 9 of 17 TUs in cluster B (Table 3), including 8 flagellar TUs and modA-modB-modC, which has a ␴28-like promoter that has not been experimentally confirmed (40). The sequence identified upstream of ykfB is TGATGAAT-N12GCCGATAA, which matches 4 of the 8 bp in the consensus ⫺35 box and perfectly matches the ⫺10 box but has a 12-bp spacer instead of the canonical 11-bp spacer. We were unable to identify a TAAAGTTT-NX-GCCGATAA motif in the upstream sequence regions of cluster C genes. From the 26 TUs that are significantly induced by ␴28EC

7368

SHEN ET AL.

J. BACTERIOL. TABLE 3. Cluster B genes upregulated by ␴28Ec only Transcription ratiob (␴28Ec/pLC3)

Function(s)

fliA fliY fliZ

171.87 42.707 5.453

FliA, sigma 28 factor Possible cell density-responsive regulator Putative periplasm-binding transport protein

tar-tap-cheR-cheB-cheY-cheZ

tar tap cheR cheB cheY cheZ

23.378 33.558 6.437 11.395 13.858 18.823

Methyl-accepting chemotaxis protein II Methyl-accepting chemotaxis protein IV Response regulator for chemotaxis Response regulator for chemotaxis Chemotaxis regulator Chemotaxis protein

motA-motB-cheA-cheW

motA motB cheA cheW

14.025 32.779 13.633 9.598

Proton conductor component of motor Flagellar motor rotation Sensory transducer kinase Chemotaxis protein, regulation

yhjH

yhjH yhjG

22.024 4.105

Flagellar-function protein Hypothetical protein

aer

aer

8.553

Aerotaxis sensor receptor, flavoprotein

trg

trg

6.088

Methyl-accepting chemotaxis protein

fliL-fliM-fliN-fliO-fliP-fliQ

fliL fliM fliN

6.008 3.273 4.415

Flagellar biosynthesis Flagellar motor switch protein Flagellar motor switch protein

trs

tsr

5.642

Methyl-accepting chemotaxis protein

Transcription unita

Known flagellar genes fliA-fliY-fliZ

Other genes ynjH

Gene

ynjH

23.436

modA-modB-modC

modA modB

9.975 4.227

Molybdate ABC transporter Molybdate ABC transporter

b1742 (ves)

ves

9.763

Cold-induced member of the CspA family

yfiA

yfiA

6.624

Stationary-phase translation inhibitor

galE-galT-galK-galM

galK

6.012

Galactokinase

b1345-ydaQ

b1345

4.902

Putative transposase

ompF

ompF

4.735

Outer membrane protein

araC

araC

4.265

AraC transcriptional dual regulator

uspA

uspA

4.081

Universal stress protein, regulator

a b

Hypothetical protein

Upregulated genes are in bold type. Transcription ratio of the genes in a ␴28Ec-expressing E. coli strain versus that of the vector-only control strain.

(Tables 2 and 3), we found 14 that contained experimentally verified ␴28EC-dependent promoters (14, 18, 25, 31) (Fig. 2). Two highly conserved regions resembling the reported consensus ⫺35 and ⫺10 elements (18) were observed. We next investigated the adenine (A) and thymine (T) content 30 bp immediately upstream of the ⫺35 element from each of the 14 genes in an attempt to identify potential upstream elements, which enhance transcription initiated by some ␴ factors (13, 43). Using Spearman’s correlation test we found that the correlation between the AT content and the transcription levels directed by ␴28Ct for these genes was 0.6697, with a P value of

0.0063 (significant). In contrast, the correlation between the AT content and the transcription levels directed by ␴28EC is 0.4206, with a P value of 0.119 (insignificant). This suggested that ␴28Ct-directed transcription might be influenced by ATrich sequence features upstream of the ⫺35 element of the promoter. To further characterize the effect of the upstream AT-rich sequences on selective ␴28Ct-dependent transcriptional activation, we divided the 14 experimentally confirmed ␴28EC-dependent genes into two additional subsets (Fig. 2): subset 1 contains genes that were significantly upregulated by both ␴28EC

PROMOTER RECOGNITION BY CHLAMYDIAL ␴28 RNA POLYMERASE

VOL. 188, 2006

7369

TABLE 4. Cluster C genes upregulated by ␴28Ct only Transcription unita

Gene

Transcription ratiob (␴28Ct/pLC3)

Function(s)

melR ynaF (uspF) groES malK-lamB-malM

melR ynaF groES malK lamb yfcZ yeiY

6.518 5.168 5.064 4.948 4.411 3.591 3.098

Transcriptional dual regulator Stress-induced protein, ATP-binding protein GroES, 10-kDa chaperone Maltose ABC transporter Maltose high-affinity receptor Conserved hypothetical protein Putative dihydrothymine dehydrogenase

yfcZ yeiY a b

Upregulated genes are in bold type. Transcription ratio of the gene in a ␴28Ct-expressing E. coli strain versus that in the vector-carrying strain.

