Biometals (2013) 26:285–296 DOI 10.1007/s10534-013-9610-x
Selenium effect on selenoprotein transcriptome in chondrocytes Jidong Yan • Yuewen Zheng • Zixin Min Qilan Ning • Shemin Lu
•
Received: 23 January 2012 / Accepted: 20 January 2013 / Published online: 7 March 2013 Ó Springer Science+Business Media New York 2013
Abstract Selenium is an essential micronutrient and exerts its biological functions predominantly through selenoproteins. Selenium deficiency is associated with cartilage function. This study demonstrated that all 24 selenoprotein transcripts in mouse genome were detectable in ATDC5 chondrocytes except deiodinase 1 (DIO1), DIO2, and selenoprotein V (Sel V), while all 25 selenoprotein transcripts in human genome were detectable in C28/I2 chondrocytes except glutathione peroxidase 6 (GPx6) and DIO1. In addition, gene expression of five selenoproteins (GPx1, Sel H, Sel N, Sel P, and Sel W) was up-regulated and two selenoproteins (SPS2 and Sel O) was down-regulated by sodium selenite (Se) in both ATDC5 and C28/I2 cells. Gene expression of six selenoproteins (TrxR1, Sel I,
Sel M, Sel R, Sel S, Sel T) and one selenoprotein (GPx3) was up-regulated by Se in ATDC5 and C28/I2 cells, respectively. Gene expression of one selenoprotein (TrxR2) was down-regulated by Se only in ATDC5 cells. Further transcription inhibition assay showed that both transcriptional and posttranscriptional mechanisms involved in Se-regulated gene expression of GPx1, TrxR1, TrxR2, SPS2, Sel O, and Sel S. However, Se-regulated gene expression of Sel H, Sel I, Sel M, Sel N, Sel P, Sel R, Sel T, and Sel W mainly at posttranscriptional level. Moreover, new protein synthesis inhibition assay indicated that Semediated new protein synthesis also played roles in Se-regulated gene expression of GPx1, TrxR1, TrxR2, Sel H, Sel O, Sel P, Sel R, and Sel W. In summary, this study described the selenoprotein transcriptome, Seregulated selenoproteins and possible mechanisms involved in chondrocytes.
J. Yan Y. Zheng Z. Min Q. Ning S. Lu (&) Department of Genetics and Molecular Biology, Xi’an Jiaotong University School of Medicine, Yanta West Road 76, Xi’an 710061, Shaanxi, China e-mail:
[email protected];
[email protected]
Keywords Chondrocyte Selenium Selenoprotein Real-time PCR Gene expression
J. Yan Y. Zheng Z. Min Q. Ning S. Lu Key Laboratory of Environment and Gene Related Diseases of Ministry Education, Xi’an Jiaotong University, Xi’an 710061, Shaanxi, China S. Lu Department of Epidemiology and Health Statistics, Xi’an Jiaotong University School of Medicine, Xi’an 710061, Shaanxi, China
Abbreviations ActD Actinomycin D CHX Cycloheximide DIO Deiodinase GPx Glutathione peroxidase Sel Selenoprotein SPS2 Selenophosphate-synthetase 2 TrxR Thioredoxin reductases
123
286
Biometals (2013) 26:285–296
Introduction
Materials and methods
Selenium (Se) is an essential trace element and the biological effects of Se are mainly through its incorporation into selenoproteins as the form of selenocysteine (Sec) (Hesketh 2008). At present, 24 selenoproteins have been identified in rodents and 25 in human. In mammals, the incorporation of Sec into selenoproteins occurs via a stop codon UGA and requires recoding by means of a Sec-insertion sequence (SECIS) with a specific selenocysteyl-tRNA (tRNA-Sec) and a number of trans-acting proteins, including the SECIS binding protein 2 (SBP2), the specialized translation elongation factor EFSec, ribosomal protein L30, and others (Reeves and Hoffmann 2009). Selenoproteins play roles in a variety of physiological processes, such as regulation of redox homeostasis (Steinbrenner and Sies 2009), biosynthesis of thyroid hormones (Ko¨hrle et al. 2005), reproduction (Mistry et al. 2012), and immune function (Bellinger et al. 2009). Se-deficiency is associated with osteoarthropathy in humans and oral supplementation of Se shows benefits (Schepman et al. 2011; Stone 2009; Zou et al. 2009). In addition, a transgenic mouse with inhibition of selenoprotein synthesis in osteochondroprogenitors shows marked signs of osteochondropathy similar to that of humans (Downey et al. 2009). These observations suggest that Se is involved in the development and function of cartilage. However, little information is available for the tissue distribution and physiological roles of Se and selenoproteins in cartilage. In the present study, we characterized the gene expression profile of selenoproteins and Se-responsive selenoproteins in a mouse chondroblast cell line ATDC5 and a human juvenile costal chondrocyte cell line C28/I2. ATDC5 cells are a useful in vitro model for chondrogenesis, which is analogous to that observed during endochondral ossification in vivo and undergoes the multistep processes of chondrocyte differentiation in response to insulin (Shukunami et al. 1996; Iwamoto et al. 2010; Challa et al. 2010). C-28/I2 cells express high levels of matrix-anabolic and matrix-catabolic genes and thus are suitable for investigation of chondrocyte anabolic and catabolic activity in the pathogenesis of osteoarthritis (Goldring et al. 1994; Finger et al. 2003; Pufe et al. 2004).
