Selenium Supplementation Restores the Antioxidative Capacity and ...

TISSUE-SPECIFIC STEM CELLS Selenium Supplementation Restores the Antioxidative Capacity and Prevents Cell Damage in Bone Marrow Stromal Cells In Vitro REGINA EBERT,a MATTHIAS ULMER,a SABINE ZECK,a JUTTA MEISSNER-WEIGL,a DORIS SCHNEIDER,a HELGA STOPPER,b NICOLE SCHUPP,b MOUSTAPHA KASSEM,c FRANZ JAKOBa a

Musculoskeletal Research Center, Orthopaedic Department, University of Wu¨rzburg, Wu¨rzburg, Germany; Institute of Pharmacology and Toxicology, University of Wu¨rzburg, Wu¨rzburg, Germany; cDepartment of Endocrinology, University Hospital of Odense, Odense, Denmark

b

Key Words. Bone marrow stromal cells • Reactive oxygen species • Micronuclei • Selenoproteins • Tissue engineering

ABSTRACT Bone marrow stromal cells (BMSCs) and other cell populations derived from mesenchymal precursors are developed for cell-based therapeutic strategies and undergo cellular stress during ex vivo procedures. Reactive oxygen species (ROS) of cellular and environmental origin are involved in redox signaling, cumulative cell damage, senescence, and tumor development. Selenium-dependent (glutathione peroxidases [GPxs] and thioredoxin reductases [TrxRs]) and selenium-independent (superoxide dismutases [SODs] and catalase [CAT]) enzyme systems regulate cellular ROS steady state levels. SODs process superoxide anion to hydrogen peroxide, which is subsequently neutralized by GPx and CAT; TrxR neutralizes other ROS, such as peroxinitrite. Primary BMSCs and telomerase-immortalized human mesenchymal stem cells (hMSC-TERT) express GPx1–3, TrxR1, TrxR2, SOD1, SOD2, and CAT. We show here that in standard cell cultures (5%–10% fetal calf serum, 5–10 nM

selenite), the activity of antioxidative selenoenzymes is impaired in hMSC-TERT and BMSCs. Under these conditions, the superoxide anion processing enzyme SOD1 is not sufficiently stimulated by an ROS load. Resulting oxidative stress favors generation of micronuclei in BMSCs. Supplementation of selenite (100 nM) restores basal GPx and TrxR activity, rescues basal and ROS-stimulated SOD1 mRNA expression and activity, and reduces ROS accumulation in hMSC-TERT and micronuclei generation in BMSCs. In conclusion, BMSCs in routine cell culture have low antioxidative capacity and are subjected to oxidative stress, as indicated by the generation of micronuclei. Selenite supplementation of BMSC cultures appears to be an important countermeasure to restore their antioxidative capacity and to reduce cell damage in the context of tissue engineering and transplantation procedures. STEM CELLS 2006;24: 1226 –1235

INTRODUCTION

therapy expose cells to considerable oxidative stress. Oxidative stress causes damage of the genome and proteome and promotes senescence, aging, and tumorigenesis [9 –23]. The biological relevance of oxidative stress for the survival and self-renewal capacity of in this case hematopoetic stem cells has recently been stressed by the fact that in stem cells defective in the cell cycle checkpoint activator ataxia telangiectasia mutated [24], the self renewal capacity can be enhanced by antioxidative substances such as N-acetyl-cysteine treatment but not by telomerase overproduction. Reactive oxygen species are produced within a cell by several enzyme systems involved in respiratory burst reactions (e.g., NADPH oxidases), by NO synthesis, and by several signaling

Bone marrow stromal cells (BMSCs) can give rise to differentiation of terminally differentiated mesenchymal cells, such as osteoblasts, chondrocytes, myotubes, and adipocytes. Mesenchymal stem cells (MSCs) can give rise to a transient amplifying cell pool, which in the context of many reviews and experiments is also termed MSCs, but probably should rather be called mesenchymal precursors or a similar term. They can be readily isolated from various sources and are developed for cell-based regenerative therapies, such as tissue engineering of bone and cartilage [1–5]. Precursor cells of any kind are as well used as target cells for gene therapy [6 – 8]. In vivo and especially ex vivo procedures required for both tissue engineering and gene

Correspondence: Franz Jakob, M.D., Musculosceletal Research Center, Orthopaedic Department, University of Wu¨rzburg, Brettreichstrasse 11, D-97074 Wu¨rzburg, Germany. Telephone: 0049-931-8031500; Fax: 0049-931-8031599; e-mail: f-jakob.klh @mail.uni-wuerzburg.de Received March 16, 2005; accepted for publication January 7, 2006; first published online in STEM CELLS EXPRESS January 19, 2006. ©AlphaMed Press 1066-5099/2006/$20.00/0 doi: 10.1634/stemcells.2005-0117

STEM CELLS 2006;24:1226 –1235 www.StemCells.com

Ebert, Ulmer, Zeck et al. cascades. The products generated are involved in procedures of hormone synthesis (e.g., thyroid hormones and steroid hormones [9]), vessel relaxation, redox regulation of multiple promoters and—if not sufficiently compartmentalized or in case of spillover—in damage of the genome and proteome of cells [10 –11]. SOD synthesizes hydrogen peroxide from superoxide radicals. Isoenzymes contain copper, zinc (SOD1 and the extracellular isoenzyme SOD3), iron, manganese (SOD2), and nickel (bacteria) in their active centers [25]. Deficiency, as well as overproduction, of SOD1 is associated with diseases such as anemia, cystic fibrosis, and amyotrophic lateral sclerosis [26]; SOD2 knockout in Drosophila is lethal early after hatching or causes early adult onset mortality due to enhanced sensitivity against various stress mediators, oxygen, and toxins [27–32]. SOD1 and SOD2 cannot substitute for each other [33]. SOD1 mRNA is constitutively expressed and regulated by hydrogen peroxide and other substances. Identified promoter response elements comprise sites for Sp-1, C/EBP, Egr-1, WT-1, AP2, a xenobiotic response element, and an antioxidant response element [25, 34 – 40]. Hydrogen peroxide produced by SOD enzymes from superoxide anion and water is neutralized to H2O by glutathione peroxidases (GPxs), thioredoxin reductases (TrxRs), and catalase. Four GPx enzymes and three TrxR enzymes are seleniumdependent, carrying selenocysteine in their active centers. Selenocysteine, the 21st amino acid, is encoded by the opal stop codon UGA, which in the presence of a 3⬘ hairpin loop structure is translated as selenocysteine and incorporated into proteins [9]. Selenium deficiency leads to translation of truncated proteins. There is a well-characterized protein- and organ-related hierarchy in selenium incorporation and retention; for example, TrxR ranks high compared with cellular GPx (cGPx; GPx1) and plasma GPx (pGPx; GPx3) at the protein level (due to the affinity of selenocysteine insertion sequence [SECIS] binding proteins to the individual SECIS element of a selenoprotein), and brain and testis rank high compared with other organs [9]. The expression of various selenoproteins is modulated by selenite both at the transcription and the translation level [41– 44]. Recently, the human selenoprotein genome has been described to comprise 25 human selenoproteins as indicated by a whole genome screen searching for SECIS elements within the 3⬘untranslated regions of open reading frames [42]. Formation of micronuclei is a biomarker of DNA damage. The micronucleus assay has emerged as one of the preferred methods to assess chromosome damage, and the method is now widely applied for population monitoring of genetic damage (e.g., for studying nutrigenomics and chromosomal instability, to assess the individual oxidative burden in kidney insufficiency and long-term hemodialysis, for screening of chemicals for genotoxic potential, and for the prediction of interindividual variations in radiosensitivity [12–16]). The connection between oxidative load and the formation of micronulei is being fostered by a recent report in which overexpression of the antioxidant thioredoxin (the main substrate of TrxR) in fibroblasts of patients suffering from Fanconi anemia (a disorder in which high concentrations of superoxides are responsible for DNA damage) protects cells from mitomycin C-induced micronuclei formation [17, 18]. Cumulative damage contributes to aging processes of the organism and to cellular fail-safe programs such as cellular senescence, as has been indirectly shown in transgenic animals, www.StemCells.com

