Separation of Simulants of Biological Warfare Agents ... - Springer Link

Biomedical Microdevices 5:3, 217±225, 2003 # 2003 Kluwer Academic Publishers. Manufactured in The Netherlands.

Separation of Simulants of Biological Warfare Agents from Blood by a Miniaturized Dielectrophoresis Device Ying Huang,1* Joon Mo Yang,2 Penelope J. Hopkins,1 Sam Kassegne,3 Marcus Tirado, Anita H. Forster,2 and Howard Reese1

1 Nanogen Inc., 10398 Paci®c Center Court, San Diego, CA 92121, USA E-mail: [email protected] 2 Genoptix, 3398 Carmel Mountain Road, San Diego, CA 92121, USA 3 Department of Mechanical and Aerospace Engineering, Henri Samueli School of Engineering, University of California at Irvine, Irvine, CA 92697

Abstract. Separation of simulants of biological warfare agents from blood using dielectrophoresis (DEP) was demonstrated in a miniaturized DEP device. The device was fabricated by laminating ®ve different layers (all 40 mm 6 40 mm) including a polycarbonate substrate, a pressure sensitive acrylic adhesive (PSA) layer, a patterned polyimide layer with a ¯ip-chip bonded dielectrophoresis chip (DEP chip), a PSA layer with micro¯uidic channel, and a glass cover plate. The DEP chip consisted of repetitive interdigitated electrodes with characteristic dimension of 50 lm. This device was employed to separate different simulants of biological warfare agents (BWA), namely Bacillus cereus (B. cereus), Escherichia coli (E. coli) and Listeria monocytogenes (L. monocytogenes), from blood, individually or simultaneously. PCR ampli®cation, which was inhibited by blood components in pre-separation samples, successfully revealed bands in post-separation samples containing single or multiple BWA. Up to 97% ef®ciency of separation was achieved as demonstrated by culturing post-separation E. coli cells. The DEP device described here can potentially be used to reduce sample complexity for detection of infectious disease pathogens and biological warfare agents. Key Words. separation, dielectrophoresis (DEP), biological warfare agents (BWA), miniaturization

1.

Introduction

With the recent threat of biological weapons, a signi®cant amount of research has been devoted to the development of miniaturized immuno- or nucleic acid-based detectors for rapid identi®cation of biological pathogens (Rowe et al., 1999; Yu et al., 1998; Belgrader et al., 2001; Yang et al., 2002; Taylor et al., 2001). Given the nature of biological warfare agents, upstream sample preparations such as selective cell isolation, cell lysis, and nucleic acid extraction are often required to reduce the sample complexity for accurate detection (Huang et al., 2002). Although steps involving cell lysis and nucleic acid extraction can be accomplished through thermal treat-

ment during PCR, as demonstrated by identi®cation of pathogenic genes directly from intact bacteria uncontaminated with blood (Yang et al., 2002; Taylor et al., 2001), little attention has been paid to the development of integrated microfabricated devices for selectively isolating pathogens from blood mixture. Efforts have been made to selectively collect pathogens by utilizing intrinsic differences in physical properties such as size (Wilding et al., 1998; Brody et al., 1995; Craighead et al., 2000) and dielectric properties (Cheng et al., 1998a, 1998b; Huang et al., 2002, 2001). Among the available methods, dielectrophoresis (DEP), the movement of particles in nonuniform ac electric ®elds, is a proven technology that is well suited for miniaturization and integration. This technology utilizes the unique intrinsic dielectric properties of different cell types to manipulate cells to distinct locations on microelectrodes, thus selectively separating one type of cell from another. In previous experiments using DEP, E. coli bacteria were separated from whole blood for subsequent DNA hybridization analysis on microfabricated bioelectronic chips (Cheng et al., 1998), and puri®ed monocytic U937 cells were isolated from human peripheral blood mononuclear cell mixtures for accurate gene expression analysis (Huang et al., 2002). In this paper, we demonstrate separation of three different simulants of biological warfare agents (BWA) from blood using a miniaturized DEP device. These simulants, B. cereus, E. coli, and L. monocytogenes, were separated from blood individually or simultaneously using this device. PCR analysis of the post-separation samples from single or multiple simulants revealed bands that were not detectable in the pre-separation samples due to inhibition of PCR by blood components. The ef®ciency of separation was demonstrated by culturing *Corresponding author.