and ␴28Ct, and subset 2 contains genes that were upregulated by ␴28EC but were relatively unaffected by ␴28Ct. Two statistical tests were used to address the question of whether or not the two subsets have different AT contents. The two-sample t test gave a P value of 9e-5 (significant), and the Wilcoxon rank sum test gave a P value of 8e-4 (significant). These results further suggest that an upstream AT-rich sequence in the promoter region might be favorable for selective transcription activated by ␴28Ct compared to that activated by ␴28EC. These observations raised three questions that we sought to further address experimentally. (i) Was the observed increase in ␴28Ct-dependent transcription due to recognition of specific promoter sequences by ␴28Ct? (ii) Did RNAP-␴28Ct initiate transcription from an authentic transcription start site in E. coli? (iii) What promoter configuration, including upstream elements and ⫺35 and ⫺10 spacer lengths, is preferentially recognized by ␴28Ct? RNAP-␴28Ct recognizes specific promoters in E. coli. We attempted to confirm the promoter activities of three ␴28EC TUs (PflgK, PycgR, and Ptar) identified in our microarray assay, as well as the ␴28Ct-dependent promoter from the one known chlamydial ␴28Ct-dependent gene, hctB (PhctB) (58). We selected PflgK and PycgR because they contain consensus-like core promoter elements and were positive in our microarray assay when both ␴28Ct and ␴28EC were expressed in E. coli. In contrast, we selected Ptar because it contains a consensus core element but was negative in the microarray assay with ␴28Ct. We also tested PgroEEc, because expression of the groE gene, which is recognized by ␴32EC and lacks a ␴28 core element, was increased in the ␴28Ct-expressing strain by microarray analysis but not in the ␴28EC-expressing strain. As a control, we analyzed the ␴66-dependent promoter from the chlamydial groE gene (PgroE) (55). Promoter activity was measured in vivo using the cat-gfp-based reporter system by cloning each promoter into the cat-gfp plasmid pCG (Fig. 1). pCG contains a multiple cloning site sandwiched between the transcriptional terminator rrnB T1, preventing readthrough into the cat-gfp operon, and spfT, preventing interference from opposing transcription (Fig. 1). In control experiments (data not shown), no fluorescence or chloramphenicol resistance was noted in strains carrying the empty vector pCG. Following the induction of ␴28Ct by the addition of arabinose to the media, constant increases in the GFP fluorescence levels were observed over 8 h for all promoters tested, although the increase of Ptar was barely detectable (Fig. 3a). The promoter sequences tested are listed in Fig. 4a. Increases were also noted

in strains that harbored both pLE28 (fliA⫹) and each of above promoter fusions (Fig. 3a). To assess the specific effect of ␴28EC and ␴28Ct on transcription, GFP expression was examined at the 4-h time point with and without the addition of arabinose (Fig. 3b). Consistent with the known promoter specificities (␴66 for PgroE and ␴32 for PEgroE), the groE promoters did not show significantly increased transcription upon induction of the ␴28 genes; presumably, expression was driven by chromosomally encoded ␴ factors in E. coli strain YK4104. GFP expression from PhctB, PycgR, and PflgK was significantly increased following the induction of both ␴28Ct and ␴28EC, clearly demonstrating ␴28 recognition of these promoters with consensus-like sequences. In contrast, GFP expression from Ptar was insignificant following the induction of ␴28Ct but significant following the induction of ␴28EC (Fig. 3b). Our GFP expression data mirrored our microarray data, except with PgroE, which was positive by microarray analysis but negative by GFP analysis with ␴28Ct. The expression of CAT was also measured, and the levels correlated well with the levels of GFP expression (data not shown). We performed in vitro transcription assays to test the activities of the six promoters described above (Fig. 4a) in the presence of RNAP holoenzyme but in the absence of any additional factors that might be present in whole E. coli cells. RNAP holoenzyme was made with E. coli core enzyme and recombinant ␴28Ct or ␴28EC. Transcription experiments were performed three or more times for each promoter; the results of a representative experiment are shown in Fig. 4b. Activity was not detected when either ␴28Ct or ␴28EC was omitted from the reaction mixture (not shown). To estimate the comparative in vitro activities of the test promoters, we normalized the amount of transcript generated by a test promoter to that of the PfliC transcript. Neither chlamydial PgroE nor E. coli PgroE was stimulated by RNAP-␴28Ct or RNAP-␴28EC in the in vitro reaction (Fig. 4b). These results indicate that neither ␴28Ct nor ␴28EC displayed overlapping recognition of ␴66Ct- and ␴32ECdependent promoters; they were consistent with results of the GFP reporter assay but were inconsistent with our observations from the microarray assay. RNAP-␴28Ct was transcribed efficiently from chlamydial PhctB, despite the presence of a suboptimal 12-bp spacer and two substitutions from the ␴28EC consensus in the ⫺10 region (C3T at position ⫺14 and A3G at position ⫺8) (Fig. 4b). Based on a PhctB/PfliC ratio of ⬎1, we conclude that PhctB is the stronger of the two promoters. RNAP-␴28EC also initiated transcription more efficiently from PhctB than from PfliC (Fig.

7370

SHEN ET AL.

J. BACTERIOL.

FIG. 2. Sequence alignments and subsets of promoters from upregulated genes in E. coli. (a) Subset 1 promoters that were significantly upregulated by both ␴28EC and ␴28Ct. AT-rich sequences are present upstream of the ⫺35 regions that center mainly at ⫺41, ⫺51, and ⫺56. (b) Subset 2 promoters that were upregulated by ␴28EC only. In this subset, a lower AT content was observed upstream from the ⫺35 region. The results are also shown as logos in which the heights of the letters in bits are proportional to their frequencies. Logos were generated by Weblogo (http://weblogo.berkeley.edu/logo.cgi). For ease of interpretation, the promoter sequences are numbered from the ⫹1 position of the fliC promoter (in bold and italics) and aligned according to their ⫺35 boxes. The regions of high homology (⫺35 and ⫺10) are highlighted in red, green, blue, and black. The AT contents of the 30-bp sequence immediately upstream of ⫺35 (⫺65 to ⫺37) are shown at the right.