Cell lines and culture condition
123
The mouse chondroblast cell line ATDC5 was obtained from European Collection of Cell Cultures (ECACC). Cells were maintained in DMEM/F12 medium (Invitrogen) containing 5 % FBS (Invitrogen) at 37 °C in a 100 % humidified atmosphere of 5 % CO2 and 95 % air (standard culture condition). For experiments of sodium selenite (Se, Sigma) supplementation, cells were preconditioned with medium containing 1 % FBS at least for 5 days resulting in Se depletion (Se-deficient condition). For induction of chondrogenesis, cells were plated as 10 ll/droplet in 24-well plate at concentration of 1 9 107 cells/ml (micromass culture) for 1 h and then refreshed with DMEM/F12 medium containing different concentration of FBS, 10 lg/ml insulin, 5 lg/ml transferrin, and 50 nM Se for 7 days as described previously (Woods et al. 2005). The human juvenile costal chondrocyte cell line C28/ I2 was obtained as described previously (Goldring et al. 1994). Cells were maintained in DMEM/F12 medium (Invitrogen) containing 10 % FBS (Invitrogen) at 37 °C in the presence of 5 % CO2. The medium was refreshed every 3 days. For experiments of Se supplementation, cells were preconditioned with DMEM/F12 medium supplemented with 1 % FBS, 10 lg/ml insulin, and 5 lg/ml transferrin at least for 5 days resulting in Se depletion (Se-deficient condition). Selenium content analysis Contents of selenium in serum and chondrocytes were measured by atomic absorption spectroscopy as described previously (Gao et al. 2012). GPx activity assay GPx activity was assayed using a GPx activity assay kit with tert-butyl hydroperoxide (t-BuOOH) as substrate (Byotime Biotech) according to the manufacturer’s instruction as described (Pan et al. 2008). Briefly, cell lysates were clarified by centrifugation. The protein contents in the supernatant were determined by BCA assay (Pierce). The oxidation of NADPH was recorded at 340 nm within the first 3 min of the reaction. The
Biometals (2013) 26:285–296
activity of GPx was expressed as nanomoles of NADPH oxidized per minutes and milligram of protein. TrxR activity assay The activity of TrxR was determined using the DTNB reduction assay as described previously (Rackham et al. 2011). TrxR activity was measured in buffer containing 100 mM potassium phosphate (pH 7.0), 10 mM EDTA, 0.2 mM NADPH, and 2.5 mM 5, 50 -dithio-bisnitrobenzoic acid (DTNB) with or without gold compound auranofin (final concentration of 10 lM, Sigma). The reduction of DTNB was recorded at 412 nm within the first 2 min of the reaction. The activity of TrxR was estimated as the difference between the reducing activity of the sample in the absence of auraofin and its activity in the presence of autanofin per milligram of protein. The specific activity of TrxR was determined in cytosolic (TrxR1) or mitochondrial (TrxR2) lysate. Mitochondrial and cytosolic proteins were isolated using the mitochondria/cytosol fractionation kit according to the manufacturer’s instruction (Byotime Biotech). The protein contents were determined by BCA assay (Pierce). Alcian blue staining Differentiation of ATDC5 chondrocytes was measured by Alcian blue staining as described previously (Sugita et al. 2011). Cells were fixed in 4 % paraformaldehyde for 10 min at room temperature. After fixation, cells were stained with Alcian blue 8GX overnight. The stained cells were washed three times with water and photographed with a camera. RT-PCR and real-time PCR Total RNA was extracted using a TRIzol kit (Invitrogen) according to the manufacture’s instruction. The integrity of RNA samples was checked by electrophoresis and the concentration was detected using a UV-spectrophotometer. The reverse transcription reaction was performed with 5 lg of total RNA and oligo(dT18) primer using a reverse transcription kit (Ferments). RT-PCR was performed at standard condition as followed: 1 cycle at 94 °C for 3 min; followed by 40 cycles at 94 °C for 30 s, 60 for 30 s, 72 °C for 30 s and finally 1 cycle at 72 °C for 7 min.
287
PCR products were separated electrophoretically in a 1.2 % agarose DNA gel and stained with ethidium bromide for analysis with a bioimaging system (Syngene). Real-time PCR was performed on an iQ5 Real-Time PCR System (BIO-RAD). Reactions were performed using 0.2 ll of the cDNA in 10 ll reactions mixture with 95 °C for 30 s followed by 40 cycles of 95 °C for 15 s, 60 °C for 30 s and 72 °C for 30 s. Relative gene expression levels of selenoproteins under Se-deficient or Se-supplemented condition were identified by the 2-DDCt method (Yuan et al. 2006). The forward and reverse primers designed to recognize mouse and human sequences were listed in Tables 1 and 2, respectively. Electrophoresis was performed to verify primer specificity and the dissociation curve was run to confirm the production of a single product. Western blot The total cellular proteins were extracted and the protein contents were determined by BCA assay (Pierce). Proteins were separated on SDS-PAGE and transferred onto a nitrocellulose membrane. The membrane was blocked with 3 % nonfat milk in Tris-buffered saline-0.05 % Tween 20 (TBST, pH 8.0) buffer and then incubated with primary antibodies followed by secondary antibodies conjugated with horseradish peroxidase. Protein bands were visualized on X-ray film (Kodak) using an ECL reagent (Pierce). Antibody against GPx1 (sc-22145, 1:200 dilution), TrxR1 (sc28321, 1:200 dilution), and TrxR2 (sc166259, 1:200 dilution) was from Santa Cruz Biotechnology (CA, USA). Antibody against b-actin (1:2,000 dilution), the secondary horseradish peroxidase-coupled anti-goat (1:5,000 dilution) and antimouse (1:5,000 dilution) antibody were obtained from Byotime Biotech (Jiangsu, China). Statistical analysis Data were presented as mean ± standard error of the mean (SEM) for at least three independent experiments unless otherwise indicated. Statistical analysis was performed by Student’s t test or ANOVA followed by Dunnett’s test for multiple comparisons. P value less than 0.05 was considered statistically significant.