217

218

Huang et al.

Fig. 1. Photographs of the DEP chip. The electrode and spacing dimension is 50 mm.

post-separation E. coli; up to 97% ef®ciency was achieved. The presented work provides a simple and fast sample preparation approach to selectively isolate pathogens from blood for applications such as infectious diseases testing and BWA detection.

2.

Materials and Methods

2.1. DEP chip fabrication The DEP chip consisted of repetitive interdigitated electrodes with electrode and spacing dimensions of 50 mm and with external connections via two electronic connecting pads (Figure 1). The chip had a die size of 8 mm 6 10 mm with an electrode area of 5 mm 6 5 mm. The electrodes were fabricated on silicon using standard semiconductor processing techniques. Brie¯y, the silicon wafer was spin-coated with Shipley 3,612 photoresist (Shipley, Marlborough, MA) at 3,000 rpm for 1 minute. The wafer was then baked on a hot plate at 105 C for 2 minutes. A glass mask was used for photolithography. The wafer was exposed to UV light for 2 seconds and

developed in LDD26-W Developer (Shipley) for 1 minute. Next, the wafer was hard-baked on a hot plate at 120 C for 2 minutes before Ti-W and Pt layers were deposited using an Elmer±Perkins 4,400 Deposition System (Elmer±Perkins). The lift-off process was accomplished with 1,165 Remover (Shipley) to remove excess deposition. Finally, the wafer was cleaned with acetone, methanol and de-ionized water. 2.2. DEP device package The fabricated DEP chip was packaged by sequential lamination of different functional layers including a polycarbonate substrate, a pressure sensitive acrylic adhesive (PSA) layer, a patterned polyimide layer with a ¯ip-chip bonded DEP chip, a PSA layer with a ¯uidic cutout, and a glass cover plate layer (Figure 2) using a similar method as described (Yang et al., 2002). First, the ¯ex circuitry was fabricated on a 40 6 40 mm2 piece of Kapton polyimide substrate (0.05 mm-thick, DuPont High Performance Films, Circleville, OH) as described previously (Forster et al., 2001). The fabricated Kapton substrate had metal patterns for electronic connection

Fig. 2. DEP device: (a) Fabrication of the DEP device; (b) photographs of the completed DEP device.

Separation of Simulants of Biological Warfare Agents

and cutouts for ¯ip-chip bonding and ¯uidic inlet/outlet. The ¯ex layer was supplied by Tyco Flexible Electronic Circuit Division (Santa Clara, CA). The DEP chip was ¯ip-chip bonded to the Kapton layer with a silver epoxy (Epoxy Technology, model H20E, Billerica, MA) for electronic connections and an adhesive (Norland model 83H, New Brunswick, NJ) for under®ll. The DEP device was laminated by combining the Kapton layer with a DEP chip and a 0.152 mm thick double coated PSA layer. The cutout in the PSA layer formed micro¯uidic channels (1.27 mm wide) and a ¯uidic chamber (3.5 mm wide) for dielectrophoretic collection and separation. The micro¯uidic chamber and channels were sealed by a 1.27 mm thick glass plate to form an enclosed ¯uidic channel/chamber. For added durability, a 3 mm-thick machined polycarbonate and a 0.152 mm-thick PSA layer were laminated to the other side of the Kapton layer. The ®nal DEP device had a dimension of 40 6 40 mm2 with a thickness of 4.6 mm. The lamination of the layers was performed in a vacuum assembly ®xture for this purpose (Yang et al., 2002). The laminated DEP package (40 6 40 mm2) is shown in Figure 2. The ®nal ¯ow cell covered a DEP area of 15 mm2 with approximately 0.300 mm height. The volume of the ¯ow cell was approximately 5 mL. The geometry of the micro¯uidic channel leading into the ¯uidic chamber over the DEP chip followed 5th-order polynomial equation for optimal ¯uidic performance. Pathways for ¯uidic delivery and removal were located on the bottom of the package. The metalized patterns on the opposite side of the Kapton layer permitted electrical contact (not shown in the ®gure). 2.3. Fluidic and electronic interfaces Fluidic interface between the DEP device and an external system was achieved by a clamping ®xture (Figure 3), which consisted of a polycarbonate block

Fig. 3. Fluidic interface of the DEP device.

