sugar-regulated gene, RAmy3D, for rice a-amylase and not in that of the ..... Rogers,J.C. and Rogers,S.W. (1992) Plant Cell 4, 1443-1451. 14. Huang,N., Sutliff ...
1948-1953 Nucleic Acids Research, 1994, Vol. 22, No. 11 -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Sequence-specific interactions of a nuclear protein factor with the promoter region of a rice gene for ao-amylase, RAmy3D Shin-ichiro Mitsunaga*, Raymond L.Rodriguez1 and Junji Yamaguchi Nagoya University, BioScience Center, Chikusa-ku, Nagoya 464-01, Japan and 'Department of Genetics, University of California, Davis, CA 95616, USA Received May 2, 1994; Accepted May 6, 1994
ABSTRACT The expression of a rice gene for a-amylase, RAmy3D, in suspension-cultured cells is induced at the transcriptional level by the deprivation of sugars. Binding of a nuclear protein from suspension-cultured rice cells to the promoter region of the RAmy3D gene was studied by gel-retardation and DNase I footprinting assays. Gel-retardation assays indicated that a 358-bp fragment of the promoter region interacted specifically with a protein factor from suspension-cultured cells. DNase I footprinting analysis allowed us to define three protein-binding regions. Each of these protein-binding sequences contained the GCCG G/C CG motif, which is specifically present in the promoter region of the sugar-regulated gene, RAmy3D, for rice a-amylase and not in that of the gibberellin-regulated RAmylA gene. Subsequent cross-competition experiments using gelretardation assay and synthetic oligonucleotides showed that the GCCG G/C CG motifs directly mediated the binding of a nuclear protein. These observations are discussed in relation to expression of the gene for a-amylase in suspension-cultured cells. INTRODUCTION a-Amylase (EC 3.2.1.1.) is an endoglycolytic enzyme that plays an important role in the germination of cereal seeds. a-Amylases are responsible for the mobilization of stored endosperm reserves that provide the growing seedling with a supply of fixed carbon and reduced nitrogen (1). Gibberellins are phytohormones that are synthesized in the germinating cereal embryo and diffuse to the aleurone cells that surround the starchy endosperm. Much interest in gibberellins is based on the observation that they can stimulate aleurone cells to produce a range of hydrolytic enzymes, in particular, aamylase (2, 3). The synthesis of ca-amylase is accompanied by a dramatic increase in the level of the corresponding mRNA, the accumulation of which has been shown to be regulated at the transcriptional level (4, 5). *To whom correspondence should be addressed at:
Niigata 943, Japan
Among the cereals, barley, wheat and rice have been the most extensively studied with regard to the induction of a-amylase. In these cereals, genes for ca-amylases have been cloned and their expression during seed germination studied (6, 7, 8, 9). Because the transcription of these genes may involve the interaction of trans-acting factors with cis-elements in the promoter region (5' flanking region), the functional analysis of the promoters of genes for cx-amylase using transient expression assays has been initiated in several laboratories as part of an attempt to identify gibberellinresponse elements (GAREs) involved in hormone-regulated gene expression (10, 11, 12, 13). a-Amylases in rice are encoded by a multigene family that consists of at least ten genes (14, 15) located on five different chromosomes (16). These ten distinct genes have been identified and grouped into the following three subfamilies: RAinylA-IC; RAm4ry2A and RAmy3A-3F (17, 18, 19). Although aleurone cells are the major sites of production of ct-amylases in germinating rice, enzymatic (20, 21) and electron microscopie (22) studies have shown that the initial site of starch degradation in intact rice grains is in a region immediately adjacent to the scutellar epithelium. It is, as yet, unclear whether expression of ca-amylases in rice scutellar tissue is gibberellin-regulated or not, but the biosynthesis and transport of a-amylase isozymes have been studied extensively in isolated scutella (23). Recent studies suggest that the scutellar epithelium is the initial site of expression of the RAny3D gene in the rice grain and that this expression is regulated at the transcriptional level by a variety of sugars (24, 25). In the scutella of the isolated embryo, a high level of expression of RAny3D is induced at the transcriptional level by the deprivation of sugars (glucose, fructose, maltose and sucrose). In addition, the expression of the RAny3D gene is similarly subject to regulation by sugar in suspension-cultured rice cells generated from embryonic scutella (26, 27) (Geshi et al., submitted). In this study, we initiated experiments designed to identify the protein factors that control expression of the RAmy3D gene in suspension-cultured rice cells. We identified DNA-binding factors that specifically interact with the promoter region of the RAny3D
Department of Life and Health Science, Joetsu University of Education,
Yamayashiki
1, Joetsu,
Nucleic Acids Research, 1994, Vol. 22, No. 11 1949 gene, using gel- retardation assays and DNase I footprinting analysis.