1227

in which overexpression of single and combined components of antioxidative systems influenced longevity [19 –23]. We have previously reported on the expression of various selenoproteins in bone cells and cells of the myelomonocytic pathway of differentiation [45– 47], but little is known about the expression and role of antioxidant systems in stem cells or in cells of the transient proliferating pool derived from them, or of their effectivity to scavenge the genome and proteome of these cells during ex vivo procedures. We now used BMSC cultures and the recently established telomerase-immortalized human mesenchymal stem cell line (hMSC-TERT) [48] to demonstrate that their antioxidative capacity under standard (selenium-deficient) cell culture conditions is impaired and to show biological consequences in terms of intracellular production of reactive oxygen species and formation of micronuclei. Selenite supplementation of culture media was capable of restoring the antioxidative capacity of BMSCs and of reducing intracellular ROS production and stress-related generation of micronuclei.

MATERIALS

AND

METHODS

Cell Culture Media for cell culture and fetal calf serum (FCS) were obtained from PAA Laboratories (Linz, Austria, http://www.paa.at). hMSC-TERT cells were produced and cultured as described [48]. Cells were cultured in Earle’s minimum essential medium containing 10% FCS. BMSCs were isolated from bone marrow from different donors and cultivated up to seven passages by a standardized protocol [5, 49]. Bone marrows were recovered in informed consent from the explanted femoral heads of patients undergoing elective hip arthroplasty. The procedure was approved by the local Ethics Committee of the University of Wu¨rzburg. Briefly, bone marrow preparations were washed with medium (Dulbecco’s modified Eagle’s medium [DMEM]-F12 supplemented with 10% FCS, penicillin/streptomycin, and 50 ␮g/mlascorbate[Sigma-Aldrich,St.Louis,http://www.sigmaaldrich. com]), and centrifuged at 100 rpm for 5 minutes. The pellet was reconstituted in medium and washed four times, and the supernatants of the washing steps containing the released cells were collected. Cells were centrifuged and cultivated at a density of 3 ⫻ 108 cells per 150-cm2 culture flask at 37°C in 5% CO2. Adherent cells were washed after 2 days and cultivated until confluency with or without 100 nM sodium selenite supplementation (Sigma-Aldrich). Upon establishment of the protocol in our laboratory, we again characterized the BMSC population obtained by fluorescence-activated cell sorting (FACS) analyses and were able to exclude expression of hematopoetic markers (CD14 and CD45; data not shown). The chondrogenic and osteogenic differentiation potential of these BMSCs was repeatedly characterized [50]. Starting with passage 1 after confluence of the first 150-cm2 flask cell numbers were determined, an equal number of selenium-deficient and selenium-supplemented cells were seeded into new 150-cm2 flasks (1.8 ⫻ 105 to 1.8 ⫻ 106), and cell doubling rates were calculated. THP1 cells (human monocytic leukemia cells) were grown in RPMI 1640 medium containing 10% FCS, and human fetal osteoblasts (hFOBs; obtained from T. Spelsberg [51]) and HepG2 cells (human hepatocarcinoma cells) were cultivated in DMEM-F12 containing 10% FCS. All cells were grown at 37°C, (except hFOB cells, which were grown at 34°C), in a humidified atmosphere consisting of 5% CO2 and 95% air.

1228

GPx Assay Cells were sonicated in buffer containing 250 mM sucrose, 20 mM HEPES, and 1 mM EDTA, pH 7.4. GPx activity was assayed by the method of Dreher using tertiary butyl hydroperoxide as the substrate, as described previously [52]. Cytosols of the cells were added to the reaction mixture in a final volume of 1 ml (0.1 M Tris, 0.5 mM EDTA, pH 8, 200 mM NADPH [Roche Diagnostics, Mannheim, Germany, http://www.rocheapplied-science.com], 2 mM glutathione, 1 U/ml glutathione reductase). The reaction was started by the addition of 7 ␮M tertiary butyl hydroperoxide. After an initial incubation period of 1–1.5 minutes, the oxidation of NADPH was registered at 340 nm, within the linear range of the reaction for 3 minutes. The activity of GPx was expressed as nanomoles of NADPH oxidized per minutes and mg of protein. Unspecific NADPH oxidation was measured by the complete inhibition of GPx by the addition of 100 mM of the GPx inhibitor mercaptosuccinate to the incubation mixture before starting the reaction. The background values were subtracted from the results obtained. Each measurement was obtained in duplicate. Protein content of cell extracts was determined by using Rotiquant Protein Assay (Carl Roth GmbH, Karlsruhe, Germany, http://www.carl-roth.de). All chemicals were obtained from Sigma-Aldrich.

Oxidative Stress in Bone Marrow Stromal Cells tained. Each measurement was obtained in duplicate. Protein content of cell extracts was determined by using the Rotiquant Protein Assay (Carl Roth GmbH).

Reverse Transcription-Polymerase Chain Reaction Total RNA was isolated from hMSC-TERT cells, primary BMSCs obtained from different donors, hFOB, HepG2, and THP1 cells as controls using the NucleoSpin RNA II kit (MachereyNagel, Du¨ren, Germany, http://www.macherey-nagel.de) according to the manufacturer’s instructions. Two micrograms of total RNA was reverse-transcribed with Moloney murine leukemia virus reverse transcriptase (Promega, Mannheim, Germany, http://www.promega.com) in a volume of 20 ␮l. For polymerase chain reaction (PCR), 1 ␮l of cDNA was used as a template in a volume of 50 ␮l. Taq DNA polymerase was obtained from Qiagen (Hilden, Germany, http://www1.qiagen. com). DNA fragments were amplified by using a standard protocol. PCR conditions were as follows: 30 seconds at 94°C, 30 seconds at annealing temperature, 60 seconds at 72°C; 40 cycles. The sequences of the primers used, annealing temperatures, MgCl2 concentrations, and the sizes of the PCR products are listed in Table 1.

