SEQUENCE-BASED REAGENTS SEQUENCE REFERENCE Primers ...

Recommend Documents

Waldor MK, Mekalanos JJ (1994) Vibrio cholerae O139 specific gene sequences. ... Zhu J, Miller MB, Vance RE, Dziejman M, Bassler BL, et al. (2002) Quorum- ...

Primers sequence and annealing temperature to IGF1

Genomic DNA was isolated from peripheral blood leucocytes. ... of deoxy-ATP, -GTP, -CTP, -TTP, 1.5 mmol MgCL2, 0.5 U Taq DNA polymerase, 50 mmol/l KCl,.

Sequence of impersonal reference

Impersonal reference to human agents in French Sign Language (LSF) .... Translation: âOn TV, the Deaf have to use their creativity to imagine that a man and a ...

Reagents

rupted by the addition of 2 ml. of dinitrosalicylic acid reagent. The tube ..... 1 G. L. Baker, G. H. Joseph, Z. I. Kertesz, H. H. Mottern, and A. G. Olsen, Chem.

Hematology Reagents Hematology Reagents - BrandSD

BC-5300, BC-5380, BC-5100, BC-5180. M-50 Diluent, LEO(I) Lyse, LEO(II) Lyse, LBA Lyse, LH Lyse, Cleanser, Probe Cleanser. BC-5500, BC-5200.

Metazoan mitochondrial gene sequence reference

Mar 14, 2017 - Gnathostomulida. Hemichordata. Kinorhyncha. Mollusca. Nematoda. Nematomorpha. Nemertea. Onychophora. Placozoa. Platyhelminthes.

The Reference Genome Sequence of

of Saccharomyces cerevisiae: Then and Now. Stacia R. Engel,*,1 Fred S. Dietrich,â Dianna G. Fisk,* Gail Binkley,* Rama Balakrishnan,*. Maria C. Costanzo,* ...

TABLE 1 Primers used in this study Primer Sequence (5' to 3') Primers

Sequence (5' to 3'). Primers for gene cloning. ccpAF. CTAGCTAGCGGCTATTTTTATATGGAAAAACAAAC. ccpAR. CGAACTTAATCAGCAGACTTGG. Primers for ...

Table S1. Primers used in the study. Name Sequence

Cytokinin (BAP) bud induction assay. WT protonemal tissue (a) and (c);. âdek1 protonemal tissue (b) and (d). Protonemal tissue in (c) and (d) were treated for 48.

Table S3. Primers used in this work Primer Sequence - PLOS

Table S3. Primers used in this work. Primer. Sequence (5`-3`)a. Locationb. PCR product size (bp). Use. Reference or source. ACrnaF.

Table S1. DNA Primers Primer Name Sequence (5

Qrr2 was present at 1.4 ÂµM in each case. On the right, the upper panels show a ribbon representation of Qrr2, predicted by iFoldRNA (26,27), superimposed with.

Table S5. Primers Used in this Study. Primer Number Sequence

Primer Number. Sequence. Information. CGCGCGCCAAGCTTGATGTCTTTGTTCA Clone LapD for B2H Fwd. AACAGCTGTTGATCGCTATC.

Plasmid or primer Description a Reference or sourceb Primers ... - PLOS

SpeCFwd. TATAAAAATTGCAGGGTAAA. SpeCRev. ATAAATATCGAAATGACTAAG. Î¦370.1 phage spd1 gene (PCR amplicon also used as Southern blot probe).

Towards a unified paradigm for sequencebased ...

Jul 8, 2013 - Arthur SchÃ¼Ãler. 24. , James A. Scott. 25. , Carolina SenÃ©s. 24. ,. Matthew E. Smith. 26. , Ave Suija. 1. , D. Lee Taylor. 27. , M. Teresa Telleria. 12.

Table S1. Primers used for qPCR qPCR primer Sequence - Plos

MALAT1 F-GACGGAGGTTGAGATGAAGC. R-ATTCGGGGCTCTGTAGTCCT. Tripathi et al., PLOS Genetics,. 2013. GusB. F- CTCATTTGGAATTTTGCCGATT.

Reagents: Mesitylene

Chemicals/Reagents: Mesitylene (Sigma-Aldrich, 98%), oleylamine (Acros Organics, ... Preparation of ammonium hydrosulfide sulfur precursor: Caution! H2S is ...