219

(50 6 70 6 20 mm3) with machined ¯uidic channels, two O-rings and an aluminum cover plate. The DEP device was clamped between the aluminum cover plate and the polycarbonate block by two screws, with the bottom of the DEP device sealed tightly against the Orings in order to form a ¯uidic connection with the external plumbing (not shown). The electronic interface was achieved either by soldering two wires to the metalized patterns on the Kapton layer, or with pogo pins (not shown). 2.4. Fluidic and electronic control system The ¯uidic deliveries to the DEP device were controlled by a peristaltic pump (model RP-1, Rainin Instruments, Woburn, WA). The ac signals for performing DEP were provided by a Hewlett-Packard signal generator (model HP33120A, Hewlett-Packard, Santa Clara, CA). Images were collected using a Leica INM 100 confocal microscope (Leica, Deer®eld, IL). 2.5. DEP separations Heat-killed E. coli 0157:H7 and heat-killed L. monocytogenes were purchased from KPL (Gaithersburg, MD) and were stored in distilled water at concentrations of 7 6 109 and 1 6 1010 bacteria/mL, respectively. B. cereus was purchased from ATCC (#14579, Rockville, MD) and grown in LB broth (Sigma, St. Louis, MO) at 30 C for 18 hours, then diluted in LB broth to a ®nal concentration of 1 6 109 cell/mL. Human blood, anticoagulated with EDTA, was purchased from the San Diego Blood Bank (San Diego, CA). DEP separation was carried out in a separation buffer (280 mM mannitol 1% (v/v) phosphate buffered saline (PBS)). The conductivity of separation buffer was 180 mS/cm. Bacteria was added to blood and cells were pelleted by centrifugation and re-suspended in separation buffer prior to loading into the DEP device. All separations were run with an ac voltage of 10 Vpp at 10 kHz. The following separation protocol was used: (1) 5 mL of sample were loaded into the DEP device; (2) an ac voltage of 10 Vpp at 10 kHz was applied for 5 minutes; (3) the chip was washed for 10 minutes at a ¯ow rate of 45 mL/min (ac voltage maintained during wash); (4) the ac voltage was disconnected, the chip was ¯ushed with separation buffer at 400 mL/min, and cells were collected; (5) post-separation samples were centrifuged and resuspended in 5 mL of separation buffer for culturing or PCR analysis. 2.6. PCR protocols PCR primers were ordered from IDT (Coralville, IA). The sequences of the primers and names of the target genes are listed in Table 1. 50 mL of PCR reactions were run using an MJ Research PTC-200 Peltier Thermal

220

Huang et al.

Table 1. PCR Primers for B. cereus, E. coli and L. monocytogenes

B. cereus E. coli L. monocytogenes

Forward primer

Reverse primer

Gene

Amplicon length

gtggtgatagtgctcaattccataa gtagtcaacgaatggcgattt cggagatgcagtgacaaatgtg

ccatatcctgttaaagctggtactgta agaggaagggcggttta catctttccactaatgtatttactgcg

Hly II STX hlyA

399 bp 234 bp 330 bp

Cycler (MJ Research, Boston, MA) and 0.5 mL Thermowell tubes (Corning Incorporated, Corning, NY). The ®nal reaction conditions were: 5 mL of template ( pre-separation or post-separation samples), 1 6 buffer D (33.5 mM Tris-HCl, 8.3 mM (NH4)SO4, 25 mM KCl, 85 ng/mL BSA), 2.5 mM MgCl2, 0.35 mM dNTPs, 0.15 mM each primer, and 1 unit AmpliTaq Gold (Applied Biosystems, Foster City, CA). The thermal cycling settings were (1) 94 C for 12 minutes; (2) 16 cycles of [94 C for 30 seconds, 66 C for 30 seconds, (decreasing 1 C per cycle) 72 C for 30 seconds]; (3) 22 cycles of [94 C for 30 seconds, 50 C for 30 seconds, 72 C for 30 seconds]; (4) a ®nal extension at 72 C for 10 minutes. The PCR products were analyzed on a 2% agarose E-gel (Invitrogen, Carlsbad, CA). Gel images were captured using a MultiImage Light Cabinet and AlphaImager (Alpha Innotech Corporation, San Leandro, CA). The PCR protocol developed here was applied for samples containing single or multiple types of bacteria. 2.7. Colony plating Colony plating was used to evaluate the collection ef®ciency. Live E. coli (ATCC#27165, Rockville, MD) were used in these experiments. The E. coli were grown in LB Broth at 37 C for 18 hours to a concentration of approximately 1 6 109 cells/mL. Cells were diluted and spiked into blood at different ratios. The bacteria/blood mixtures were separated and bacteria cells were harvested using the DEP device prior to plating on LB agar plates. Agar plates were made by pouring sterile LB agar (Sigma, St. Louis, MO) into 100 6 15 mm sterile polystyrene petri dishes (VWR International, West Chester, PA) and storing at 4 C until needed. The plates were incubated at 37 C overnight, and the colonies counted the following day. Duplicate plates were made for each experimental condition.