Real-Time PCR TrxR Assay TrxR activity was measured as described previously [53]. Cells were sonicated in 1 mM EDTA, 50 mM Tris, pH 7.5. TrxR activity was determined in a volume of 0.5 ml containing 100 mM potassium phosphate, pH 7.0, 10 mM EDTA, 0.2 mM NADPH, and 2.5 mM 5,5⬘-dithio-bis nitrobenzoic acid. Reactions were started by adding 100 ␮l of cell extract. The change in absorption was monitored at 412 nm for 2 minutes. All chemicals were obtained from Sigma-Aldrich. Protein content of cell extracts was determined using Rotiquant Protein Assay (Carl Roth GmbH). The activity of TrxR was expressed as milliunits per milligram of protein.

SOD Assay For the determination of SOD activity, hMSC-TERT cells were cultivated with or without selenite supplementation. Cells were harvested in 50 mM potassium phosphate buffer (pH 7.8) and sonicated, and cytosols were used for the SOD assay. We used the bathocuproine sulfonate-nitroblue tetrazolium (NBT) test described by Beauchamp et al. [54, 55] and Spitz and Oberley [56]. The main principle of the test is the reduction of NBT to blue formazan by superoxide anions, which can be measured at 560 nm at room temperature. The underlying reaction is a competition between SOD and NBT for O2– radicals, which are generated by a xanthine-xanthine-oxidase system. The rate of NBT reduction in the absence of SOD is taken as the reference value. In a final volume of 1 ml, 50 mM potassium phosphate buffer, pH 7.8, 1 mM diethylenetriaminepentaacetic acid, 1 U of catalase, 56 nM NBT, 0.1 mM xanthine, and 50 nM bathocuproine disulfonate disodium salt were mixed, and reaction was started by adding 20 ␮l of cell extract. To differentiate between SOD1 and SOD2 activity, samples were incubated in an additional reaction with 5 mM NaCN for 45 minutes to block SOD1 activities. All chemicals were obtained from Sigma-Aldrich. The background values were subtracted from the results ob-

For monitoring SOD1 mRNA expression in hMSC-TERT cells and primary BMSCs and to confirm its regulation by selenite supplementation and H2O2, a real-time PCR protocol was established. Cells were cultivated with or without 100 nM selenite for at least 1 week and stimulated with or without 50 ␮M H2O2 for up to 8 h. One microliter of cDNA was used for SOD1 and EF1␣ amplification as a housekeeping gene. PCR conditions were as follows: 30 seconds at 94°C, 30 seconds at annealing temperature, 60 seconds at 72°C (see Table 1 for PCR conditions). Real-time PCR was performed with the DNA Engine Opticon system (MJ Research, Waltham, MA, http://www.mjr. com) using SYBR Green (Biozym Scientific GmbH, Hessisch Oldendorf, Germany, http://www.biozym.com) as fluorescent dye. For quantification and statistical analyses, SOD1 mRNA expression was normalized to the expression levels of the housekeeping gene EF1␣ using the relative expression software tool (REST) [57]. Specificity of SOD1 amplicons were confirmed by melting curve analyses.

Western Blot HMSC-TERT cells were cultivated with or without 100 nM selenite and stimulated with or without 50 ␮M H2O2 as described above. Cells were harvested in homogenization buffer (50 mM Tris, 1 mM EDTA, 1 mM Pefabloc, 1 mM dithiothreitol). The protein content was determined using the Rotiquant (Carl Roth GmbH) protein assay. Twenty micrograms of protein were boiled for 5 minutes in SDS-polyacrylamide gel electrophoresis buffer (100 mM Tris, pH 6.8, 7.5% glycerol, 1% SDS, 0.025% bromphenol blue) and separated by SDS gel electrophoresis. Proteins were transferred to Optitran BA S 85 membranes (Schleicher and Schuell, Dassel, Germany, http://www. whatman.com). The membranes were treated with a buffer containing 0.1% Tween 20, 2% horse serum, 2.5% bovine serum albumin (BSA), 2.5% milk powder in phosphate-buffered saline (PBS) for 2 hours to inhibit nonspecific binding. Then, the membranes were incubated in 0.1% Tween 20, 1% horse serum,

Ebert, Ulmer, Zeck et al.

1229

Table 1. Primers used for reverse transcription polymerase chain reaction Primer name TrxR1 sense TrxR1 antisense TrxR2 sense TrxR2 antisense cGPx sense cGPx antisense GI-GPx sense GI-GPx antisense pGPx sense pGPx antisense PH-GPx sense PH-GPx antisense SeP sense SeP antisense SOD1 sense SOD1 antisense SOD2 sense SOD2 antisense CAT sense CAT antisense EF1␣ sense EF1␣ antisense

Sequence 5ⴕ 3 3ⴕ

Product size (bp)

Annealing temperature (°C)

TCGCTTTGGAGTGCGCTGGA GATTGCAACTGGGGTGAGCT ATGCGCAGGTGATGCGGACCGTG GTCGTCATCATCTGGCACCAGGAG ATGTGTGCTGCTCGGCTAGC GCCGGACGTACTTGAGGGAA TCACTCTGCGCTTCACCATG AGCAGTTCACATCTATATGGC GGACAAGAGAAGTCGAAGATG GATGTCGTGAACCTTCATGGGTTC TGTGCGCGCTCCATGCACGAGT AAATAGTGGGGCAGGTCCTTCTCT GGCCCGTTGGAAGTGGTTGT CCTAGGAGCCAACTCTGAAT TGAAGGTGTGGGGAAGCATTA TTACACCACAAGCCAAACGAC TGTTGAGCCGGGCAGTGT CTCCCAGTTGATTACATTC TTTGGCTACTTTGAGGTCAC TCCCCATTTGCATTAACCAG AGGTGATTATCCTGAACCATCC AAAGGTGGATAGTCTGAGAAGC

439

58

2

381

62

1.5

300

58

2

601

63

2.5

467

62

2

481

68

2

926

60

2.5

359

60

2

631

55

1.5

439

53

1.5

234

54

1.5

MgCl2 (mM)

Designations and sequences of the primers used are shown with the corresponding product sizes, annealing temperatures, and concentrations of MgCl2. Abbreviations: bp, base pair(s); CAT, catalase; cGPx, cellular glutathione peroxidase; GI-GPx, gastrointestinal glutathione peroxidase; pGPx, plasma glutathione peroxidase; SeP, selenoprotein P; SOD, superoxide dismutase; TrxR, thioredoxin reductase.

and 1% milk powder in PBS with a monoclonal antibody against SOD1 (Santa Cruz Biotechnology Inc., Heidelberg, Germany, http://www.scbt.com). Membranes were washed with 10 mM Tris, pH 7.5, 140 mM NaCl, 2 mM EDTA, 0.1% Triton X-100, 1% horse serum, 1% BSA, and 1% milk powder, followed by incubation with horseradish peroxidase-conjugated goat antimouse IgG antibody (Sigma-Aldrich) using a solution containing 0.1% Tween 20, 1% horse serum, 1% BSA, and 1% milk powder in PBS. The expression of SOD1 was detected by using the enhanced chemiluminescence system (Amersham Biosciences, GE Healthcare Life Sciences, Freiburg, Germany, http://www.amersham.com).