4b). E. coli Ptar was strongly activated by RNAP-␴28EC (Ptar/ PfliC ratio, ⬎1) but weakly stimulated by RNAP-␴28Ct (Ptar/PfliC ratio, ⬍1). Transcription from PycgR, which has partial homology to the ␴28 ⫺35 and ⫺10 consensus sequences, was very weak with ␴28EC and only slightly above the Ptar level with ␴28Ct. Transcript initiation from PflgK was good in the presence of RNAP-␴28Ct but was weak in the presence of RNAP-␴28EC. Our in vitro transcription studies indicate that transcripts initiating from the chlamydial PhctB and the E. coli PycgR and PflgK promoters are directly controlled by ␴28. The failure of ␴28Ct to

efficiently initiate transcription from Ptar, which includes the consensus ⫺35 and ⫺10 elements, suggests that that sequence, in addition to the core element, may be required for efficient ␴28Ct transcription. RNAP-␴28Ct utilizes an authentic transcription initiation site in E. coli. In a previous study, we have demonstrated that hybrid RNAP-␴28Ct and RNAP-␴28EC initiated transcription in vitro from the E. coli fliC gene at identical transcription start sites (49). Here we address whether hybrid RNAP-␴28Ct initiates transcription in E. coli using an authentic transcription

VOL. 188, 2006

PROMOTER RECOGNITION BY CHLAMYDIAL ␴28 RNA POLYMERASE

7371

FIG. 3. Measurements of GFP levels associated with different promoters. (a) Variation of GFP levels expressed from different transcriptional cat-gfp fusion plasmids in the E. coli strain coharboring plasmid-encoded ␴28Ct (left) or ␴28EC (right). (b) Effect of ␴28Ct or ␴28EC on the expression of promoter-driven GFP levels after a 4-h addition of arabinose (ara⫹) or without inducer (ara⫺). Numbers of RFUs were taken as the measurement of GFP levels. RFU ⫽ ¦(fluorescence intensity of test strains ⫺ fluorescence intensity of strain carrying pCG)¦/¦(OD600 of test strain ⫺ OD600 of strain carrying pCG)¦, where pCG containing a promoterless cat-gfp operon was used as the intrinsic background fluorescence control. *, t tests give a P value of ⬎0.05 (insignificant).

start site in the chlamydial hctB gene. The 5⬘ end of the mRNA derived from the hctB gene was determined by primer extension analysis of total RNA extracted from E. coli strain YK4104, which carries pLF28 (rpsD⫹) and pPhctB::cat-gfp. When expression of ␴28Ct was induced with arabinose, the 5⬘ end of the hctB fusion transcript was mapped to an adenine residue (103 bp upstream of the AUG codon of the cat gene) (Fig. 5). This start site coincides with the one previously identified in C. trachomatis serovar L2 (5), indicating that ␴28Ct recognizes the chlamydial PhctB promoter in E. coli, which is similar to that in Chlamydia. A similar primer extension analysis indicated that RNAP-␴28EC recognizes the same start site when initiating transcription from PhctB (Fig. 5). The presence of AT-rich sequences located upstream of the ⴚ35 region favors ␴28Ct activation. In silico analysis suggested that the level of ␴28Ct-directed transcription might be positively associated with the AT-rich sequences upstream of the ⫺35 element in ␴28EC-dependent promoters (Fig. 2). Chlamydial PhctB is a strong promoter (Fig. 3 and 4) and is enriched in A and T residues upstream of its ⫺35 element. These AT-rich sequences are also present in other hctB genes from different

species of Chlamydia (not shown). We therefore examined the contribution of these AT-rich sequences to ␴28Ct-specific transcription in vitro using derivates of pGPhctB that carried the PhctB core promoter (⫺37 to ⫹5 sequences) with or without its native AT-rich upstream sequences (⫺65 to ⫺38) (Fig. 6a). Because this assay excludes factors other than RNAP, the resultant transcript should reflect the direct interaction between RNAP-␴28 and the promoter. We constructed pGPhctB⌬UP, containing only the core promoter of PhctB, and pGPhctB-2, containing the sequence from ⫺65 to ⫺38 of the Ptar promoter (CG-rich sequences) fused to the core promoter of PhctB (Fig. 6a). In the presence of RNAP-␴28Ct, the relative levels of transcript initiating from mutant PhctB and PhctB-2 were sharply reduced (PhctB/PfliC ratio, ⬍1; PhctB-2/PfliC ratio, ⬍1), compared to that from PhctB (PhctB/PfliC ratio, ⬎1), where native ⫺65 to ⫺38 sequences of hctB were present (Fig. 6b, upper panel). Diminished transcription from mutant PhctB and PhctB-2 was also observed when RNAP-␴28EC was used. The effects were smaller than with RNAP-␴28Ct (Fig. 6b, lower panel). To investigate whether the ⫺65 to ⫺38 region of PhctB func-

7372

SHEN ET AL.

J. BACTERIOL.

FIG. 4. In vitro activities of ␴28-dependent promoters. (a) Promoter sequences inserted into the test vector. (b) Gel analysis of the in vitro transcription products using RNAP-␴28Ct (upper panel) or RNAP-␴28EC (lower panel). Supercoiled DNA templates used in this experiment are indicated on the top of each lane. The RNAP holoenzymes used are indicated on the left. Note that all transcripts were generated from the same starting amount of DNA template and run in parallel on the same gel. The ratios between the amounts of the test promoter and control promoter transcripts (Ptest/PfliC) are indicated and were used to normalize the data.

tioned independently away from its native core element, we placed these AT-rich sequences upstream of the core promoter of ␴28EC-dependent Ptar to construct pGPtar⫹. The hybrid promoter, Ptar⫹, was considerably more responsive to RNAP␴28Ct stimulation than the native promoter, Ptar (Fig. 6c, upper panel). This observation suggests that the poor expression from native Ptar in our microarray and GFP reporter assays, in spite of the presence of a consensus core element, may be due to the absence of an upstream AT-rich sequence. Only a slight increase of transcription level stimulated by RNAP-␴28EC was observed at Ptar⫹ (Fig. 6c, lower panel). Similarly, we fused the sequence from ⫺65 to ⫺38 of PhctB to the core promoter of PlacUV5, which is ␴70EC dependent and lacks AT-rich enhancer sequences (UP element) (43), to generate pGPlaUV5⫹. In the presence of RNAP-␴70EC, we found over a twofold increase in transcription from PlacUV5⫹ compared to that from native PlacUV5 (Fig. 6d), suggesting that the ⫺65 to ⫺38 sequences of PhctB also had an enhancing effect within the context of core PlacUV. It is unclear why the AT-rich hctB sequence had a greater effect on Ptar than on PlacUV. RNAP-␴28Ct tolerates an altered spacer length between the ⴚ10 and ⴚ35 elements. By microarray and sequence analysis, an ␴28EC promoter-like ykfB promoter with a 12-bp spacer was identified in E. coli, although the known ␴28EC-dependent promoters contain 11-bp spacers (18, 40). RNAP-␴28Ct was able to initiate transcription from PykfB efficiently in vitro, while RNAP-␴28EC was only slightly transcribed from PykfB (data not