3.

Theory

The theory of DEP has been studied extensively (Pohl, 1978; Washizu and Jones, 1996; Gimsa and Wachner, 1998; Gascoyne and Vykoukal, 2002; Schnelle et al., 1993; Green and Morgan, 1997). Brie¯y, when a particle is placed in a nonuniform electric ®eld, the interaction between the induced dipole (or quadrupole, octopole,

etc.) and the electric ®eld can generate net force (dielectrophoretic force) acting on the particle. The time-averaged DEP force due to a spatially nonuniform electric ®eld can be approximated in terms of dipole effects as FDEP 2p em r 3 Re fCM HE2 ;

1

where em is the absolute permittivity of the suspending medium, r is the radius of the particle, E is the local (rms) electric ®eld, H is the del vector operator, and Re fCM is the real part of Clausius±Mossotti factor relating to the induced dipole moment. Depending on the difference between the dielectric properties of the particle and its suspending medium, the induced dipole moment can align with or against the electric ®eld, causing the particle to move to a ®eld maximum ( positive DEP) or a ®eld minimum (negative DEP), respectively. The electric ®eld distributions of the interdigitated electrodes used here were calculated by a ®nite-element method using the CoventorWare software package (Coventor, Cambridge, MA). In this calculation, four representative interdigitated electrodes with characteristic dimensions of 50 mm were situated in the bottom of a ¯ow cell, which had dimensions of 900 mm 6 500 mm 6 50 mm. The ®nite element model consisted of a converged ®nite element mesh of almost 240,000 nodes and 26,400 parabolic solid elements. Potentials of 5 and 5 volts were assumed to be applied to the electrode pairs alternatively. The electric ®eld distribution is plotted in Figure 4 with red representing the ®eld maximum. In agreement with other groups' calculations (Green and Morgan, 1997; Wang et al., 1993), the maximum electric ®elds are at the protruding edges of the interdigitated electrodes, and the minimum electric ®elds are located at two regions: the triangular-shaped recessed edges and the diamond-shaped top of electrode surfaces. The Re fCM values for red blood cells (RBC) (Becker et al., 1995), T-lymphocytes (Yang et al., 1999) (a major subpopulation of leukocytes) and heatkilled E. coli (HoÈlzel, 1999) were calculated using dielectric shell models (Fuhr et al., 1990) and the dielectric parameters reported previously. At the separation conditions used here (frequency 10 kHz and medium conductivity 180 mS/cm), the Re fCM value


221

Fig. 4. (a) A color-coded 3-dimensional plot of the electric ®eld distribution for the DEP chip showing regions of maximum and minimum ®eld gradient; (b) The threshold ¯ow rate for bacteria and blood calculated based on DEP retention theory and the dielectric properties. The separation ¯ow rates must be in the shaded region.

is 0.49, 0.49 and 0.69 for RBC (average radius 2.8 mm), T-lymphocytes (average radius 3.29 mm), and heat-killed E. coli (average radius 0.8 mm), respectively. Because the dielectric properties of B. cereus and L. monocytogenes were unknown at the time, we assumed that they have same Re fCM value as E. coli. These Re fCM values predict that on-chip separation can be achieved in such a way that bacteria are collected at the ®eld maxima by positive DEP forces and blood cells (RBC and leukocytes) are collected at the ®eld minima by negative DEP forces. After on-chip separations, bacteria could be selectively separated by introduction of a ¯uidic ¯ow to the DEP chip (Becker et al., 1994, 1995; Markx and Pethig, 1995). When a hydrodynamic force of ¯uid ¯ow is introduced, the movement of the particle is dependent on the net force between the DEP force and hydrodynamic drag force (Becker et al., 1994, 1995; Voldman et al. 2001). The horizontal drag on a particle can be given by the modi®ed form of the Stokes equation as FHD 6pZrvm c;