Determination of Reactive Oxygen Species In hMSC-TERT cells cultivated with or without 100 nM selenite, the accumulation of reactive oxygen species (ROS) was determined using 2⬘7⬘-dichlorodihydrofluorescin diacetate (H2DCF-DA) (Invitrogen, Karlsruhe, Germany, http://www. invitrogen.com), a nonfluorescent lipid permeable compound that is oxidized by intracellular ROS to form the impermeable fluorescent compound DCF [58 – 60]. Cells were treated with 30 ␮M dichlorofluorescein diacetat (DCFH-DA) for 30 minutes, trypsinized, and washed twice with PBS, 1% BSA. DCF fluorescence was determined by FACS analyses using a FACS cytometer (BD LSR I; Becton, Dickinson and Company, Heidelberg, Germany, http://www.bd.com) at an excitation wavelength of 488 nm and a 530 nm emission filter bandpassed for DCF. For analyzing the flow cytometry histograms, the free software WinMDI version 2.8 (Scripps Research Institute Cytometry Software, http://facs. scripps.edu/software.html) was used. www.StemCells.com

Micronucleus Assay Primary BMSCs were cultivated with or without 100 nM selenite on glass slides for up to four passages until confluence. Cells were fixed with methanol at –20°C for 4 hours. For staining of the nuclei and micronuclei, cells were incubated with staining solution (0.006% acridine orange [Sigma-Aldrich] in Sørensen buffer [15 mM Na2HPO4, 15 mM KH2PO4]) for 3 minutes, washed twice with Sørensen buffer for 5 minutes each, and mounted for microscopy [12–14]. Cells were analyzed with a Zeiss Axioskop 2 fluorescence microscope (Carl Zeiss, Go¨ttingen, Germany, http://www.zeiss.com), and nuclei and micronuclei were counted in a blinded fashion. Each MSC population was analyzed by evaluating three sets of 1,000 nuclei. Photographs were taken with an AxioCam MRc camera and the AxioVision 4.0 software (Carl Zeiss).

RESULTS Expression Profile of Antioxidative Enzyme Systems in Primary BMSCs and hMSC-TERT Cells Both primary BMSCs obtained from different subjects and hMSC-TERT cell cultures expressed a broad variety of antioxidative enzyme systems and selenoproteins, as determined by reverse transcription-PCR analyses (Fig. 1, lanes 2– 6). As a control, the genes of interest were also amplified from THP1 (monocytic), hFOB, and HepG2 (hepatocarcinoma) cells (lanes 7–9). The selenoproteins TrxR1 and TrxR2, cGPx, phospholipid-hydroperoxide glutathione peroxidase, and the nonselenoproteins SOD1, SOD2, and catalase were expressed in equal amounts in all samples analyzed. The pGPx could be detected in

1230

Oxidative Stress in Bone Marrow Stromal Cells hMSC-TERT cells (lane 2– 6). The selenoproteins thioredoxin glutathione reductase (TGR, TrxR3) and glutathione peroxidase 6 (GPx6) could not be detected in all samples (data not shown). As a control, the housekeeping gene EF1␣ was amplified.

GPx and TrxR Activity in hMSC-TERT Cells and BMSCs When cultured in the presence of 100 nM sodium selenite, both the activities of GPx and TrxR were considerably enhanced in BMSCs and hMSC-TERT cells. BMSCs show basal GPx activities ranging between 50 and 80 mU/mg protein, varying between different subjects (Fig. 2A). The activity could be enhanced 1.8-fold by cultivating cells in the presence of 100 nM selenite. The stimulation varied between different subjects. The basal GPx activity of hMSC-TERT cells is much lower and ranges between 6 and 7 mU/mg protein. Activity could be stimulated twofold in the presence of selenite. BMSCs showed basal TrxR activity between 9 and 100 mU/mg protein, varying between different subjects (Fig. 2B). Activity could be enhanced 1.5-fold by cultivating the cells in the presence of 100 nM selenite, with a variation between different subjects. HMSC-TERT cells show a basal TrxR activity of 22 mU/mg protein. A 1.4-fold stimulation could be also determined after selenite supplementation.

ROS Accumulation in hMSC-TERT Cells To obtain reproducible results, avoid individual biases, and get sufficient amounts of cells, we used hMSC-TERT cells to measure the accumulation of ROS in selenium adequate (100 nM selenite) versus selenium-deficient cultures. The determination of ROS accumulation in hMSC-TERT cells showed a higher ROS load in selenite-deficient cells (Fig. 2C, left panel, gray line) compared with selenite-supplemented cells (black line). The selenium-deficient hMSC-TERT cells showed a DCFH-DA fluorescence intensity median of 14.75 (Fig. 2C, right panel, gray bar), which was significantly reduced to 6.03 in seleniumsupplemented cells (black bar). Figure 1. Reverse transcription-polymerase chain reaction expression profile of antioxidative enzyme systems in hMSC-TERT (lane 2) and primary BMSCs (lanes 3– 6). BMSCs were obtained from four different subjects (BMSC53, BMSC73, BMSC113, and BMSC158). cDNAs from THP1 (human monocytic leukemia), hFOB, and HepG2 (hepatocarcinoma) cells were used for comparison and positive controls (lanes 7–9). Experiments were done in triplicates, and a representative result is shown. Abbreviations: BMSC, bone marrow stromal cell; CAT, catalase; cGPx, cellular glutathione peroxidase; GI-GPx, gastrointestinal GPx; hFOB, human fetal osteoblast; hMSC, human mesenchymal stem cell; pGPx, plasma GPx; PH-GPx, phospholipid-hydroperoxide GPx; SeP, selenoprotein P; SOD, superoxide dismutase; TrxR, thioredoxin reductase.

different preparations of primary BMSCs (lanes 3– 6) and in the control sample HepG2. In the more osteogenic differentiated hFOB cell line, the amplified signal was weaker, and no amplicons, or a very faint band, appeared when using cDNA from hMSC-TERT cells (lanes 2 and 7). BMSCs express selenoprotein P (SeP) in a high amount (lane 3– 6), comparable to the expression in liver cells (lane 8), whereas hMSC-TERT and hFOB cells show much weaker signals (lanes 2 and 7). The gastrointestinal glutathione peroxidase was only expressed in HepG2 cells (lane 8) but was undetectable in BMSCs and