shown). This suggested that ␴28Ct and ␴28EC may differ in recognizing promoters with an altered length of the spacer. To test this hypothesis, we systemically analyzed how a change in spacer length affected the RNAP promoter interactions with chlamydial PhctB that ordinarily has a 12-bp spacer between its ⫺35 and ⫺10 elements (58). We examined variants of pGPhctB, where the ⫺10 and ⫺35 regions of PhctB were kept constant while the lengths of spacers varied from 9 to 14 bp (Fig. 7a). RNAP-␴28Ct was able to transcribe from PhctB variants with spacers ranging from 9 to 14 bp (Fig. 7b, upper panel). A relative increase in transcription level was observed from the promoter with an 11-bp spacer, suggesting that the optimal spacing for the recognition of PhctB by RNAP-␴28Ct may be 11 bp, similar to what occurs with ␴28EC-dependent promoters (18). Although the levels of transcription dropped using templates with 9-, 10-, 13-, and 14-bp spacers, the levels stimulated by RNAP-␴28Ct were still higher than those from PfliC. RNAP-␴28EC transcribed variants of PhctB with 10-, 11-, 12-, and 13-bp spacers (Fig. 7b). The level of transcription initiating from the promoter with the 11-bp spacer was similar to that using the native 12-bp spacer. An obvious decrease in transcript levels was observed using templates with 10- or 13-bp spacers. Compared to RNAP-␴28Ct, RNAP-␴28EC failed to stimulate a promoter with a larger (14-bp) or smaller (9-bp) spacer (Fig. 7b). This suggests that RNAP-␴28Ct may have greater flexibility in recognizing and stimulating a modulated promoter DNA structure.

PROMOTER RECOGNITION BY CHLAMYDIAL ␴28 RNA POLYMERASE

VOL. 188, 2006

7373

FIG. 5. Mapping of the 5⬘ end of hctB mRNA. (a) Sequence of the regulatory region of the chlamydial hctB gene. (b) Primer extension analysis. Total RNA extracted from E. coli YK4104 harboring pLF28 plus pPhctB::cat-gfp (lanes 1 and 2) and harboring pLF28 plus pPhctB::cat-gfp (lanes 3 and 4) were used. Transcripts were detected after induction with arabinose (lanes 2 and 4) or repression with glucose (lanes 1 and 3). A DNA sequencing ladder (lanes A, C, G, and T) was prepared using pPhctB::cat-gfp (Table 1). The transcription start site (⫹1) is as indicated. The ⫺10 and ⫺35 regions of the promoter sequence are underlined and in boldface type.

DISCUSSION The ␴ protein plays a pivotal role in flagellin biosynthesis and chemotaxis in E. coli and Salmonella (7, 28, 31); however, chlamydiae are not motile. In other bacteria, ␴28 recognizes the promoters of genes involved in many functions, including sporulation and the response to certain forms of stress, but orthologous genes are not present in Chlamydia, and the role of ␴28 in Chlamydia is not obvious. One chlamydial gene, hctB, has been demonstrated by in vitro transcription analysis to possess a promoter recognized by ␴28Ct (58). The hctB gene is expressed late in the cycle, but many other late genes are dependent on the major ␴ factor ␴66 for initiation of transcription (12). The hctB gene promoter strongly resembles the E. coli ␴28 consensus; however, it is not clear what range of core promoter sequences and what other regulatory elements might be recognized by RNAP-␴28Ct. In the absence of a tractable genetic system in Chlamydia, we took four experimental approaches to identify potential promoter elements that might be recognized by ␴28Ct. The first approach, in which we used microarray-based transcriptional analysis, allowed us to examine the entire E. coli genome (four times the size of the chlamydial genome) for promoters recognized by ␴28Ct in this heterologous system. We found 15 TUs that appeared to be activated by ␴28Ct (Tables 2 and 4), nine of which were also upregulated upon the induction of ␴28EC (Table 2) and six of which were not upregulated by ␴28EC (Table 4). We also found 17 TUs that were upregulated by ␴28EC but were not upregulated by ␴28Ct (Table 3, cluster B). We next 28

used a promoter probe vector, which isolated promoters from upstream and downstream transcripts, to confirm the promoter activities identified by microarray analysis (Fig. 3). Then, we analyzed selected promoters by in vitro transcription analysis, an approach that allowed us to determine the ability of RNAP␴28Ct to recognize promoter sequences in the absence of other factors that might influence gene expression in E. coli (Fig. 4). Last, we carried out mutational analysis of selected promoters to determine the effects of upstream sequence on core promoter recognition (Fig. 6) and ⫺35 to ⫺10 spacing (Fig. 7). We were surprised to find by microarray analysis E. coli groE and five other genes that were not upregulated by ␴28EC to be upregulated by ␴28Ct (Table 4). Previously, it has been reported that B. subtilis ␴28 shares overlapping promoter specificity with E. coli ␴32 and that B. subtilis ␴28 can use the E. coli ␴32-dependent promoter from the rpoD gene (4). In our studies, none of these genes possess ⫺35 and ⫺10 elements resembling the ␴28EC consensus, and our GFP and in vitro transcription analyses failed to confirm the ability of ␴28Ct to initiate transcription from one of these promoters, PgroEEc. It is possible that the observed upregulation of groE was not direct but was rather a response to stress induced by our experimental system and manipulations. It is not obvious why the other genes were upregulated; most likely the upregulation of these genes (and groE) is affected by the indirect influence of multiple regulatory networks in vivo. For this reason, we did not further analyze cluster C genes. In a recent study, we noted that ␴28Ct could complement an

7374

SHEN ET AL.