123
288
Biometals (2013) 26:285–296
Table 1 Primers used for mouse selenoproteins Gene
Forward primer
b-actin
50 -cccgccaccagttcgccatgg-30 0
Reverse primer 50 -agcacagggtgctcctcaggggc-30
0
50 -ctgtacctgcgcacgggaac-30
GPx1
5 -gtctctctgaggcaccacgatc-3
GPx2 GPx3
50 -atcatatggagtcccgtgcgccgct-30 50 -atcctccgggcatcctgccttctgt-30
50 -agccccaagcaaactccccaagagc-30 50 -taggcacaaagcccccacctggtcgaa-30
GPx4
50 -caggggtttcgtgtgcatcgt-30
50 -gagatagcacggcaggtcctt-30
DIO1
0
5 -tggctgtggctgaagcggcttgtga-3 0
50 -tgggcgctctgcactggcaaagtca-30
5 -tccaactgcctcttcctggcgctct-3
DIO3
50 -aggcacggccttcatgctctggctt-30
TrxR2 TrxR3
50 -tcatccgcgccatgaacggtggtca-30
0
5 -tggcagcagctaaggaggcagccaa-3 0
5 -tggcacctgtgtcaacgtgggttgc-3
5 -tgtccacacagcacgcgggttaagga-3 0
0
50 -ttccttggcacaagagaggccgcca-30
0
50 -ccaaagcgcccactggctttgctga-30
Sel 15
50 -agctggggcttcgtggatagccgat-30
Sel H
50 -tgtacgagctgacgcgtgta-30
Sel M
50 -tgtggcgatgaggaaccgctctgct-30 50 -agcagagtcgccttcccgcctttgt-30
0
5 -tgctgccaatgcccaccaatggct-3
Sel K
0
0
SPS2
Sel I
50 -acaccaggggcctgctgccttgaat-30
0
DIO2 TrxR1
0
50 -tgacgcaaactctgcccccagagca-30 50 -gctgcctcacaactgaacca-30
0
5 -tcgcttactgtgaggagaggtgcggaa-3 0
0
5 -agcaggcaaccggagggaagatggt-3
0
50 -tgcacccccttcgtcagagcttcct-30 50 -agccgctcttcaccgcttgatggctt-30
0
0
50 -agccgagctcctgtaccagcgcatt-30
0
0
50 -accacagtgccgttgggcagacaga-30
5 -tttgggtgcagcctgcggaacgtct-3
Sel N
5 -acctgccgttcacggaggcctttga-3
Sel O Sel P
50 -tggtcgcaaagtcctgcggtcaagca-30 50 -ggcttgcaccaccaccacaggcata-30
50 -tccgtgtcacaggtatgggcagcct-30 50 -tctcctccgcgaaaagcccctgtca-30
Sel R
50 -tttgcctgtcccgtcgcgaccatgt-30
50 -tgtccccgcttggggccatcattca-30
Sel S
0
5 -ggcccatcatctggcggctgaaact-3 5 -tgaggctcctgctgcttctgctggt-3
50 -tttcttggccccactgccagatgct-30
Sel V
50 -agttcttggcctccccgctgaagga-30
50 -tcatgtcccctccgttgctgctgct-30
0
0
5 -ttgcttgtgggtcgggtcctcgtgt-3
Results Chondrocytes of mouse and human express majority of selenoprotein transcripts We first set out to examine gene expression of selenoproteins characterized in mouse and human genome in a mouse chondrocyte cell line ATDC5 and a human chondrocyte cell line C28/I2, respectively. Cells were cultured in standard condition for 24 h and total RNA were extracted. Gene expression profile of selenoproteins was detected by RT-PCR assay. It was found that gene expression of 21 selenoproteins (GPx1, GPx2, GPx3, GPx4, TrxR1, TrxR2, TrxR3, DIO3, SPS2, Sel 15, Sel H, Sel I, Sel K, Sel M, Sel N, Sel O, Sel P, Sel R, Sel S, Sel T, and SelW) was at a detectable level in ATDC5 cells, while gene expression of the other three selenoproteins (DIO1, 2 and Sel V) was below the level of detection (Fig. 1a). In
123
0
50 -tcccgtcacagagaccatcctgcca-30
Sel T Sel W
0
0
50 -agccaaggcagctttgatggcggt-30
addition, gene expression of 23 selenoproteins (GPx1, GPx2, GPx3, GPx4, TrxR1, TrxR2, TrxR3, DIO2, DIO3, SPS2, Sel 15, Sel H, Sel I, Sel K, Sel M, Sel N, Sel O, Sel P, Sel R, Sel S, Sel T, Sel V, and Sel W) was at a detectable level in C28/I2 cells, while gene expression of the other two selenoproteins (GPx6 and DIO1) was below the level of detection (Fig. 1b). The undetectable gene expression of selenoproteins may be due to the extremely low expression level because nest PCR or altered PCR program could not obtain visible results. However, expression of these genes was clearly detected in other tissues or cell lines using the same protocol (data not shown). Selenium deficiency regulates gene expression of selenoproteins in ATDC5 cells We next examined the effects of Se depletion on the gene expression of selenoproteins in ATDC5 cells.