SOD1 Regulation by Selenite and H2O2 in Primary BMSCs and hMSC-TERT Cells By performing a dot blot screening procedure on the mRNA expression of antioxidative enzymes in selenium-deficient and selenium-adequate primary BMSCs (BMSC73) and hMSCTERT cultures, we realized a marked stimulation of SOD1 mRNA species in both cell types by selenite supplementation (data not shown). As a consequence, we measured SOD1 mRNA in primary BMSCs and hMSC-TERT, and protein and activity of SOD1 in hMSC-TERT, during H2O2 stimulation in the presence and absence of 100 nM selenite. mRNA levels were determined by quantitative PCR, protein expression was determined by Western blotting, and semiquantitative densitometry and SOD1 activity was measured by using an enzymatic assay. Under selenium deficiency, SOD1 mRNA expression was modulated slightly, by 50 ␮M H2O2 after 0.5– 8 hours of treatment in hMSC-TERT cells (Fig. 3A, gray bars). SOD1 mRNA expression was significantly higher in cells cultured under adequate selenite supplementation (Fig. 3A, black bars). Under basal conditions, without H2O2 treatment, SOD1 mRNA content of selenite-supplemented cells was 1.75-fold higher than in untreated cells. After 1 hour of stimulation of cells with


1231

Figure 2. Selenoenzyme activity in hMSCTERT and primary BMSC and ROS accumulation in hMSC-TERT. GPx (A) and TrxR activity (B) of hMSC-TERT and primary BMSCs isolated from different subjects. Cells were cultivated with (black bars) or without (gray bars) 100 nM selenite supplementation. Activity assays were done in triplicates, and the results are expressed as mean ⫾ SEM. Statistical analyses were performed by using analysis of variance (ⴱ, p ⬍ .05; ⴱⴱ, p ⬍ .005). (C): Reactive oxygen species (ROS) accumulation in hMSC-TERT cells. Left: Cells were cultivated in the presence (black line) and absence (gray line) of 100 nM selenite. DCFH-DA fluorescence of cells was determined by fluorescence-activated cell sorting cytometry as an indicator of ROS accumulation within the cells. A representative result is shown. Right: Median of fluorescence intensity of seleniumdeficient (gray bar) and selenium-supplemented (black bar) hMSC-TERT cells. The experiments were repeated three times and done in triplicates. The results are shown as mean ⫾ SEM. Statistical analyses were performed by using analysis of variance (ⴱⴱ, p ⫽ .005). Abbreviations: BMSC, bone marrow stromal cell; DCFH-DA, dichlorofluorescein diacetat; GPx, glutathione peroxidase; hMSC-TERT, telomerase-immortalized human mesenchymal stem cell; n.s., not significant; TrxR, thioredoxin reductase.

H2O2, SOD1 mRNA was markedly enhanced under adequate selenite supplementation compared with selenium-deficient cells and compared with untreated cells. In selenite-deficient primary BMSC271 and BMSC280, SOD1 mRNA expression was not modulated by 50 ␮M H2O2 treatment after 0.5–7 hours and 0.5–1 hours, respectively (Fig. 3B, gray bars). When BMSC271 and BMSC280 were supplemented with 100 nM selenite and stimulated with 50 ␮M H2O2, www.StemCells.com

SOD1 mRNA expression was significantly enhanced time-dependently and at any time point, with a maximal twofold stimulation after 0.5 and 4 hours in BMSC271 and a maximal 1.5-fold stimulation after 1 hour in BMSC280 (Fig. 3B, black bars). Values were normalized to the expression of the housekeeping gene EF1␣. SOD1 protein expression as detected by Western blotting was enhanced in hMSC-TERT cells cultivated under selenite

1232

Oxidative Stress in Bone Marrow Stromal Cells

Figure 3. SOD1 expression in hMSCTERT and primary BMSCs and activity in hMSC-TERT cells cultivated with or without 100 nM selenite and stimulated with H2O2. (A): Real-time PCR amplification of SOD1 in hMSC-TERT cultivated with (black bars) or without (gray bars) 100 nM selenite supplementation and H2O2 stimulation for 0.5– 8 h. SOD1 expression is normalized to EF1␣ as a housekeeping gene. Experiments were done in triplicates; the results are expressed as mean ⫾ SEM. Statistical analyses were performed by using the relative expression software tool (REST) [57] (ⴱ, p ⬍ .05). (B): Real-time PCR amplification of SOD1 in primary BMSC271 and BMSC280 with (black bars) or without (gray bars) 100 nM selenite supplementation and H2O2 stimulation for 0.5–7 h (BMSC271) and 0.5 and 1 h (BMSC280), respectively. SOD1 expression is normalized to EF1␣ as a housekeeping gene. Statistical analyses were performed by using the REST [57] (ⴱ, p ⬍ .05). (C): Western blot detection of SOD1 in hMSC-TERT cells cultivated with or without 100 nM selenite supplementation and stimulation with or without 50 ␮M H2O2 for 8 h. Signals were quantified by optical densitometry. Experiments were done three times, and a representative experiment is shown. White bar: No selenite, no H2O2; light gray bar: no selenite, 50 ␮M H2O2; dark gray bar: 100 nM selenite, no H2O2; black bar: 100 nM selenite, 50 ␮M H2O2. (D): SOD1 activity in hMSC-TERT cells cultivated with (black bars) or without (gray bars) 100 nM selenite supplementation and stimulation with H2O2 with 10, 25, and 50 ␮M for 8 h. Experiments were done four times, and the results are expressed as mean ⫾ SEM. Statistical analyses were performed by using analysis of variance (ⴱ, p ⬍ .05). Abbreviations: BMSC, bone marrow stromal cell; hMSC-TERT, telomerase-immortalized human mesenchymal stem cell; PCR, polymerase chain reaction; SOD, superoxide dismutase.

supplementation and stimulated with 50 ␮M H2O2 for 8 hours (Fig. 3C, black bar). In cells grown under selenium-deficient conditions, SOD1 expression was independent of H2O2 treatment. SOD1 activity was measured in hMSC-TERT cells cultivated with or without selenite supplementation and stimulation with 10, 25, and 50 ␮M H2O2 for 8 hours (Fig. 3D). In selenite-deficient cells, SOD1 activity was only slightly modulated by H2O2 treatment and ranged between 70 and 100 U/mg protein (gray bars). Under adequate selenite supplementation, hMSC-TERT cells showed a twofold enhancement of SOD1 activity after 8 hours of treatment with 10 ␮M H2O2 (black bars). Higher doses of H2O2 could not further stimulate SOD1 activity.