J. BACTERIOL.

FIG. 6. Effect of AT-rich sequences upstream of PhctB on transcription in vitro. (a) Sequences of test promoters. Sequences were aligned according to their ⫺35 boxes. Numbering of the upstream sequences of these promoters was done from the ⫹1 base (in bold and italics) that was determined for the native promoter of the hctB gene. The nonnative upstream sequences are shown in lowercase letters. mut, mutant. (b to d) Gel analysis of the in vitro transcription products from promoters that differ in their upstream sequences. (b) Derivatives of PhctB; (c) derivatives of Ptar; (d) derivatives of PlacUV5. The RNAP holoenzymes used are indicated on the left. Plasmid templates are shown on the top. Transcription ratios are shown below each lane. CtrRNA, C. trachomatis rRNA.

␴28EC-deficient mutant (fliA mutant) but did not restore motility in E. coli (49). From these observations, we speculated that ␴28Ct recognizes only a subset of ␴28EC promoters. Our microarray analysis confirmed this suspicion. Interestingly, two of the TUs not recognized by ␴28Ct are members of the class 2 flagellar regulon that requires additional transcriptional regulators for activation (7, 19, 31), factors that may not interact with RNAP-␴28Ct. In silico analysis revealed only minor differences in the core elements of the promoters recognized by ␴28Ct and ␴28EC (cluster A) and those recognized by ␴28EC but not by ␴28Ct (cluster B). Indeed, one of the promoters not recognized by ␴28Ct, Ptar, possesses perfect ␴28 ⫺35 and ⫺10

elements. This suggested to us that the context of the core elements is important for the interaction of RNAP-␴28Ct with promoters. Subsequently, we found that all of the upstream sequence of the known ␴28EC promoters in cluster A (Table 2 and Fig. 2) are AT rich (0.67 or higher) but that only two of the eight known ␴28EC promoters in cluster B (Table 3 and Fig. 2) had an AT content above 0.60; the AT content of poorly recognized Ptar was only 0.47. This observation raised the possibility that the AT-rich upstream sequence may enhance the function of RNAP-␴28Ct. DNA sequences upstream of ⫺35 elements can bind to the C-terminal domain of the RNAP ␣ subunit and are important

VOL. 188, 2006

PROMOTER RECOGNITION BY CHLAMYDIAL ␴28 RNA POLYMERASE

FIG. 7. Influence of altered spacer size on the transcription of chlamydial PhctB in vitro. (a) Derivatives of pGPhctB differing in spacer lengths are depicted. The wild-type ⫺10 and the ⫺35 regions are underlined. The short lines indicate deletion of residues. Inserted extra residues are indicated in lowercase letters. The transcription start sites at the ⫹1 positions are italicized and boldface. (b) Gel analysis of the in vitro transcription products using RNAP-␴28Ct (upper panel) or RNAP-␴28EC (lower panel).

for transcription initiation in bacteria (44, 45). These are named UP elements and may consist of a proximal and a distal subsite (11). The proximal subsite is more important in the stimulation of E. coli ␴70; the distal subsite favors selectivity of a general stress-responsive ␴ factor, ␴38 (11, 56). In Chlamydia, evidence supporting the existence of a UP element has been reported for the ␴66-specific chlamydial promoters rRNA P1 (54) and major outer membrane protein gene, omp1 (9). However, 14 of 19 known chlamydial ␴66 promoters have AT-rich sequences around the ⫺41 regions, and two of them have further upstream AT-rich sequences (16). Thus, frequencies of UP-like sequences are likely common in Chlamydia. Whether or not the AT-rich sequence in the cluster A genes functions as an UP element per se is not known and must be experimentally confirmed. In general, these AT-rich sequences do not resemble the E. coli consensus UP element (NNNAAAWWTWTT TTNNAAAANNN) (11), nor do they resemble the UP-like element sequence (TAGGGAAGTTGAGAAAAAATAG) located immediately upstream from the chlamydial rRNA operon ⫺35 element (53). However, at least three lines of evidence indicate a functional interaction between RNAP␴28Ct and the AT-rich sequences upstream of the ⫺35 element in the hctB promoter. First, deleting or exchanging the AT-rich elements with the UP-disparate sequences compromised hctB activity; second, fusing UP-like sequences to the “weak” promoters increased significantly their strength; and third, transcription analysis performed in vitro using RNAP in the absence of additional accessory factors reflected the direct interaction of RNAP holoenzyme and promoters. The presence and influence of UP elements have been found to be more significant in some bacteria than others (17). For example, a strong influence of an UP element was observed for