Biometals (2013) 26:285–296
289
Table 2 Primers used for human selenoproteins Gene
Forward primer
Reverse primer
bactin
50 cccgccaccagttcgccatgg30
50 agcacagggtgctcctcaggggc30
GPx1
50 -acatcgagcctgacatcgaa30
50 -tctggcagagactgggatca-30
GPx2
50 -gggacttcacccagctcaac30
50 -ggtaggcgaagacaggatgc-30
GPx3
50 -caacgtggccagctactgag30
50 -gacaaagcctccacctggtc-30
GPx4
50 -agttttccgccaaggacatc30
50 -tgcttcccgaactggttaca-30
GPx6
50 -gctttgtccccagtttccag-30
50 -tgcatgacagggactccatc-30
0
DIO1
5ggacaccatgcagaaccaga30
50 -cctcccgttggtcacctaga-30
DIO2
50 -ggaagatcgatgtgcagcag30
50 -gccggacttcttgaaggttg-30
DIO3
50 -cagcacatcctcgactacgc30
50 -tgctgtgggatgatgtaggg-30
TrxR1
50 -gggtccaaatgctggagaag30
50 -gcagtcttggcaacagcatc-30
TrxR2
50 -ccccgacactcagaagatcc30
50 -atactccagcggggtgaaga-30
TrxR3
50 -tctggcctcttgaatggaca-30
50 -ggggtgaattccaatggtgt-30
0
SPS2
5 -cggtggagttgccactgtag30
50 -taggccagctccacctcttc-30
Sel 15
50 -cctgattgcagaggatgctg30
50 -agggtctgaaccacggacat-30
Sel H
50 -ccgctgtaggagcagagctt30
50 -gccagcttctctcgcttctc-30
Sel I
50 -tgggagttgaggcctggtat30
50 -gaccaaaggatccacgctgt-30
Sel K
50 -aagtgttggacagccggagt30
50 -ctagggccacgcagatgatt-30
Sel M
50 -tgacagctgaaccgcctaaa30
50 -tcctgcactagcgcattgat-30
Sel N
50 agccaaggctgagaacaagc30
50 -gggacgagttctcctggttg-30
Sel O
50 -acggttgtgttgcgtgtagc-30
50 -gcatttctctgcacgctgtc-30
Sel P
50 -ctcctccaggccttcatcac30
50 -gacaatggcagcatcagctc-30
Sel R
50 -ccgcctttcagtgggatcta-30
50 -gacaacctctgtgcgagctg-30
0
Sel S
5aagaagccccaggaggaaga30
50 -cccttggtcaagaagcaacc-30
Sel T
50 -aggcgggtgtttgaggagta30
50 -tattttcttggccccactgc-30
Sel V
50 -gcggacttcaacctcagtcc30
50 -ggggaccagagtgggaatct-30
Sel W
50 -gtcgtttattgtggcgcttg-30
50 -cgtagccatcgcctttcttc-30
Intracellular Se was depleted by serum deprivation because serum contains sufficient trace amounts (about 500 nM) of Se. It was found that intracellular Se content decreased significantly after serum deprivation (1 % FBS) for 5 days (Fig. 2a). Similar result was also found for GPx activity (Fig. 2b). More serum deprivation (0.5 % FBS) did not further deplete intracellular Se as well as GPx activity (Fig. 2a and b). Thus, cells were cultured in DMEM/F12 medium containing 1 % FBS as Se-deficiency condition. Under this condition, ATDC5 cell retained the chondroblast properties as estimated by Alcian blue stain assay (Fig. 2c). Gene expression of selenoproteins under Se-deficient condition was determined by real-time PCR analysis. The housekeeping gene ß-actin was used to normalize the abundance of other mRNAs as its levels were not changed after serum deprivation. As shown in Fig. 2d, gene expression of nine selenoprotein was down-regulated by Se depletion. The mRNA abundance of Sel W, GPx1, Sel H, and Sel I in ATDC5 cells under Se-deficient condition were reduced to 9, 14, 21, and 59 %, respectively, of those under standard condition. In addition, gene expression of five selenoproteins (TrxR1, TrxR2, Sel M, Sel N, and SelT) each was reduced to about 80 % of those under standard culture condition. However, gene expression of four selenoproteins (SPS2, Sel O, Sel R, and Sel S) was upregulated about 0.5-fold under Se-deficient condition compared to those under standard condition. In contrast, gene expression levels of GPx2, GPx3, GPx4, DIO3, TrxR3, Sel 15, Sel K, and Sel P were not affected by Se depletion. Se supplementation affects gene expression of selenoproteins in ATDC5 cells Se repletion of Se-depleted cells was used as a model to further investigate the Se-responsive selenoproteins in chondrocytes. Supplemented with 50 nM Se for 24 h under Se-deficient condition increased intracellular GPx1 protein level (Fig. 3a) and could fully rescue intracellular GPx activity (Fig. 3b). Se supplementation at concentration of 100 nM did not further elevate intracellular GPx1 activity (unpublished observation). Thus, Se-depleted cells were supplemented with 50 nM Se for Se adequate requirement. Gene expression levels of selenoproteins in Sesupplemented cells were determined by real-time PCR analysis. The housekeeping gene ß-actin was used to
123
290
Biometals (2013) 26:285–296
Fig. 1 Transcripts of selenoproteins in chondrocytes. Cells were cultured in maintained conditions and total RNA was isolated and used for cDNA synthesis. Gene expression profile
of selenoproteins was detected by conventional PCR assay in a mouse chondroblast cells ATDC5 (a) and a human chondrocytes C28/I2 (b), respectively
normalize the abundance of other mRNAs as its levels were not changed after Se addition. It was found gene expression of eleven selenoproteins (GPx1, TrxR1, Sel H, Sel I, Sel M, Sel N, Sel P, Sel R, Sel S, Sel T, and Sel W) and three selenoproteins (TrxR2, SPS2, and Sel O)was up-regulated and down-regulated significantly after Se addition, respectively (Fig. 3e). The mRNA abundance of GPx1, Sel H, Sel P, Sel R, and Sel W increased 2.5, 4.25, 1.65, 1, and 6.9-fold, respectively,
after Se addition as compared to those under Sedeficient condition. However, mRNA levels of TrxR2, SPS2, and Sel O fall to 59, 73, and 72 % of those under Se-deficient condition, respectively. In contrast, mRNA levels of GPx2, GPx3, GPx4, DIO3, TrxR3, Sel 15, and Sel K were not affected by Se addition. Gene expression of the Se-responsive selenoproteins (TrxR1 and TrxR2) were further validated by protein expression (Fig. 3c) and enzyme activity (Fig. 3d), respectively.