Micronucleus Assay in Primary BMSCs The occurrence of micronuclei (MN) as a biomarker for DNA damage was analyzed in primary BMSCs cultivated with or without 100 nM selenite. BMSCs of three donors (BMSC274, BMSC276, and BMSC278) in different passages were investigated by determining the number of MN per 1,000 cells. Of each sample, three sets of 1,000 cells were analyzed in a blinded fashion. The results are summarized in Table 2. In cells cultivated under adequate selenite concentrations, the number of MN was reduced by a mean of 40% (28.8%–58.3%) compared with cells cultivated under selenite deficiency. MN frequency varied considerably between different donors. Figure 4 shows micronuclei formation in BMSC276 cultivated under selenium-deficient conditions.

Cell Proliferation and Population Doubling We did not find a significant difference in population doubling time between selenium-supplemented and control cultures (data

not shown). As is known from the literature, primary BMSC culture could be maintained for three to seven passages independent of donor age but with a great deal of variation among individual donors. The cell doubling rates starting with passage 1 varied between 50 and 280 hours.

DISCUSSION Adult stem cells are rare cells with low proliferation capacity, which according to present hypotheses reside in stem cell niches and give rise to a transient amplifying cell pool that differentiates, thereby regenerating the respective tissues [61]. Mesenchymal stem cells can be isolated from bone marrow stroma and other sources, and the transient amplifying pool derived from it can be differentiated towards various mesenchymal pathways, for example, osteogenesis, chondrogenesis, adipogenesis and others. We used the immortalized cell line hMSC-TERT and primary cultures of BMSCs to demonstrate that cells cultured in vitro under conditions of low selenium supply show symptoms of oxidative stress and that supplementation of selenium represents an adequate countermeasure. The immortalized cell system was used to get sufficient, reproducible, and unbiased cell material, propagated under long-term low selenium culture conditions to yield significant results. The translation of the results obtained with this system into primary cultures is of course hampered by donor differences in expression levels of antioxidative systems and in nutritional selenium uptake. This is probably why differences in cellular TrxR activity in individual donor cell populations were not always significant if basal activity was individually high (Fig. 2B), whereas GPx activity was always significantly enhanced in all samples after selenium supplementation, probably due to its lower rank in protein


1233

Table 2. MN frequency per 1,000 cells in primary bone marrow stromal cells cultivated with or without 100 nM selenite Passage BMSC278 Control Selenite BMSC276 Control Selenite BMSC276 Control Selenite BMSC274 Control Selenite

MN per 1,000 cells

SEM

p value

Reduction of MN frequency (%)

17.4 12.4

⫾4.37 ⫾1.45

n.s.

28.8

39.0 24.4

⫾4.73 ⫾4.34

n.s.

37.6

28.7 16.7

⫾1.20 ⫾2.73

p ⬍ .005

41.9

80.0 33.3

⫾1.53 ⫾4.84

p ⬍ .05

58.3

2

3

4

6

Data were obtained by using cells from three donors, one in two different passages, and by counting three samples of 1,000 cells per sample each in a blinded fashion. The number of micronuclei per 1,000 cells, SEM, p values, and the reduction of MN frequency (%) after selenite supplementation are shown. Statistical analyses were performed using analysis of variance. Abbreviations: MN, micronucleus frequency; n.s., not significant.

Figure 4. Micronuclei formation in BMSC276 cultivated under selenium-deficient conditions. Arrows mark micronuclei in four different cells (magnification ⫻400).

hierarchy for selenium incorporation [9]. This indicates that— albeit with individual variability— cellular antioxidative capacity rapidly decreases ex vivo and/or is primarily low in donors at risk. There is ample evidence and consensus that reactive oxygen species are indispensable for redox signaling, hormone synthesis, and intracellular killing of bacteria [9, 43, 46], but if not appropriately controlled by neutralization and compartmentalization, they may damage DNA, proteins, and lipids. Prevention and repair of damage by ROS is mediated in a concerted action of antioxidative systems and DNA repair mechanisms. Anything beyond their capacities may cause irreversible damage followed by senescence or tumor promotion [19, 62– 66]. As we could show both in immortalized and in primary cells, basal and ROS-stimulated expression of SOD1 is diminwww.StemCells.com

ished under conditions of selenium deficiency in standard cell culture systems. Thus, these cells produce less hydrogen peroxide at the expense of superoxide anion accumulation; for example, they harbor an increased risk of cell damage [67]. The SOD1 promoter hydrogen peroxide response element is located between bases –533 and –520 [68] and may be blocked under these conditions for unknown reasons, but it is effective after selenite supplementation. However, this mechanism avoids additional hydrogen peroxide production—albeit at the risk of superoxide anion accumulation—in a situation in which the neutralization capacity for hydrogen peroxide is impaired due to low GPx activity. Having clearly demonstrated these biochemical phenomena, the question of biological consequences was evaluated applying an ROS production assay in hMSC-TERT cells. Again, in this case, the immortalized cells were used to get reproducible results and sufficient amounts of cells, and the difference was highly significant in selenium-supplemented versus control cells. The telomerase transfection overcomes fail-safe programs, and as we have shown previously, these cells in fact harbor mutations in culture if maintained under high proliferation pressure (Ink4a/ARF, KRAS), which can lead to tumor formation in nude mice [69]. Using the micronuclei formation assay in primary cells, we could also demonstrate that in fact significant amounts of micronuclei are formed in culture and that selenium supplementation reduced the number of micronuclei up to 58%. The amount of 30 –50 micronuclei per 1,000 cells found in some cultures is comparable to reports about micronuclei formation in lymphocytes in patients on chronic hemodialysis [12]. Stem cells are widely used in research to elucidate molecular mechanisms of differentiation and to establish cell-based strategies of tissue repair, tissue engineering, and transplantation. Thus it appears to be very important to care for the integrity of the genome and proteome of these cells for various reasons, for example, quality and survival of stem cell preparations. As we can show here, micronuclei formation as readout of damage of BMSCs ex vivo can be effectively reduced and the antioxidative capacity enhanced by the simple means of adding adequate amounts of selenium to the culture medium. Selenium deficiency has been described to cause cell death in vitro in

1234

Jurkat cells [70], and several specific stem cell media are supplemented with selenite for empirical reasons [71]. Our data deliver a molecular explanation. In the setting of primary BMSC cultures, it is obvious that we can control for the oxidative load and that endogenous fail-safe programs do work since the population doubling ceases by time and cells stop proliferating in vitro in higher passages. Further translational research is warranted to ever optimize quality and security issues in cell-based therapeutic strategies.

SUMMARY We show here that under standard cell culture conditions, primary BMSCs have low antioxidative capacity and show symptoms of cellular stress, such as formation of micronuclei. The simple means of selenium supplementation in cultures enhances mechanisms of selenium-dependent and selenium-independent ROS scavenging, restores their antioxidative capacity, and effectively reduces micronuclei formation. We therefore conclude

REFERENCES 1

Tuan RS, Boland G, Tuli R. Adult mesenchymal stem cells and cellbased tissue engineering. Arthritis Res Ther 2003;5:32– 45

2

Cancedda R, Dozin B, Giannoni P et al. Tissue engineering and cell therapy of cartilage and bone. Matrix Biol 2003;22:81–91.