2

where Z is the dynamic viscosity of the ¯uid and vm is the ¯uid velocity at the center of the particle. When the particle is in contact with the bottom wall, c 1.7 (Goldman et al., 1967). The ¯uid velocity, vm, at a distance x from the bottom wall of the ¯ow cell can be expressed as x x 1 vm 6hvi ; 3 w w where hvi is the mean velocity of medium ¯ow and w is the height of the ¯ow cell. By adjusting electric ®eld conditions and ¯uidic ¯ow

conditions, DEP forces acting on the bacteria were strong enough to trap and retain the bacteria on the electrodes despite of the presence of the ¯uidic forces. Simultaneously, ¯uidic forces acting on blood cells were larger than DEP forces so that blood cells were carried away with the ¯uidic ¯ow. FDEP FDEP

> FHD bacteria ; < FHD blood :

4a 4b

bacteria blood

Combining equations (1)±(4), one can obtain the inequality: rblood Re fCM

blood

kblood < a

< rbacteria Re fCM

bacteria

hvi V2

kbacteria ;

5

where a 36pcZ=wem , is a constant for a given ¯ow cell geometry and medium, and rblood and rbacteria are the radii of the respective particle types having Claussius± Mossotti factors Re fCM blood and Re fCM bacteria . The left- and right-hand terms of this inequality determine the relative DEP forces on the different types of particles, while the center term re¯ects the competition between the mean ¯uid ¯ow rate hvi and the applied voltage V. Factor kblood and kbacteria are geometrical terms that depend on the electrode design and are 4.4 6 1012 m 3 and 8.8 6 1012 m 3, respectively as calculated from electric ®eld simulations. Thus, at given medium conductivity, the frequency and the voltage, there are threshold ¯ow rates for bacteria vbacteria and blood vblood, respectively. Based on the above dielectric parameters, we calculated the vbacteria and vblood as plotted in Figure 4(b). Bacteria will only be retained by the DEP force when hvi is less than vbacteria; whilst blood

222

Huang et al.

will be swept away by the ¯uidic ¯ow when hvi is greater than vblood. Therefore, the ¯ow rate for separation must be greater than vblood and less than vbacteria and it should be within the shaded region in Figure 4(b). In this work, the separation ¯ow rate was chosen to be 45 mL/min (see Materials and Methods Section).

4.

Results and Discussion

4.1. Separation of individual or multiple simulants The pre-separation samples containing 4 mL whole blood and 1 mL of 1 6 106 B. cereus or 7 6 105 heat-killed E. coli or 1 6 106 L. monocytogenes were spun down and resuspended in 5 mL of separation buffer. The samples were individually loaded into the DEP device. Using an ac voltage of 10 Vpp at 10 kHz, bacteria were separated from blood by DEP forces (Figure 5(a)±(c)). In all cases, blood cells collected in the recessed areas, forming triangular shapes. Some of the B. cereus collected at the electrode edges, and some were collected on the electrode surface (Figure 5(a)). E. coli (Figure 5(b)) and L. monocytogenes (Figure 5(c)) collected on the electrode surface and formed diamond shape patterns. As predicted from DEP theory, blood cells collected in low ®eld regions. However, E. coli and L. monocytogenes were observed to collect at the diamond regions, which are ®eld minimum regions, instead of the ®eld maximum regions at the electrode edges. The nature of the diamond formations cannot be simply explained by conventional DEP theory. Similar DEP behavior has been observed for yeast cells (Pethig et al., 1992). Such DEP behavior is due to a combination of effects from positive DEP,

Fig. 5. Separations of bacteria from blood on DEP device were achieved at 10 kHz, 10 Vpp with medium conductivity of 180 mS/cm for (a) B. cereus; (b) E. coli; (c) L. monocytogenes; and (d) all three types together.