7375

␴28-specific promoters in B. subtilis (13), but little effect was observed on the ␴28-specific promoters in E. coli and Salmonella (18, 48). Chlamydial genomes contain about 59% AT (22, 42, 52), which is similar to that in B. subtilis (57%), whereas the E. coli K-12 genome has a lower (50%) AT content. It is not clear whether the difference in use of the UP element is related to the general AT contents in genomes from divergent bacterial species. We report here that RNAP-␴28Ct can tolerate variations in the spacer length of PhctB (Fig. 7), in contrast to what occurs with known RNAP-E␴28 promoters, which have an 11-bp spacer. It has been proposed that an optimal spacer length facilitates the spatial alignment of the ⫺10 and ⫺35 elements to accomplish binding to the 2.4 and 4.2 regions of the ␴ factor (8, 29). This may depend on the structure of the holoenzyme and vary across different organisms possessing different amino acid structures of RNAP subunits. Interestingly, promoters with different spacer lengths, such as the promoters for motA in Vibrio cholerae (9 bp) (41), the promoter for the flaA gene in Helicobacter pylori (10 bp) (21), and, here, Chlamydia PhctB (12 bp), have been identified in other bacteria. Our observation that RNAP-␴28Ct can potentially recognize a range of “suboptimal” spacer lengths in PhctB and yet maintain function implies a structural flexibility of the enzyme and an ability to undergo conformational transition. This could be a point of regulation, if subsets of ␴28Ct promoters with different spacers are somehow better recognized under different environmental conditions. The differences in levels of transcription activation by ␴28Ct and ␴28EC, as well as the failure of ␴28Ct to activate cluster B TUs, may result from different ␴28 protein levels, different ␴28 core enzyme binding affinities, or other steps in the transcription cycle. Conformational changes in the ␴ or core enzyme or both occurring during holoenzyme formation are a consideration (29). It was shown that extension sequences at both the amino and carboxy termini of chlamydial ␴66 were responsible for modulating transcription from the chlamydial major outer membrane protein promoter (34). Amino acid alignments of ␴28Ct and ␴28EC indicate a lack of homology at the N terminus of domain 2.1 as well as at the linker region between domains 3 and 4, which serves as a central pillar of the ␴28 conformation (23, 51). Possibly, differences between ␴28Ct and ␴28EC might also contribute to the disparity of promoter recognition. In summary, we have established that ␴28Ct can recognize many but not all ␴28EC consensus-like promoters and have found a correlation between high AT content and the ability of ␴28Ct to recognize ␴28EC promoters and the chlamydial hctB. We have also demonstrated that that ␴28Ct tolerates a greater range of spacer distances between ⫺35 and ⫺10 elements. We have used these findings to search the chlamydial genome for a putative ␴28Ct-controlled promoter using MotifSearch (X. Feng et al., unpublished data). Mismatches to the motif sequence were allowed in the range of 0 to 4 bases for each block and for a spacer of 10 to 14 bp. These searches generated 78 candidates, including the known hctB promoter. These putative promoter sequences are listed in Table S1 in the supplemental material. It is possible and perhaps likely that the promoter recognition properties of the ␴28Ct-containing holoenzyme might differ from the promoter recognition properties of the hybrid holoenzyme used in this study. Thus, fur-

7376

SHEN ET AL.

J. BACTERIOL.

ther validation with chlamydial ␴28Ct-containing holoenzyme will be needed. We are now in the process of cloning these potential core elements and upstream sequences into our GFP promoter probe vector and the in vitro transcription vector to validate these sequences as ␴28Ct promoters. Positive candidates will then be further analyzed by mutational analysis to establish the significance of potential upstream AT-rich elements. ACKNOWLEDGMENTS We thank Robert Macnab for strain YK4104, Ming Tan for plasmid pMT504, S. E. Lindow for plasmid pGreenTIR as a source of GFP, and Peter Rice and Rick Gourse for useful suggestions and discussions. We thank Kelly Winterberg and Chris Wozniak for critically reading the manuscript. We also thank Chenxin Li for assistance on motif searches and Garrett Frampton for technical assistance on the microarray analysis. This work was supported by the following grants from the National Institutes of Health: AI055869 (L.S.), AI38515 (Y.-X.Z.), AI19570 (T.P.H.), and HG02518 (J.S.L.). REFERENCES 1. Belland, R. J., G. Zhong, D. D. Crane, D. Hogan, D. Sturdevant, J. Sharma, W. L. Beatty, and H. D. Caldwell. 2003. Genomic transcriptional profiling of the developmental cycle of Chlamydia trachomatis. Proc. Natl. Acad. Sci. USA 100:8478–8483. 2. Blattner, F. R., G. Plunkett III, C. A. Bloch, N. T. Perna, V. Burland, M. Riley, J. Collado-Vides, J. D. Glasner, C. K. Rode, G. F. Mayhew, J. Gregor, N. W. Davis, H. A. Kirkpatrick, M. A. Goeden, D. J. Rose, B. Mau, and Y. Shao. 1997. The complete genome sequence of Escherichia coli K-12. Science 277:1453–1474. 3. Bolstad, B. M., R. A. Irizarry, M. Astrand, and T. P. Speed. 2003. A comparison of normalization methods for high density oligonucleotide array data based on bias and variance. Bioinformatics 19:185–193. 4. Briat, J. F., M. Z. Gilman, and M. J. Chamberlin. 1985. Bacillus subtilis sigma 28 and Escherichia coli sigma 32 (htpR) are minor sigma factors that display an overlapping promoter specificity. J. Biol. Chem. 260:2038–2041. 5. Brickman, T. J., C. E. Barry III, and T. Hackstadt. 1993. Molecular cloning and expression of hctB encoding a strain-variant chlamydial histone-like protein with DNA-binding activity. J. Bacteriol. 175:4274–4281. 6. Brudno, M., C. B. Do, G. M. Cooper, M. F. Kim, E. Davydov, E. D. Green, A. Sidow, and S. Batzoglou. 2003. LAGAN and Multi-LAGAN: efficient tools for large-scale multiple alignment of genomic DNA. Genome Res. 13:721–731. 7. Chilcott, G. S., and K. T. Hughes. 2000. Coupling of flagellar gene expression to flagellar assembly in Salmonella enterica serovar Typhimurium and Escherichia coli. Microbiol. Mol. Biol. Rev. 64:694–708. 8. Dombroski, A. J., B. D. Johnson, M. Lonetto, and C. A. Gross. 1996. The sigma subunit of Escherichia coli RNA polymerase senses promoter spacing. Proc. Natl. Acad. Sci. USA 93:8858–8862. 9. Douglas, A. L., and T. P. Hatch. 1996. Mutagenesis of the P2 promoter of the major outer membrane protein gene of Chlamydia trachomatis. J. Bacteriol. 178:5573–5578. 10. Dove, S. L., S. A. Darst, and A. Hochschild. 2003. Region 4 of sigma as a target for transcription regulation. Mol. Microbiol. 48:863–874. 11. Estrem, S. T., T. Gaal, W. Ross, and R. L. Gourse. 1998. Identification of an UP element consensus sequence for bacterial promoters. Proc. Natl. Acad. Sci. USA 95:9761–9766. 12. Fahr, M. J., A. L. Douglas, W. Xia, and T. P. Hatch. 1995. Characterization of late gene promoters of Chlamydia trachomatis. J. Bacteriol. 177:4252– 4260. 13. Fredrick, K., T. Caramori, Y. F. Chen, A. Galizzi, and J. D. Helmann. 1995. Promoter architecture in the flagellar regulon of Bacillus subtilis: high-level expression of flagellin by the sigma D RNA polymerase requires an upstream promoter element. Proc. Natl. Acad. Sci. USA 92:2582–2586. 14. Frye, J., J. E. Karlinsey, H. R. Felise, B. Marzolf, N. Dowidar, M. McClelland, and K. T. Hughes. 2006. Identification of new flagellar genes of Salmonella enterica serovar Typhimurium. J. Bacteriol. 188:2233–2243. 15. Gross, C. A., C. Chan, A. Dombroski, T. Gruber, M. Sharp, J. Tupy, and B. Young. 1998. The functional and regulatory roles of sigma factors in transcription. Cold Spring Harbor Symp. Quant. Biol. 63:141–155. 16. Hatch, T. P. 1999. Developmental biology, p 29–67. In R. S. Stephens (ed.), Chlamydia. Intracellular biology, pathogenesis, and immunity. American Society for Microbiology, Washington, D.C. 17. Helmann, J. D. 1995. Compilation and analysis of Bacillus subtilis sigma A-dependent promoter sequences: evidence for extended contact between