3

Caplan AI, Bruder SP. Mesenchymal stem cells: Building blocks for molecular medicine in the 21st century. Trends Mol Med 2001;7:259 – 264.

4

Bianco P, Robey PG. Stem cells in tissue engineering. Nature 2001;414: 118 –121.

5

No¨th U, Osyczka AM, Tuli R et al. Multilineage mesenchymal differentiation potential of human trabecular bone-derived cells. J Orthop Res 2002;20:1060 –1069.

6

Pelled GGT, Aslan H, Gazit Z et al. Mesenchymal stem cells for bone gene therapy and tissue engineering. Curr Pharm Des 2002;8:1917–1928.

7

Bianco P, Riminucci M, Gronthos S, Robey PG. Bone marrow stromal stem cells: Nature, biology, and potential applications. STEM CELLS 2001;19:180 –192.

8

Turgeman G, Aslan H, Gazit Z et al. Cell-mediated gene therapy for bone formation and regeneration. Curr Opin Mol Ther 2002;4:390 –394.

9

Ko¨hrle J, Jakob F, Dumont J. Selenium and the endocrine system. Endocr Rev 2005;26:944 –984.

10 Ghezzi P, Bonetto V. Redox proteomics: Identification of oxidatively modified proteins. Proteomics 2003;3:1145–1153. 11 Barzilai A, Yamamoto K. DNA damage responses to oxidative stress. DNA Repair (Amst) 3:1109 –1115, 2004. 12 Stopper H, Meysen T, Bockenforde A et al. Increased genomic damage in lymphocytes of patients before and after long-term maintenance hemodialysis therapy. Am J Kidney Dis 1999;34:433– 437. 13 Stopper H, Hempel K, Reiners C et al. Pilot study for comparison of reticulocyte-micronuclei with lymphocyte-micronuclei in human biomonitoring, Toxicol Lett 2005;156:351–360. 14 Fenech M. Chromosomal biomarkers of genomic instability relevant to cancer. Drug Discov Today 2002;7:1128 –1137.

Oxidative Stress in Bone Marrow Stromal Cells that selenite supplementation should be part of good medical practice in cell cultures used for tissue engineering, genetic engineering, and transplantation to optimize scavenging mechanisms of ex vivo-manipulated stem cells.

ACKNOWLEDGMENTS We thank Prof. Dr. Katja Becker-Brandenburg, Giessen, Germany, for helpful discussions; Dr. Norbert Schu¨tze, Wu¨rzburg, Germany, for providing the hFOB cell line; Dr. Ulrich No¨th and Martina Regensburger, Wu¨rzburg, Germany, for the preparation of primary MSC cultures; and Kristin Kobras, Wu¨rzburg, Germany, for help with the micronucleus assay. This work was supported by German Research Society Priority Program 1087 and Research Training Group 639.

DISCLOSURES The authors indicate no potential conflicts of interest.

18 Kontou M, Adelfalk C, Ramirez MH et al. Overexpressed thioredoxin compensates Fanconi anemia related chromosomal instability. Oncogene 2002;21:2406 –2412. 19 Kirkwood TB, Austad SN. Why do we age? Nature 2000;408:233– 238. 20 Aigaki T, Seong KH, Matsuo T. Longevity determination genes in Drosophila melanogaster. Mech Ageing Dev 2002;123:1531–1541. 21 Toussaint O, Royer V, Salmon M et al. Stress-induced premature senescence and tissue ageing. Biochem Pharmacol 2002;64:1007–1009. 22 Smith SK, Kipling D. The role of replicative senescence in cancer and human ageing: Utility (or otherwise) of murine models. Cytogenet Genome Res 2004;105:455– 463. 23 Kipling D, Davis T, Ostler EL et al. What can progeroid syndromes tell us about human aging? Science 2004;305:1426 –1431. 24 Ito K, Hirao A, Arai F et al. Regulation of oxidative stress by ATM is required for self renewal of hematopoetic stem cells. Nature 2004;431: 997–1002. 25 Zelko IN, Mariani TJ, Folz RJ. Superoxide dismutase multigene family: A comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and ECSOD (SOD3) gene structures, evolution, and expression. Free Radic Biol Med 2002;33:337–349. 26 Noor R, Mittal S, Iqbal J. Superoxide dismutase: Applications and relevance to human diseases. Med Sci Monit 2002;8:RA210 –RA215. 27 Kirby K, Hu J, Hilliker AJ et al. RNA interference-mediated silencing of Sod2 in Drosophila leads to early adult-onset mortality and elevated endogenous oxidative stress. Proc Natl Acad Sci U S A 2002;99:16162– 16167. 28 Huang TT, Carlson EJ, Raineri I et al. The use of transgenic and mutant mice to study oxygen free radical metabolism. Ann N Y Acad Sci 1999;893:95–112. 29 Huang TT, Raineri I, Eggerding F et al. Transgenic and mutant mice for oxygen free radical studies. Methods Enzymol 2002;349:191–213.

15 Fenech M. In vitro micronucleus technique to predict chemosensitivity. Methods Mol Med 2005;111:3–32.

30 Andreassen OA, Ferrante RJ, Dedeoglu A et al. Mice with a partial deficiency of manganese superoxide dismutase show increased vulnerability to the mitochondrial toxins malonate, 3-nitropropionic acid, and MPTP. Exp Neurol 2001;167:189 –195.

16 Fenech M. The Genome Health Clinic and Genome Health Nutrigenomics concepts: Diagnosis and nutritional treatment of genome and epigenome damage on an individual basis. Mutagenesis 2005;20:255–269.

31 Asikainen TM, Huang TT, Taskinen E et al. Increased sensitivity of homozygous Sod2 mutant mice to oxygen toxicity. Free Radic Biol Med 2002;32:175–186.

17 Ruppitsch W, Meisslitzer C, Hirsch-Kauffmann M et al. Overexpression of thioredoxin in Fanconi anemia fibroblasts prevents the cytotoxic and DNA damaging effect of mitomycin C and diepoxybutane. FEBS Lett 1998;422:99 –102.

32 Zhang J, Graham DG, Montine TJ et al. Enhanced N-methyl-4-phenyl1,2,3,6-tetrahydropyridine toxicity in mice deficient in CuZn-superoxide dismutase or glutathione peroxidase. J Neuropathol Exp Neurol 2000; 59:53– 61.