MATERIALS AND METHODS Cultures of rice cells Rice callus was generated from embryonic scutella of the rice variety Nipponbare (28). Rice seeds were dehulled and surfacesterilized with a 3% solution of NaClO that contained 0.1% Tween 20 for 30 min and they were then washed extensively with sterile distilled water. The washed seeds were placed on suspension medium that contained 1 % agar. The suspension medium consisted of inorganic salts of R2 medium (29), 5.6 mg/l FeSO4, 7.5 mg/l Na2EDTA, the vitamins of MS medium (30), 2.0 mg/l glycine, 2 mg/l 2,4-D and 3% sucrose. Embryonic cultures were incubated at 25°C in the dark. Four weeks later, initiated callus tissues were transferred to 150 ml of liquid suspension medium in a 500-ml Erlenmyer flask. Cultures were incubated at 25°C with gentle shaking under constant light. Established suspension-cultured cells were subcultured every 3 weeks by transfer of about 2 g fresh weight of cells into 200 ml of fresh liquid suspension medium in a 500-ml flask. All procedures were carried. under aseptic conditions. Preparation of nuclear extracts Crude nuclear extracts from suspension-cultured rice cells were prepared as described by Mikami et al. (31). About 100 g (fresh weight) of 2-week-cultured cells, which had been pulverized in liquid nitrogen, were homogenized in 500 ml of homogenizing buffer (50 mM Tris-HCl, pH 7.9, 5 mM MgCl2, 1 mM PMSF, 1.6 mM salicylhydroxamic acid, 1 ,Ag/ml t-butylated hydroxytoluene, 5 mM DTT) in a homogenizer (HG-3; Hitachi) at moderate speed for 1 min. The homogenate was filtered through a double layer of cheesecloth and a double layer of miracloth. The filtrate was centrifuged at 3,300 xg for 10 min. The precipitate (crude nuclear phase) was resuspended in 30 ml of nuclear extraction buffer (10 mM Tris-HCl, pH 7.9, 5 mM MgCl2, 5 mM EDTA, 25% glycerol, 1 mM PMSF, 2 mM DTT). Then a 5 M solution of NaCl was added slowly to give a final concentration of NaCl of 0.5 M. Nuclei were extracted for 30 min with gentle stirring. The resultant highly viscous solution was centrifuged at 25,000 x g for 30 min to sediment DNA. The clear supernatant was dialyzed for 12 h against two liters of dialysis buffer (20 mM Hepes-KOH, pH 7.9, 100 mM KCl, 12.5 mM MgCl2, 0.2 mM EDTA, 20% glycerol, 1 mM PMSF, 2 mM DTT) with three changes of buffer. The dialysate was centrifuged at 25,000 x g for 30 min. The supernatant, designated crude nuclear extract, was quick-frozen in small aliquots in liquid nitrogen, and stored at - 80°C. All procedures were carried out at 4°C. Concentrations of protein were determined with a Bio-Rad kit. Preparation of DNA fragments A 358-bp NdeI-BstP I fragment [-422 (582) to -65 (939) relative to the site of initiation of transcription; the brackets indicate the original number of sequence described in elsewhere (32)], just upstream of the TATA box was excised from the recombinant plasmid pOSglAl .SS in which the upstream region of RAny3D had been subcloned (32). The DNA fragment was
isolated from a low-melting-temperature agarose gel (4% NuSieve GTG agarose; FMC) by the standard procedure (3). For gelretardation assays and DNase I footprinting, the isolated DNA fragment was labeled at the 3'-end of the coding strand with [a-32P]dCTP and the Klenow fragment of DNA polymerase and then it was used as a probe. Gel-retardation assays All procedures for gel-retardation assays were performed as described by Mikami et al. (31), with slight modifications. Binding reactions were carried out in a total volume of 20 11 of a solution that contained 17 mM Hepes-KOH, pH 7.9, 60 mM KCI, 7.5 mM MgCl2, 0.12 mM EDTA, 17% glycerol, 0.6 mM PMSF, 1.2 mM DTT, 4,tg poly(dI-dC)poly(dI-dC), 2-12 Ag of protein in a crude nuclear extract, labeled probe (2 ng) and competitor DNA (0, 50 or 200 ng). The assay mixtures were incubated for 30 min at room temperature. The reaction mixtures were