18. 19. 20. 21.

22.

23.

24. 25. 26.

27. 28. 29.

30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42.

43.

44.

RNA polymerase and upstream promoter DNA. Nucleic Acids Res. 23: 2351–2360. Ide, N., T. Ikebe, and K. Kutsukake. 1999. Reevaluation of the promoter structure of the class 3 flagellar operons of Escherichia coli and Salmonella. Genes Genet. Syst. 74:113–116. Ikebe, T., S. Iyoda, and K. Kutsukake. 1999. Promoter analysis of the class 2 flagellar operons of Salmonella. Genes Genet. Syst. 74:179–183. Ishihama, A. 2000. Functional modulation of Escherichia coli RNA polymerase. Annu. Rev. Microbiol. 54:499–518. Josenhans, C., E. Niehus, S. Amersbach, A. Horster, C. Betz, B. Drescher, K. T. Hughes, and S. Suerbaum. 2002. Functional characterization of the antagonistic flagellar late regulators FliA and FlgM of Helicobacter pylori and their effects on the H. pylori transcriptome. Mol. Microbiol. 43:307–322. Kalman, S., W. Mitchell, R. Marathe, C. Lammel, J. Fan, R. W. Hyman, L. Olinger, J. Grimwood, R. W. Davis, and R. S. Stephens. 1999. Comparative genomes of Chlamydia pneumoniae and C. trachomatis. Nat. Genet. 21:385– 389. Karlinsey, J. E., and K. T. Hughes. 2006. Genetic transplantation: Salmonella enterica serovar Typhimurium as a host to study sigma factor and anti-sigma factor interactions in genetically intractable systems. J. Bacteriol. 188:103–114. Keseler, I. M., J. Collado-Vides, S. Gama-Castro, J. Ingraham, S. Paley, I. T. Paulsen, M. Peralta-Gil, and P. D. Karp. 2005. EcoCyc: a comprehensive database resource for Escherichia coli. Nucleic Acids Res. 33:D334–D337. Ko, M., and C. Park. 2000. Two novel flagellar components and H-NS are involved in the motor function of Escherichia coli. J. Mol. Biol. 303:371–382. Koehler, J. E., R. R. Burgess, N. E. Thompson, and R. S. Stephens. 1990. Chlamydia trachomatis RNA polymerase major sigma subunit. Sequence and structural comparison of conserved and unique regions with Escherichia coli sigma 70 and Bacillus subtilis sigma 43. J. Biol. Chem. 265:13206–13214. Komeda, Y., K. Kutsukake, and T. Iino. 1980. Definition of additional flagellar genes in Escherichia coli K12. Genetics 94:277–290. Kundu, T. K., S. Kusano, and A. Ishihama. 1997. Promoter selectivity of Escherichia coli RNA polymerase sigmaF holoenzyme involved in transcription of flagellar and chemotaxis genes. J. Bacteriol. 179:4264–4269. Kuznedelov, K., L. Minakhin, A. Niedziela-Majka, S. L. Dove, D. Rogulja, B. E. Nickels, A. Hochschild, T. Heyduk, and K. Severinov. 2002. A role for interaction of the RNA polymerase flap domain with the sigma subunit in promoter recognition. Science 295:855–857. Liu, X., D. L. Brutlag, and J. S. Liu. 2001. BioProspector: discovering conserved DNA motifs in upstream regulatory regions of co-expressed genes. Pac. Symp. Biocomput. 6:127–138. Liu, X., and P. Matsumura. 1996. Differential regulation of multiple overlapping promoters in flagellar class II operons in Escherichia coli. Mol. Microbiol. 21:613–620. Lonetto, M., M. Gribskov, and C. A. Gross. 1992. The sigma 70 family: sequence conservation and evolutionary relationships. J. Bacteriol. 174:3843–3849. Mathews, S. A., and K. S. Sriprakash. 1994. The RNA polymerase of Chlamydia trachomatis has a flexible sequence requirement at the ⫺10 and ⫺35 boxes of its promoters. J. Bacteriol. 176:3785–3789. Mathews, S. A., and R. S. Stephens. 1999. DNA structure and novel amino and carboxyl termini of the Chlamydia sigma 70 analogue modulate promoter recognition. Microbiology 145:1671–8181. Mathews, S. A., and P. Timms. 2000. Identification and mapping of sigma-54 promoters in Chlamydia trachomatis. J. Bacteriol. 182:6239–6242. Miller, W. G., and S. E. Lindow. 1997. An improved GFP cloning cassette designed for prokaryotic transcriptional fusions. Gene 191:149–153. Moulder, J. W. 1991. Interaction of chlamydiae and host cells in vitro. Microbiol. Rev. 55:143–190. Mytelka, D. S., and M. J. Chamberlin. 1996. Escherichia coli fliAZY operon. J. Bacteriol. 178:24–34. Nicholson, T. L., L. Olinger, K. Chong, G. Schoolnik, and R. S. Stephens. 2003. Global stage-specific gene regulation during the developmental cycle of Chlamydia trachomatis. J. Bacteriol. 185:3179–3189. Park, K., S. Choi, M. Ko, and C. Park. 2001. Novel sigmaF-dependent genes of Escherichia coli found using a specified promoter consensus. FEMS Microbiol. Lett. 202:243–250. Prouty, M. G., N. E. Correa, and K. E. Klose. 2001. The novel sigma54- and sigma28-dependent flagellar gene transcription hierarchy of Vibrio cholerae. Mol. Microbiol. 39:1595–1609. Reads, T. D., R. C. Brunham, C. Shen, S. R. Gill, J. F. Heidelberg, O. White, E. K. Hickey, J. Peterson, T. Utterback, K. Berry, S. Bass, K. Linher, J. Weidman, H. Khouri, B. Craven, C. Bowman, R. Dodson, M. Gwinn, W. Nelson, R. DeBoy, J. Kolonay, G. McClarty, S. L. Salzberg, J. Eisen, and C. M. Fraser. 2000. Genome sequences of Chlamydia trachomatis MoPn and Chlamydia pneumoniae AR39. Nucleic Acids Res. 28:1397–1406. Ross, W., K. K. Gosink, J. Salomon, K. Igarashi, C. Zou, A. Ishihama, K. Severinov, and R. L. Gourse. 1993. A third recognition element in bacterial promoters: DNA binding by the alpha subunit of RNA polymerase. Science 262:1407–1413. Ross, W., and R. L. Gourse. 2005. Sequence-independent upstream DNA-