Complete Genome Sequence of Riemerella anatipestifer Reference

8 Mar 2012 - Complete Genome Sequence of Riemerella anatipestifer Reference. Strain. Xiaojia Wang,a,c DeKang Zhu,b MingShu Wang,a,b,c AnChun ...

Metazoan mitochondrial gene sequence reference ... - Semantic Scholar

Mar 14, 2017 - Entoprocta. Gastrotricha. Gnathostomulida. Hemichordata. Kinorhyncha. Mollusca. Nematoda. Nematomorpha. Nemertea. Onychophora.

Reagents for Sysmex analyzers

Oct 15, 1997 ... K-Diff Control L/N/H. 3896/3897/3898. 2.5 ml. Sysmex K series 1000. tWBC + 3 part differential analysis. Application. Description. Product Nr.

Reagents for Abbott Counters

Abbott Cell-Dyn 3500 (closed sampler CS and sample loader SL), CD 3700. tWBC + 5 part differential analysis (reticulocytes optional). Application. Description.

Reagents and Antibodies

Jul 23, 2016 - Proteomic Analysis of a Detergent-resistant Membrane Skeleton ...... Zacharias, D. A., Violin, J. D., Newton, A. C., and Tsien, R. Y. (2002) Science 296, 913- ... Friedrichson, T., and Kurzchalia, T. V. (1998) Nature 394, 802-805.

(EBX) Reagents

classical behavior (umpolung reactivity) with exceptional reactivity of EBX reagents, made us to consider them suitable for alkynylation of 2-oxindoles. Herein ...

Bioconjugate Reagents

and a secondary or tertiary amine linkage made by the reductive amination of a primary or secondary amine with an aldehyde group. Therefore, using these ...

IVIS|Reagents & Biologicals

Explorer Kit. Pre-formulated chemiluminescent probe for monitoring inflammation. 5 injections. 760535. XenoLight RediJec

SEQUENCE-BASED REAGENTS SEQUENCE REFERENCE Primers ...

Download PDF

1 downloads 0 Views 45KB Size Report

Comment

pre_mLrwd1_qF agggaagatgggccacagaaatga. Duong and Weitz, 2014. pre_mLrwd1_qR ggaatgggcacaatcaaagcgtga. Duong and Weitz, 2014. Primers for ChIP.

! SEQUENCE-BASED REAGENTS Primers for RT-PCR mTbp_qF mTbp_qR hCry1_qF hCry1_qR pre_mBmal1_qF pre_mBmal1_qR pre_mPer2_qF pre_mPer2_qR pre_mPer1_qF pre_mPer1_qR pre_mDbp_qF pre_mDbp_qR pre_mLrwd1_qF pre_mLrwd1_qR Primers for ChIP mPer2E2_ChIPF mPer2E2_ChIPR mDbp-0.4_ChIPF mDbp-0.4_ChIPR mLrwd1_ChIPF mLrwd1_ChIPR Primers for genotyping hCry1i10F hCry1i12R

SEQUENCE

REFERENCE

ccttcaccaatgactcctatgac caagtttacagccaagattcac atccgctgcgtctacatcct tccaaagggctcagaatcatact gagggagtctgccatctgaa cacactaccacaaacttccc gtcattctccttgtgccttc ccacattacctcaaagtccc attctgagggtgtatctgccgctt taaggaatcaccacaccaccacca ccctctttctttcctttggcctca tcaggcacattcctcatccctagt agggaagatgggccacagaaatga ggaatgggcacaatcaaagcgtga

This study This study This study Zhang et al. 2009 This study This study This study This study Duong et al., 2011 Duong et al., 2011 Duong et al., 2011 Duong et al., 2011 Duong and Weitz, 2014 Duong and Weitz, 2014

ggttccgccccgccagtatgc ccgtcacttggtgcgctcggc acacccgcatccgatagc ccacttcgggccaatgag ttacaggcaagctgggccttagtt ttatctgcgagagacaacgccaca

Koike et al., 2012 Koike et al., 2012 Koike et al., 2012 Koike et al., 2012 Duong and Weitz, 2014 Duong and Weitz, 2014

gtcaacacttctgtgagcct cagatgcatgtctcttgacc

This study This study