layered on 4 % acrylamide gels that contained a low-ionicstrength electrophoresis buffer (6.7 mM Tris-HCI, pH 7.9, 1 mM EDTA, and 3.3 mM sodium acetate). The gels (13 x 13 cm2, 1 mm thick) had been pre-run in the above buffer for 1 h at 20 mA and 4°C with recirculation of the buffer. Subsequent electrophoresis of samples was performed for 1 h under the same conditions, except that the current was 30 mA. The gels were blotted on Whatman 3MM paper, dried and subjected to autoradiography for 12 h at -80°C with an intensifying screen. In the competition experiments, the reaction conditions were the same as for the standard binding reaction and specific or nonspecific competitor DNAs were added. As the specific competitor DNA, the non-isotopically labeled NdeI -BstP I fragment was used. For non-specific competitor DNA, pBluescript KS(Stratagene) was digested with HaeHJ. The products of digestion were extracted with phenol, precipitated with ethanol at - 80°C and used as competitor DNA. In the cross-competition experiments, two kinds of synthetic double-stranded oligonucleotides having the HindlII-tailed heptameric motifs were used as the sequence-specific competitors. The sequences of competitors, designated GCCGGCG and GCCGCCG oligomer, are the following: 5'-AGCTTGCCGGCGAAGCT-3' and 5 '-AGCTTGCCGCCGAAGCT-3', respectively. DNase I footprinting The DNase I footprinting assay was performed in a total volume of 100 1l under the same conditions as the above competition experiments (Fig. 2, lane 5). After binding, 10 1il of a solution of DNase I (25 jig/ml) were added to the reaction mixture, and the entire mixture was incubated at room temperature for 30 s. The reaction was terminated by the addition of 200 tdl of a stop solution (100 mM Tris-HCI, pH 7.9, 100 mM NaCl, 50 mM EDTA, 1 % SDS, 500 pg/ml proteinase K, and 30 Ag/ml yeast tRNA) (34), after which this mixture was further incubated 37°C for 30 min. The DNA then was extracted three times with phenol, precipitated twice with sodium acetate and ethanol at -80°C, and subjected to electrophoresis on a 6% sequencing gel (40 x20 cm2, 0.4 mm thick) in 0.5 xTBE buffer. The gel was fixed and dried and then the radioactivity was recorded on the imaging plate of a Bio-Imaging Analyzer (Fujix BAS2000; Fuji Photo Film) with an exposure time of 12 h.
1950 Nucleic Acids Research, 1994, Vol. 22, No. 11
RESULTS Preliminary experiments It has already been shown that the sugars in the 3% sucrosecontaining suspension medium fall to almost undetectable levels by day 12 (26, 35, 36). A concomitant increase in ca-amylase activity in suspension-cultured cells is observed on day 12. To examine this phenomenon in greater detail, non-sizefrcinated RNA dot-blot analysis was used to measure the relative levels of mRNA for cx-amylase in suspension-cultured cells. The cDNA clone pOS 137, encoding the gene for ct-amylase RAny3D (37), was used to detect the mRNA. The results of dot-blot analysis revealed a dramatic increase in the level of RAmy3D mRNA on day 12. This increase could be readily reversed by the replenishment of sugars (glucose, fructose and sucrose) in the suspension medium (Geshi et al., submitted). These results indicate that the expression of the RAmy3D gene in suspension-cultured cells is induced at the transcriptional level by the deprivation of sugars. Therefore, the promoter region of RAmy3D and 2-week-cultured suspension cells were used to study the putative sugar-regulated transcription factors and cis-acting
however, unaffected by the addition of the non-specific competitor, a digest of pBluescript KS- (Fig. 2, lanes 5 and 6). This competition experiment shows that the band indicated by the closed arrow (B, corresponding to Bl in Fig. 1) represents a specific binding-complex while that indicated by the open arrow (corresponding to B2 in Fig. 1) represents a non-specific bindingcomplex.
c
Et
X
3.