Fig. 6. Agarose gel showing PCR ampli®cations of E. coli STX gene, L. monocytogenes hlyA gene, and B. cereus Hly II gene from pre- and post-separation of monotype of bacteria and blood mixtures. M: DNA marker; P: positive control; N: no-template-control; 1: pre-separation sample; 2: post-separation sample.

electrophoresis and ac electro-osmosis (Ramos et al., 1999; Wang and Cheng, 2001). Because the three types of bacteria were separated from blood under the same conditions, we tested whether we could separate multiplexed samples. The bacteria were combined and added to blood, after which simultaneous separation was performed using the same conditions as above. The three types of bacteria were separated simultaneously from blood (Figure 5(d)) as shown by PCR (below). We believe this is the ®rst demonstration of simultaneous separation of multiple bacteria using dielectrophoresis. 4.2. PCR ampli®cations of post-separation samples The effectiveness of DEP separation was con®rmed by PCR ampli®cation of the post-separation samples in comparison to the pre-separation samples. PCR ampli®cation products, inhibited by the components in blood in pre-separation samples, were detected in all postseparation samples (Figure 6). Separation effectiveness was also demonstrated for multiplexed samples containing two or three types of bacteria (Figure 6). PCR ampli®cation of the postseparation samples containing B. cereus and L. monocytogenes produced the two expected products (Figure 7(a)), which were not ampli®ed in pre-separation samples. Likewise, three PCR products (Figure 7(b)) were detected from the post-separation samples consisting of B. cereus, E. coli and L. monocytogenes. These results indicate that the DEP device can minimize blood contamination and enable PCR detection of bacteria. 4.3. Collection ef®ciency DEP collection ef®ciency was quantitatively evaluated using live E. coli (ATCC #26125) that were mixed with blood in different ratios (Table 2). DEP separated live E. coli were cultured on solid media, and the colony number was compared with the pre-separation samples. The


223

Fig. 7. Agarose gel showing PCR ampli®cations of E. coli STX gene, L. monocytogenes hlyA gene, and B. cereus Hly II gene from pre- and postseparation of (a) duplex bacteria and blood mixtures; and (b) triplex bacteria and blood mixtures. M: DNA marker; P: positive control; N : no-template-control; 1: pre-separation sample; 2: post-separation sample.

collection ef®ciency is de®ned as the percentage of colonies from the post-separation samples compared to the number of colonies from the pre-separation samples. The results in Table 2 indicate that lower E. coli to RBC ratios in the pre-separation samples correlate with higher collection ef®ciency. For example, when the E. coli : RBC ratio was 1:12, collection ef®ciency as high as 97% was achieved. As the amount of input E. coli number increased to 105 cells, the collection ef®ciency dropped. One explanation for the decrease in collection ef®ciency of bacteria is that the DEP chip was overloaded. The area of each ``diamond'' is about 2,500 mm2, and the overall active diamond area of the entire DEP chip is about 3 6 106 mm2. Assuming that the average diameter of bacteria used here is 1 mm, then the number of bacteria necessary to cover the overall active diamond area of the entire DEP chip is about 1 6 106. In other words, the estimated capacity of the device for collecting bacteria under the above separation conditions is approximately 1 6 106 bacteria. If the loaded bacterium number exceeds the DEP chip capacity, then the excess bacteria can not be collected and will be swept away during the washing step. Although the batch operation protocol described above can achieve high collection ef®ciency, processing 5 mL of sample at a time cannot meet the practical requirement for analysis of clinical samples, which often Table 2. Collection ef®ciency of E. coli ATCC 27165 as determined from duplicate colony platings Total cell number ratio

Total E. coli in pre-separation sample

Total E. coli in post-separation sample

Ef®ciency (%)

4.6 6 103 9.7 6 103 1.5 6 107

4.1 6 103 9.4 6 103 3.0 6 106

89 97 20

*

E. coli : RBC 1 : 120 1 : 12 8:1 *

RBC number is assumed as 7.0 6 106 in 1 mL.