Fig. 2 Abundance of selenoprotein transcripts in chondrocyte ATDC5 under Se-deficient conditions. Cells were preconditioned with DMEM/F12 medium containing indicated concentration of serum for 5 days. Intracellular Se (a, n = 3), GPx activity (b, n = 3), and chondrocyte differentiation (c) were detected as described in Materials and methods. Total RNA was extracted from cells cultured in the medium containing 5 % FBS (standard culture) and 1 % FBS (Se-deficient culture), respectively. Expression levels of each selenoprotein relative to b-actin were estimated by real-time PCR (d, n = 4). *P \ 0.05 versus control group
123
Biometals (2013) 26:285–296
291
Fig. 3 Gene expression of selenoproteins during Se repletion of Se-deficient cells. Cells cultured at Se-deficient condition (1 % FBS) were supplemented with 50 nM Se for 24 h. Total protein was extracted for GPx1 protein expression (a) and GPx activity assay (b). Total protein was also extracted for protein expression assay of TrxR1 and TrxR2 (c). b-actin was used as
equal amounts of loading protein and cells cultured with 5 % FBS were used as a positive control. Cytosolic and mitochondrial protein was isolated for TrxR1 and TrxR2 activity assay, respectively (d). Total RNA was isolated and relative mRNA levels of selenoproteins were assayed by real-time PCR (e, n = 5). *P \ 0.05 versus control group. CON control
Se affects gene expression of selenoproteins in C28/I2 cells
selenoproteins (GPx1, GPx3, Sel H, Sel N, Sel P, and Sel W) were up-regulated and two selenoproteins (SPS2, and Sel O) were down-regulated significantly after Se addition (Fig. 4d). The mRNA abundance of GPx1, GPx3, Sel H, Sel N, Sel P, and Sel W increased 1.5, 0.5, 1.3, 0.4, 0.7, and 2.4-fold respectively, after Se addition as compared to those under Se-deficient condition. However, mRNA levels of SPS2 and Sel O each fall to 80 % of those under Se-deficient condition. In contrast, mRNA levels of GPx2, GPx4, DIO2, DIO3, TrxR1, TrxR2, TrxR3, Sel 15, Sel I, Sel K, Sel M, Sel R, Sel S, Sel V, and Sel T were not affected by Se.
The Se-responsive selenoproteins were further examined in a human chondrocyte C28/I2 cells. Firstly, C28/I2 cells were preconditioned under Se-deficiency condition (DMEM/F12 supplemented with 1 % FBS, 10 lg/ml insulin, and 5 lg/ml transferrin) to deplete intracellular Se. Cell viability rescued well under this condition, since C28/I2 cells were more sensitive to serum deprivation than ATDC5 cells (data not shown). It was found that intracellular GPx activity decreased significantly in time-course manner (Fig. 4a). Similar result was also found for intracellular Se content (Fig. 4b). Under this condition, cells supplemented with 50 nM Se for 24 h could increase intracellular GPx activity significantly (Fig. 4c). Then, Se-depleted cells were incubated with 50 nM Se for 24 h for Se supplementation requirement. Secondly, gene expression levels of selenoproteins were determined by real-time PCR analysis. The housekeeping gene ß-actin was used to normalize the abundance of other mRNAs as its levels were not changed after Se addition. It was found that gene expression levels of six
Se regulates gene expression of selenoproteins in a dose-dependent and time-course manner in ATDC5 cells We next examined the dynamics gene expression of Seresponsive selenoproteins in ATDC5 cells by real-time PCR analysis. Se-depleted cells treated with sodium selenite (Se) for 24 h affected gene expression of certain selenoproteins in a concentration-dependent manner (Fig. 5a). Gene expression of GPx1, Sel H, and
123
292
Biometals (2013) 26:285–296
Fig. 4 Gene expression of selenoproteins during Se repletion of Se-deficient C28/I2 cells. Cells were refreshed with Sedeficient medium (DMEM/F12 containing 1 % FBS, 10 lg/ml insulin, and 5 g/ml transferrin) and total protein was extracted at indicated time points for GPx activity assay (a, n = 3). Cells were preconditioned with Se-deficient medium for 5 days and intracellular Se content was detected as described in materials and methods (b, n = 3). Cells cultured with Se-deficient
medium for 5 days were supplemented with 50 nM Se for 24 h. Total protein was extracted for GPx activity assay (c, n = 3) and total RNA was isolated for relative mRNA expression levels of selenoproteins by real-time PCR assay (d, n = 3). *P \ 0.05 versus control group. 1 % FBSIT, DMEM/ F12 containing 1 %FBS, 10 lg/ml insulin, and 5 lg/ml transferrin. CON control
Sel W increased significantly at concentrations of 5–405 nM Se for 24 h incubation (maximum induction at concentration of 45 nM Se), while gene expression of SPS2 and Sel O decreased significantly at concentrations of 45–405 nM Se. Treatment with Se also affected gene expression of selenoproteins in a time coursedependent manner (Fig. 5b). Gene expression of GPx1, Sel H, and Sel W increased significantly at 3–24 h (maximum elevation at 12–24 h) after Se treatment at concentration of 45 nM, while gene expression of SPS2 and Sel O decreased significantly at 1–24 h and 6–24 h after Se treatment, respectively.
(about 30 % decrease). Among fourteen Se-responsive selenoproteins, gene expression of six selenoproteins including GPx1, TrxR1, TrxR2, SPS2, Sel O, and Sel S fall to 77, 45, 23, 26, 67, and 79 % of levels under Se-supplementation condition, respectively. However, gene expression of the other selenoproteins was not affected or even up-regulated after Act D addition (Fig. 6a). On the contrary, expression levels of these Se-responsive selenoproteins (except Sel I and Sel P) all were down-regulated after Act D addition under Se-deficiency condition (Fig. 6b).