33 Copin JC, Gasche Y, Chan PH. Overexpression of copper/zinc superoxide dismutase does not prevent neonatal lethality in mutant mice that lack manganese superoxide dismutase. Free Radic Biol Med 2000;28:1571– 1576. 34 Rushmore TH, Morton MR, Pickett CB. The antioxidant responsive element. Activation by oxidative stress and identification of the DNA consensus sequence required for functional activity. J Biol Chem 1991; 266:11632–11639. 35 Chang MS, Lee SG, Rho HM. Transcriptional activation of Cu/Zn superoxide dismutase and catalase genes by panaxadiol ginsenosides extracted from Panax ginseng. Phytother Res 1999;13:641– 644. 36 Chang MS, Yoo HY, Rho HM. Positive and negative regulatory elements in the upstream region of the rat Cu/Zn-superoxide dismutase gene. Biochem J 1999;339:335–341. 37 Kim HT, Kim YH, Nam JW et al. Study of 5⬘-flanking region of human Cu/Zn superoxide dismutase. Biochem Biophys Res Commun 1994;201: 1526 –1533. 38 Kim YH, Yoo HY, Chang MS et al. C/EBP alpha is a major activator for the transcription of rat Cu/Zn superoxide dismutase gene in liver cell. FEBS Lett 1997;401:267–270. 39 Minc E, de Coppet P, Masson P et al. The human copper-zinc superoxide dismutase gene (SOD1) proximal promoter is regulated by Sp1, Egr-1, and WT1 via non-canonical binding sites. J Biol Chem 1999;274:503–509. 40 Park EY, Rho HM. The transcriptional activation of the human copper/ zinc superoxide dismutase gene by 2,3,7,8-tetrachlorodibenzo-p-dioxin through two different regulator sites, the antioxidant responsive element and xenobiotic responsive element. Mol Cell Biochem 2002;240:47–55.

1235

51 Harris SA, Enger RJ, Riggs BL et al. Development and characterization of a conditionally immortalized human fetal osteoblastic cell line. J Bone Miner Res 1995;10:178 –186. 52 Dreher I, Schmutzler C, Jakob F et al. Expression of selenoproteins in various rat and human tissues and cell lines. J Trace Elem Med Biol 1997;11:83–91. 53 Holmgren A, Bjornstedt M. Thioredoxin and thioredoxin reductase. Methods Enzymol 1995;252:199 –208. 54 Beauchamp C, Fridovich I. Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Anal Biochem 1971;44:276 –287. 55 Beauchamp CO, Fridovich I. Isozymes of superoxide dismutase from wheat germ. Biochim Biophys Acta 1973;317:50 – 64. 56 Spitz DR, Oberley LW. An assay for superoxide dismutase activity in mammalian tissue homogenates. Anal Biochem 1989;179:8 –18. 57 Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 2002;30:e36. 58 Royall JA, Ischiropoulos H. Evaluation of 2⬘,7⬘-dichlorofluorescin and dihydrorhodamine 123 as fluorescent probes for intracellular H2O2 in cultured endothelial cells. Arch Biochem Biophys 1993;302:348 –355. 59 Kane DJ, Sarafian TA, Anton R et al. Bcl-2 inhibition of neural death: Decreased generation of reactive oxygen species. Science 1993;262: 1274 –1277. 60 Carter WO, Narayanan PK, Robinson JP. Intracellular hydrogen peroxide and superoxide anion detection in endothelial cells. J Leukocyte Biol 1994;55:253–258.

41 Driscoll DM, Copeland PR. Mechanism and regulation of selenoprotein synthesis. Annu Rev Nutr 2003;23:17– 40.

61 Fuchs E, Tumbar T, Guasch G. Socializing with the neighbors: Stem cells and their niche. Cell 2004;116:769 –778.

42 Kyriakopoulos A, Behne D. Selenium-containing proteins in mammals and other forms of life. Rev Physiol Biochem Pharmacol 2002;145:1– 46.

62 Soti C, Sreedhar AS, Csermely P. Apoptosis, necrosis and cellular senescence: Chaperone occupancy as a potential switch. Aging Cell 2003;2:39 – 45.

43 Burk RF, Hill KE, Motley AK. Selenoprotein metabolism and function: Evidence for more than one function for selenoprotein P. J Nutr 2003; 133:1517S–1520S 44 McKenzie RC, Arthur JR, Beckett GJ. Selenium and the regulation of cell signaling, growth, and survival: Molecular and mechanistic aspects. Antioxid Redox Signal 2002;4:339 –351. 45 Jakob F, Becker K, Paar E et al. Expression and regulation of thioredoxin reductases and other selenoproteins in bone. Methods Enzymol 2002; 347:168 –179.

63 de Boer J, Andressoo JO, de Wit J et al. Premature aging in mice deficient in DNA repair and transcription. Science 2002;296:1276 –1279. 64 Bohr VA. DNA-related pathways defective in human premature aging. Scientific World Journal 2002;2:1216 –1226. 65 Linton S, Davies MJ, Dean RT. Protein oxidation and ageing. Exp Gerontol 2001;36:1503–1518. 66 Mohaghegh P, Hickson ID. Premature aging in RecQ helicase-deficient human syndromes. Int J Biochem Cell Biol 2002;34:1496 –1501.

46 Ebert-Du¨mig R, Schu¨tze N, Jakob F. The thioredoxin reductase/thioredoxin system in cells of the monocyte/macrophage pathway of differentiation. Biofactors 1999;10:227–235.

67 Boonstra J, Post JA. Molecular events associated with reactive oxygen species and cell cycle progression in mammalian cells. Gene 2004;337: 1–13.

47 Schu¨tze N, Fritsche J, Ebert-Du¨mig R et al. The selenoprotein thioredoxin reductase is expressed in peripheral blood monocytes and THP1 human myeloid leukemia cells: Regulation by 1,25-dihydroxyvitamin D3 and selenite. Biofactors 1999;10:329 –338.

68 Yoo HY, Chang MS, Rho HM. The activation of the rat copper/zinc superoxide dismutase gene by hydrogen peroxide through the hydrogen peroxide-responsive element and by paraquat and heat shock through the same heat shock element. J Biol Chem 1999;274:23887–23892.

48 Simonsen JL, Rosada C, Serakinci N et al. Telomerase expression extends the proliferative life-span and maintains the osteogenic potential of human bone marrow stromal cells. Nat Biotechnol 2002;20:592–596.

69 Serakinci N, Guldberg P, Burns JS et al. Adult human mesenchymal stem cell as a target for neoplastic transformation. Oncogene 2004;23:5095– 5098.

49 Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143–147.

70 Saito Y, Yoshida Y, Akazawa T et al. Cell death caused by selenium deficiency and protective effect of antioxidants. J Biol Chem 2003;278: 39428 –39434.

50 Schu¨tze N, No¨th U, Schneidereit J et al. Differential expression of CCN-family members in primary human bone marrow-derived mesenchymal stem cells during osteogenic, chondrogenic and adipogenic differentiation. Cell Commun Signal 2005;3:5.

www.StemCells.com

71 Guan K, Furst DO, Wobus AM. Modulation of sarcomere organization during embryonic stem cell-derived cardiomyocyte differentiation. Eur J Cell Biol 1999;78:813– 823.