VOL. 188, 2006

45.

46.

47. 48. 49. 50.

PROMOTER RECOGNITION BY CHLAMYDIAL ␴28 RNA POLYMERASE

alphaCTD interactions strongly stimulate Escherichia coli RNA polymeraselacUV5 promoter association. Proc. Natl. Acad. Sci. USA 102:291–296. Ross, W., D. A. Schneider, B. J. Paul, A. Mertens, and R. L. Gourse. 2003. An intersubunit contact stimulating transcription initiation by E. coli RNA polymerase: interaction of the alpha C-terminal domain and sigma region 4. Genes Dev. 17:1293–1307. Salgado, H., S. Gama-Castro, A. Martinez-Antonio, E. Diaz-Peredo, F. Sanchez-Solano, M. Peralta-Gil, D. Garcia-Alonso, V. Jimenez-Jacinto, A. Santos-Zavaleta, C. Bonavides-Martinez, and J. Collado-Vides. 2004. RegulonDB (version 4.0): transcriptional regulation, operon organization and growth conditions in Escherichia coli K-12. Nucleic Acids Res. 32:D303–D306. Schachter, J. 1999. Infection and diseases epidemiology, p. 139–169. In R. S. Stephens (ed.), Chlamydia. Intracellular biology, pathogenesis, and immunity. American Society for Microbiology, Washington, D.C. Schaubach, O. L., and A. J. Dombroski. 1999. Transcription initiation at the flagellin promoter by RNA polymerase carrying sigma28 from Salmonella typhimurium. J. Biol. Chem. 274:8757–8763. Shen, L., M. Li, and Y. X. Zhang. 2004. Chlamydia trachomatis sigma28 recognizes the fliC promoter of Escherichia coli and responds to heat shock in chlamydiae. Microbiology 150:205–215. Shen, L., Y. Shi, A. L. Douglas, T. P. Hatch, C. M. O’Connell, J. M. Chen, and Y. X. Zhang. 2000. Identification and characterization of promoters regulating tuf expression in Chlamydia trachomatis serovar F. Arch. Biochem. Biophys. 379:46–56.

7377

51. Sorenson, M. K., S. S. Ray, and S. A. Darst. 2004. Crystal structure of the flagellar sigma/anti-sigma complex sigma(28)/FlgM reveals an intact sigma factor in an inactive conformation. Mol. Cell 14:127–138. 52. Stephens, R. S., S. Kalman, C. Lammel, J. Fan, R. Marathe, L. Aravind, W. Mitchell, L. Olinger, R. L. Tatusov, Q. Zhao, E. V. Koonin, and R. W. Davis. 1998. Genome sequence of an obligate intracellular pathogen of humans: Chlamydia trachomatis. Science 282:754–759. 53. Tan, M., and J. N. Engel. 1996. Identification of sequences necessary for transcription in vitro from the Chlamydia trachomatis rRNA P1 promoter. J. Bacteriol. 178:6975–6982. 54. Tan, M., T. Gaal, R. L. Gourse, and J. N. Engel. 1998. Mutational analysis of the Chlamydia trachomatis rRNA P1 promoter defines four regions important for transcription in vitro. J. Bacteriol. 180:2359–2366. 55. Tan, M., B. Wong, and J. N. Engel. 1996. Transcriptional organization and regulation of the dnaK and groE operons of Chlamydia trachomatis. J. Bacteriol. 178:6983–6990. 56. Typas, A., and R. Hengge. 2005. Differential ability of sigma(s) and sigma70 of Escherichia coli to utilize promoters containing half or full UP-element sites. Mol. Microbiol. 55:250–260. 57. Wo ¨sten, M. M. 1998. Eubacterial sigma-factors. FEMS Microbiol. Rev. 22: 127–150. 58. Yu, H. H., and M. Tan. 2003. Sigma28 RNA polymerase regulates hctB, a late developmental gene in Chlamydia. Mol. Microbiol. 50:577–584.