Se regulates gene expression of selenoproteins at transcriptional and posttranscriptional levels in ATDC5 cells Then, the possible mechanisms underlying Se-responsive selenoproteins were investigated by transcription inhibition assay. Incubation ATDC5 cells with 10 lM actinomycin D (Act D) for 6 h had little effects on cell viability but caused a decrease in total RNA synthesis
123
New protein synthesis involved in Se-mediated gene expression of Se-responsive selenoproteins in ATDC5 cells Finally, the possible roles of de novo protein synthesis involved in gene expression of Se-responsive selenoproteins were investigated by protein synthesis inhibition assay. Incubation of ATDC5 cells with 10 lg/ml cycloheximide (CHX) for 6 h had slight effects on cell viability and total protein content (both
Biometals (2013) 26:285–296
293
Fig. 5 Se regulates gene expressions of selenoproteins in a dosedependent and time-course manner in ATDC5 cells. Sedeficient ATDC5 cells were treated with various concentration of sodium selenite (Se) for 24 h (a) or treated with 50 nM Se at indicated time points (b). Total RNA was extracted for relative mRNA expression levels by real-time PCR assay (n = 3). *P \ 0.05 versus control group
about 10 % decrease). Among fourteen Se-responsive selenoproteins in ATDC5 cells, gene expression of two selenoproteins (TrxR2 and Sel H) increased after CHX addition under Se-supplemented condition (Fig. 7a). However, gene expression of eight selenoproteins (GPx1, TrxR1, TrxR2, Sel H, Sel O, Sel P, Sel R, and Sel W) increased after CHX addition under Se-deficiency condition (Fig. 7b).
Discussion Se is incorporated into selenoproteins as the form of selenocysteine (Sec). Selenoproteins are responsible for the majority of biological effects of Se. Despite the association of Se-deficiency with cartilage dysfunction,
little insight has been gained as to the role of Se or selenoproteins in the physiological or pathological processes of cartilage. In this study, we searched for the possible Se-responsive selenoproteins in a mouse and a human chondrocyte cell line under the conditions of Sedeficiency or Se-supplementation. First, transcripts of selenoproteins were examined by RT-PCR assay. The selenoprotein transcripts in mouse genome except three (DIO1, DIO2, and Sel V) were detectable in a mouse chondroblast cell line ATDC5. In addition, the selenoprotein transcripts in human genome except two (GPx6 and DIO1) were detectable in a human juvenile costal chondrocyte cell line C28/I2. Although individual selenoproteins exhibit tissue specificity in their expression levels, there are some common features when comparing with the
123
294
Fig. 6 Se regulates gene expression of selenoproteins at both transcriptional and posttranscriptional levels. Cells cultured under Se-deficient condition were supplemented with (a) or without (b) sodium selenite (Se) for 24 h and then adding 10 lM Act D for further 6 h. Total RNA was isolated for selenoprotein mRNA expression assay by real-time PCR (n = 4). Act D actinomycin D. *P \ 0.05 versus control group
previous studies (Carlson et al. 2009; Hoffmann et al. 2007). Gene expression of selenoproteins at high levels (GPx1, GPx4, Sel H, Sel K, and Sel W) in chondrocyte was also observed in macrophage cells, brain and spleen tissue. It is the same for those genes at low levels (GPx2, TrxR3, and Sel 15). However, there is also some difference. Gene expression of Selenoprotein H (Sel H) in kidney and liver at low level was at a high level in ATDC5 cells, indicating a special role of Sel H for chondrocytes. Additionally, gene expression of selenoproteins at low level (GPx3, DIO3) or even undetectable (DIO2, Sel V) in ATDC5 cells was found in C28/I2 cells at a high level. Different expression profile of selenoproteins observed in mouse and human chondrocytes may be caused by the difference of species and chondrocyte differentiation stages, or the limitation of in vitro cellular model. Further in vivo investigation will be under way to elucidate these differences. Then, the effects of Se on gene expression of selenoproteins were performed by real-time PCR assay
123
Biometals (2013) 26:285–296
Fig. 7 De novo protein synthesis is involved in Se-mediated mRNA expression levels of selenoproteins in ATDC5 cells. Cells cultured at Se-deficient condition (DMEM/F12 supplemented with 1 %FBS) were supplemented with (a) or without (b) sodium selenite (Se) for 24 h and then adding 10 lg/ml CHX for further 6 h. Total RNA was isolated for relative mRNA expression levels of selenoproteins by real-time PCR assays (n = 3). CHX cycloheximide. *P \ 0.05 versus control group
through Se deprivation and Se supplementation experiments. In the present study, Intracellular Se was depleted by serum deprivation. ATDC5 cells were cultured with low serum (even at low level of 0.5 % FBS) with little effects on cell viability and proliferation properties (data not shown). However, C28/I2 cell were more sensitive to serum deprivation and were incubated with low serum containing insulin and transferrin to generate Se-deficiency condition. Although serum deprivation introduces many variables that are not only differences in Se availability, alterations of selenoprotein transcripts after Se depletion through serum deprivation were well consistent with those in Se supplementation experiments in ATDC5 cells. The mRNA levels of eight selenoprteins (GPx1, TrxR1, Sel H, Sel M, Sel N, Sel I, Sel T, and Sel W) were down-regulated after Se depletion and each was upregulated after Se supplementation in ATDC5 cells. The Se-responsive selenoproteins (GPx1, Sel H, and Sel W) were consistent with the previous studies in mouse leukocyte and liver tissue (Carlson et al. 2009; Sunde et al. 2009). However, gene expression of two