contain concentrations of bacteria several orders of magnitude lower than used here. For such samples, large volumes of material need to be processed in order to obtain enough bacteria for detection. To demonstrate the utility of this DEP device for analysis of samples containing low concentrations of bacteria, a ¯ow-through protocol was tested. In this protocol, about 0.5 mL of sample containing bacteria and blood was continuously moved across the DEP chip immediately after the ac voltage was applied until the entire sample was processed. The bacteria collected on the electrode by the DEP force were then harvested by washing with buffer after the ac voltage was turned off. The results from colony plating indicated that very low collection ef®ciency (5 2%) was achieved using this ¯ow-through protocol. An explanation for this low collection ef®ciency was offered by examination of the electric ®eld distribution as a function of the distance from the electrode plane. Figure 8 shows the results of the ®nite element calculations for the electric ®eld distribution as a function of the distance from the electrode plane. The electric ®eld strength decays as the distance from the electrode increases. At a distance of 10 mm from the electrode, the electric ®eld strength reduces by a factor of 5. More importantly, the ®eld non-uniformity becomes smaller as the distance increases. Above 10 mm the ®eld becomes almost uniform. Because the DEP force is proportional to the ®eld non-uniformity (equation (1)), particles more than 10 mm above the electrode experience minimum DEP forces. Consequently, only 3% of particles are in¯uenced by the DEP force assuming all the particles are uniformly distributed through the 300 mm depth of ¯ow cell. To increase the DEP collection ef®ciency, particles should be con®ned within 10 mm of the electrode plane. This can be achieved by reducing the ¯ow rate, or ¯ow cell height or by pressing the cells towards the electrodes using an additional force. Future work will be directed towards these improvements.

224

Huang et al.

Fig. 8. The calculated electric ®eld distribution as a function of the distance from the electrode plane.

5.

Conclusions

We have developed a laminated miniaturized DEP device for separation simulants of biological warfare agents from blood. Using this device, we have demonstrated the separation of three different simulants from blood using dielectrophoresis and the detection of PCR products from the post-separation samples. In comparison to other miniaturized devices (Adderson et al., 2000; Yuen et al., 2001; Liu et al., 2002) that often require sophisticated microfabrication procedures, the present device is simple, cost effective, and easy to integrate. The ability to separate multiple bacteria at the same time without utilizing multiple antibodies has advantages over immuno-based separation methods. The device presented is our ®rst step towards the development of a clinical DEP separation device. Such a separation device could be capable of processing samples on the milliliter scale to accommodate clinical samples; additionally, it could be integrated with other devices, such as a nucleic acid ampli®cation device or a molecular recognition device, to form a complete sample-to-answer system for fast clinical diagnostics and detection of biological warfare agents.

Acknowledgments This work is supported by a research contract from the Defense Sciences Of®ce of the Defense Advanced

Research Program Agency (DARPA/SPAWAR Contract N66001-00-C-8076). The authors are grateful to Dr. Paul Swanson and Mr. Henry Lyles for fabricating the interdigitated electrodes, Mr. Donald Thomas and Mr. Maziar Salehi for the mechanical engineering support, Ms. Huong Tang for providing B. cereus, Ms. Marjan Haghnia for PCR support. We thank Drs. Dalibor Holdko, Elizabeth L. Mather, Elaine Weidenhammer, Barbara MacGowan for reading the manuscript and providing valuable comments.

References R.C. Adderson, X. Su, G.J. Bogdan, and J. Fenton, Nucleic Acids Res. 28, e60 (2000). F.F. Becker, X.-B. Wang, Y. Huang, R. Pethig, J. Vykoukal, and P.R.C. Gascoyne, J. Phys. D: Appl. Phys. 27, 2659 (1994). F.F. Becker, X.-B. Wang, Y. Huang, R. Pethig, J. Vykoukal, and P.R.C. Gascoyne, Proc. Natl. Acad. Sci. U.S.A. 92, 860 (1995). P. Belgrader, S. Young, B. Yuan, M. Primeau, L.A. Christel, F. Pourahmadi, and M.A. Northrup, Anal. Chem. 73, 286 (2001). J.P. Brody, T.D. Osborn, R.K. Forster, and P. Yager, in The 8th International Conference on Solid-State Sensors and Actuators (Transducers'95, Stockholm, Sweden, 1995), p. 779. J. Cheng, E.L. Sheldon, L. Wu, M.J. Heller, and J.P. O'Connell, Anal. Chem 70, 2321 (1998a). J. Cheng, E.L. Sheldon, L. Wu, A. Uribe, L.O. Gerrue, J. Carrino, M.J. Heller, and J.P. O'Connell, Nature Biotech. 16, 541 (1998a). H.G. Craighead, J. Han, and S.W. Turner, in Solid-State Sensors and Actuators Workshop (Hilton Head Island, South Carolina, USA, 2000), p. 26.