Biometals (2013) 26:285–296
selenoproteins (SPS2 and Sel O) was up-regulated by Se depletion and down-regulated by Se addition in ATDC5 cells. This may serve as a negative feedback, since SPS2 is an enzyme responsible for the biosynthesis of selenoproteins (Xu et al. 2007). Yet, Sel O needs to be functionally characterized. Three selenoproteins (Sel P, Sel R, and Sel S) which were not or up-regulated under Se-deficient condition, all were up-regulated by Se supplementation in ATDC5 cells. In consideration of the stress-related properties of Sel R and Sel S, they may be up-regulated by serum deprivation under Se-deficient condition (Carlson et al. 2007). One selenoprotein TrxR2 was down-regulated under both Se-deficient and Se-supplemented condition in ATDC5 cells. This unexpected finding was not observed previously. Expression levels of the other selenoproteins including GPx4 were not affected by Se in ATDC5 cells. To verify these observations, Se effects on gene expression of selenoproteins were further investigated in C28/I2 cells by Se supplementation study. The six up-regulated selenoproteins (GPx1, GPx3, Sel H, Sel N, Sel P, and Sel W) except GPx3 and two down-regulated selenoprotein (SPS2 and Sel O) by Se in C28/I2 cells were also observed in ATDC5 cells. However, other modestly Seresponsive selenoproteins in ATDC5 cells were not affected by Se in C28/I2 cells. In summary, gene expression of fourteen selenoproteins and eight selenoproteins was affected by Se status in ATDC5 cells and C28/I2 cells, respectively. Although further in vivo studies are required, this observation has some difference with the previous studies that most selenoprotein transcripts are not affected by Se status (Mallonee et al. 2011; Sunde and Raines 2011; Kipp et al. 2012). Moreover, Se induced maximum expression of Sel H and GPx1, Sel W at concentration of 15 and 45 nM, respectively, and Se inhibited gene expression of SPS2 and Sel O after 1 h and 6 h incubation, respectively. These observations suggest that there must be specific mechanisms within chondrocytes to channel Se for the synthesis of the different selenoproteins. Finally, the possible mechanisms underlying Se-responsive selenoproteins in ATCD5 cells were further investigated through transcription inhibition and new protein synthesis inhibition assay. It was found that Se affected gene expression of GPx1, TrxR1 TrxR2, SPS2, Sel O, and Sel S partially at transcriptional level. However, Se affected gene expression of Sel H, Sel I, Sel M, Sel N, Sel P, Sel R, Sel T, and Sel W mainly at posttranscriptional level.
295
Furthermore, new protein synthesis inhibition had slight effect on gene expression of Se-responsive selenoproteins (except TrxR2 and Sel H) under Se-supplemented condition. However, new protein synthesis inhibition up-regulated expression levels of Se-responsive selenoproteins (including GPx1, TrxR1, TrxR2, Sel H, Sel O, Sel P, Sel R, and Sel W) under Se-deficiency condition. These preliminary results indicated that Se-mediated new protein synthesis also plays a role in gene expression of certain selenoproteins. The biosynthesis of selenoprotein is a complex process. Multiple levels of regulation are involved in the hierarchical regulation of selenoprotein synthesis under Se deprivation/repletion in different tissues (Papp et al. 2007). This complex pattern is still elusive and remains to be determined. Although the identified Se-responsive selenoproteins contribute to the maintenance of redox homeostasis (Steinbrenner and Sies 2009), mitochondrial function (Handy et al. 2009), and cell proliferation (Hawkes et al. 2009), their functions in chondrocytes are largely unknown. This study described the selenoprotein transcriptome and identified the Se-responsive selenoproteins in chondrocyte ATDC5 and C28/I2. These findings provide the groundwork for future studies designed to uncover the roles of individual selenoproteins in cartilage function. Acknowledgments The research was funded by National Natural Science Foundation of China (31000608 and 30630058) and China Postdoctoral Science Foundation funded project (20090461302).
References Bellinger FP, Raman AV, Reeves MA, Berry MJ (2009) Regulation and function of selenoproteins in human disease. Biochem J 422:11–22 Carlson BA, Moustafa ME, Sengupta A, Schweizer U, Shrimali R, Rao M, Zhong N, Wang S, Feigenbaum L, Lee BJ, Gladyshev VN, Hatfield DL (2007) Selective restoration of the selenoprotein population in a mouse hepatocyte selenoproteinless background with different mutant selenocysteine tRNAs lacking Um34. J Biol Chem 282: 32591–32602 Carlson BA, Yoo MH, Sano Y, Sengupta A, Kim JY, Irons R, Gladyshev VN, Hatfield DL, Park JM (2009) Selenoproteins regulate macrophage invasiveness and extracellular matrix-related gene expression. BMC Immunol 10:57 Challa TD, Rais Y, Ornan EM (2010) Effect of adiponectin on ATDC5 proliferation, differentiation and signaling pathways. Mol Cell Endocrinol 323:282–291
123