Separation of Simulants of Biological Warfare Agents A.H. Forster, P.D. Swanson, T.C. Young, D. Ackley, and M. Krihak, Biosen. Bioelect. 16, 187 (2001). G. Fuhr, P. Rosch, T. Muller, V. Dressler, and H. Gorling, Plant Cell Physiol. 31, 975 (1990). P.R.C. Gascoyne and J. Vykoukal, Electrophoresis 23, 1973 (2002). J. Gimsa and D. Wachner, Biophys. J. 75, 1107 (1998). A.J. Goldman, R.G. Cox, and H. Brenner, Chem. Eng. Sci. 22, 653 (1967). N.G. Green and H. Morgan, J. Phys. D: Appl. Phys. 30, L41 (1997). R. HoÈlzel, Biochim. Biophys. Acta 1450, 53 (1999). Y. Huang, K.L. Ewalt, M. Tirado, R. Haigis, A. Forster, D. Ackley, M.J. Heller, J.P. O'Connell, and M. Krihak, Anal. Chem. 73, 1549 (2001). Y. Huang, E.L. Mather, J.L Bell, and M. Madou, Anal. Bioanal. Chem. 372, 49 (2002a). Y. Huang, S. Joo, M. Duhon, M. Heller, B. Wallace, and X. Xu, Anal. Chem. 74, 3362 (2002b). Y. Liu, C.B. Bauch, R.L. Stevens, R. Lenigk, J. Yang, D.B. Rhine, and P. Grodzinski, Anal. Chem. 74, 3063 (2002). G.H. Markx and R. Pethig, Biotech. Bioeng. 45, 337 (1995). R. Pethig, Y. Huang, X.-B. Wang, and J.P.H. Burt, J. Phys. D: Appl. Phys. 24, 881 (1992). H.A. Pohl, Dielectrophoresis (Cambridge University Press, Cambridge, U.K., 1978). A. Ramos, H. Morgan, N.G. Green, and A. Castellanos, J. Colloid and Interface Science 420 (1999).

225

C.A. Rowe, L.M. Tender, M.J. Feldstein, J.P. Golden, S.B. Scruggs, B.D. MacCraith, J.J. Cras, and F.S. Ligler, Anal. Chem. 71, 3864 (1999). Th. Schnelle, R. Hagedorn, G. Fuhr, St. Fidler, and T. Muller, Biochim. Biophys. Acta. 1157, 127 (1993). M.Y. Taylor, P. Belgrader, B.J. Furman, F. Pourahmadi, G.T.A. Kovacs, and M.A. Northrup, Anal. Chem. 73, 492 (2001). J. Voldman, R.A. Braff, M. Toner, M.L Gray, and M.A. Schmidt, Biophys. J. 80, 531 (2001). X.-B. Wang, Y. Huang, J.P.H. Burt, G.H. Markx, and R. Pethig, J. Phys. D: Appl. Phys. 26, 1278 (1993). X.-B. Wang and J. Cheng, in Biochip Technology, edited by J. Cheng and L.J. Kricka (Harwood Academic Publishers, Philadephia, PA, 2001), p. 135. M. Washizu and T.B. Jones, J. Electrostat. 38, 199 (1996). P. Wilding, L.J. Kricka, J. Cheng, G. Hvichia, M.A. Shoffner, and P. Fortina, Anal. Biochem. 257, 95 (1998). J.M. Yang, J. Bell, Y. Huang, M. Tirado, T. Thomas, A.H. Forster, R.W. Haigis, P.D. Swanson, R.B. Wallace, B. Martinsons, and M. Krihak, Biosen. Bioelect. 17, 605 (2002). J. Yang, Y. Huang, X. Wang, X.-B. Wang, F.F. Becker, and P.R.C. Gascoyne, Biophys. J. 76, 3307 (1999). H. Yu, H. Ahmed, and G.R. Vasta, Anal. Biochem. 261, 1 (1998). P.K. Yuen, L.J. Kricka, P. Fortina, N.J. Panaro, T. Sakazume, and P. Wilding, Genome Res. 405 (2001).