296 Downey CM, Horton CR, Carlson BA, Parsons TE, Hatfield DL, Hallgrı´msson B, Jirik FR (2009) Osteo-chondroprogenitorspecific deletion of the selenocysteine tRNA gene, Trsp, leads to chondronecrosis and abnormal skeletal development: a putative model for Kashin–Beck disease. PLoS Genet 5:e1000616 Finger F, Scho¨rle C, Zien A, Gebhard P, Goldring MB, Aigner T (2003) Molecular phenotyping of human chondrocyte cell lines T/C-28a2, T/C-28a4, and C-28/I2. Arthritis Rheum 48:3395–3403 Gao X, Xing H, Li S, Li J, Ying T, Xu S (2012) Selenium regulates gene expression of selenoprotein W in chicken gastrointestinal tract. Biol Trace Elem Res 145:181–188 Goldring MB, Birkhead JR, Suen LF, Yamin R, Mizuno S, Glowacki J, Arbiser JL, Apperley JF (1994) Interleukin-1 beta-modulated gene expression in immortalized human chondrocytes. J Clin Invest 94:2307–2316 Handy DE, Lubos E, Yang Y, Galbraith JD, Kelly N, Zhang YY, Leopold JA, Loscalzo J (2009) Glutathione peroxidase-1 regulates mitochondrial function to modulate redox-dependent cellular responses. J Biol Chem 284:11913–11921 Hawkes WC, Wang TT, Alkan Z, Richter BD, Dawson K (2009) Selenoprotein W modulates control of cell cycle entry. Biol Trace Elem Res 131:229–244 Hesketh J (2008) Nutrigenomics and selenium: gene expression patterns, physiological targets, and genetics. Annu Rev Nutr 28:157–177 Hoffmann PR, Ho¨ge SC, Li PA, Hoffmann FW, Hashimoto AC, Berry MJ (2007) The selenoproteome exhibits widely varying, tissue-specific dependence on selenoprotein P for selenium supply. Nucleic Acids Res 35:3963–3973 Iwamoto T, Nakamura T, Doyle A, Ishikawa M, de Vega S, Fukumoto S, Yamada Y (2010) Pannexin 3 regulates intracellular ATP/cAMP levels and promotes chondrocyte differentiation. J Biol Chem 285:18948–18958 Kipp AP, Banning A, van Schothorst EM, Me´plan C, Coort SL, Evelo CT, Keijer J, Hesketh J, Brigelius-Flohe´ R (2012) Marginal selenium deficiency down-regulates inflammation-related genes in splenic leukocytes of the mouse. J Nutr Biochem 23:1170–1177 Ko¨hrle J, Jakob F, Contempre´ B, Dumont JE (2005) Selenium, the thyroid, and the endocrine system. Endocr Rev 26: 944–984 Mallonee DH, Crowdus CA, Barger JL, Dawson KA, Power RF (2011) Use of stringent selection parameters for the identification of possible selenium-responsive marker genes in mouse liver and gastrocnemius. Biol Trace Elem Res 143:992–1006 Mistry HD, Broughton Pipkin F, Redman CW, Poston L (2012) Selenium in reproductive health. Am J Obstet Gynecol 206:21–30 Pan Q, Huang K, He K, Lu F (2008) Effect of different selenium sources and levels on porcine circovirus type 2 replication in vitro. J Trace Elem Med Biol 22:143–148
123
Biometals (2013) 26:285–296 Papp LV, Lu J, Holmgren A, Khanna KK (2007) From selenium to selenoproteins: synthesis, identity, and their role in human health. Antioxid Redox Signal 9:775–806 Pufe T, Harde V, Petersen W, Goldring MB, Tillmann B, Mentlein R (2004) Vascular endothelial growth factor (VEGF) induces matrix metalloproteinase expression in immortalized chondrocytes. J Pathol 202:367–374 Rackham O, Shearwood AM, Thyer R, McNamara E, Davies SM, Callus BA, Miranda-Vizuete A, Berners-Price SJ, Cheng Q, Arne´r ES, Filipovska A (2011) Substrate and inhibitor specificities differ between human cytosolic and mitochondrial thioredoxin reductases: implications for development of specific inhibitors. Free Radic Biol Med 50:689–699 Reeves MA, Hoffmann PR (2009) The human selenoproteome: recent insights into functions and regulation. Cell Mol Life Sci 66:2457–2478 Schepman K, Engelbert RH, Visser MM, Yu C, de Vos R (2011) Kashin–Beck disease: more than just osteoarthrosis: a cross-sectional study regarding the influence of body function-structures and activities on level of participation. Int Orthop 35:767–776 Shukunami C, Shigeno C, Atsumi T, Ishizeki K, Suzuki F, Hiraki Y (1996) Chondrogenic differentiation of clonal mouse embryonic cell line ATDC5 in vitro: differentiationdependent gene expression of parathyroid hormone (PTH)/ PTH-related peptide receptor. J Cell Biol 133:457–468 Steinbrenner H, Sies H (2009) Protection against reactive oxygen species by selenoproteins. Biochim Biophys Acta 1790:1478–1485 Stone R (2009) Diseases. A medical mystery in middle China. Science 324:1378–1381 Sugita A, Kawai S, Hayashibara T, Amano A, Ooshima T, Michigami T, Yoshikawa H, Yoneda T (2011) Cellular ATP synthesis mediated by type III sodium-dependent phosphate transporter Pit-1 is critical to chondrogenesis. J Biol Chem 286:3094–3103 Sunde RA, Raines AM (2011) Selenium regulation of the selenoprotein and nonselenoprotein transcriptomes in rodents. Adv Nutr 2:138–150 Sunde RA, Raines AM, Barnes KM, Evenson JK (2009) Selenium status highly regulates selenoprotein mRNA levels for only a subset of the selenoproteins in the selenoproteome. Biosci Rep 29:329–338 Woods A, Wang G, Beier F (2005) RhoA/ROCK signaling regulates Sox9 expression and actin organization during chondrogenesis. J Biol Chem 280:11626–11634 Xu XM, Carlson BA, Irons R, Mix H, Zhong N, Gladyshev VN, Hatfield DL (2007) Selenophosphate synthetase 2 is essential for selenoprotein biosynthesis. Biochem J 404:115–120 Yuan JS, Reed A, Chen F, Stewart CN Jr (2006) Statistical analysis of real-time PCR data. BMC Bioinformatics 7:85 Zou K, Liu G, Wu T, Du L (2009) Selenium for preventing Kashin–Beck osteoarthropathy in children: a meta-analysis. Osteoarthritis Cartilage 17:144–151