3
4
CF
elements.
DNA-binding proteins interact specifically with the promoter region of RAmy3D In the case of cereal genes for ct-amylase, it is generally accepted that the sequence elements involved in high-level gene expression lie within 300- bp upstream of the site of initiation of transcription (38, 39, 40). Therefore, a 358-bp NdeI-BstP I fragment (-422 to -65), just upstream of the TATA box of the R4ny3D promoter was used in the following binding experiments. For gel-retardation assays, the 358-bp fragment was incubated with a crude nuclear extract plus increasing amounts of specific or non-specific competitor DNA. In the absence of the competitor DNA, two bands with lower electrophoretic mobilities than the free probe were observed (Fig. 1, BI and B2). Because these bands disappeared after treatment of crude nuclear extracts with proteinase K, it is very likely that they represented DNA-protein complexes. When the specific competitor was included in the binding mixture, both bands were specifically attenuated in the assays with crude nuclear extracts (Fig. 2, lanes 3 and 4). The intensity of the band indicated by the closed arrow in Figure 2 was, 0
2
4
6
Figure 2. Competition experiments to examine DNA-protein interactions. Twelve mg of nuclear protein from suspension-cultured rice cells were incubated with the RAmy3D promoter fragment (-422 to -65). Lanes with competitor DNA added are indicated, as is the presence of a 25-fold (50 ng) and a 100-fold (200 ng) excess (w/w) of the competing DNA. Lane 1, no nuclear protein; lane 2, no competitor DNA; lanes 3 and 4, non-isotopically labeled RAm?y3D promoter used as a specific competitor; lanes 5 and 6, products of digestion pBluescript KS- used as a non-specific competitor (see Materials and Methods). Closed arrows indicate the specific binding-complex (B) and the free probe (F). B corresponds to B1 in Fig. 1. The open arrow indicates the non-specific complex (corresponding to B2 in Fig. 1).
A
-275
-233-_| | i]Box2 Box 3
PK 8 10 12 12
-184-||| A'
s
-4 B2
-4F
Figure 1. Gel-retardation assays of the RAmty3D promoter fragment (-422 to -65) with increasing amounts of nuclear protein from suspension-cultured rice cells. The number above each lane indicates the amount (ug) of nuclear protein used. The lane labeled PK shows the results of binding with 12 1&g of nuclear protein that had been incubated with proteinase K for 30 min at room temperature. The positions of the two DNA-protein binding complexes, BI and B2, and the free probe (F) are shown by arrows.
Fgure 3. DNase I footprints showing binding of nuclear proteins from suspensioncultured rice cells to the promoter fragment of RAmy3D (-422 to -65). The lane labeled - shows the DNase I digestion pattern obtained in the absence of nuclear protein. The lane labeled + shows the pattern obtained after 60 /Ag of nuclear protein had been incubated with the 10 ng of probe for 30 min prior to digestion by DNase I. Protected regions are indicated and designated boxes 1, 2 and 3. The products of a Maxam-Gilbert 'A+G' cleavage reaction of the same fragment were used as size markers (lane A+G), and numbers indicate positions relative to the site of initiation of transcription.
Nucleic Acids Research, 1994, Vol. 22, No. 11 1951
Localization of binding domains in the promoter region of RAmy3D DNase I footprinting experiments were performed to locate elements within the RAmy3D promoter region that interact with proteins in crude nuclear extracts from suspension-cultured rice cells. In order to eliminate non-specific binding, experiments were performed in the presence of a 25-fold excess (w/w, 50 ng) of non-specific competitor, namely, the digest of pBluescript KS(see Fig. 2, lane 5). With the NdeI-BstP I fragment, three regions of DNA -protein interaction were apparent (Fig. 3) and they are labeled boxes 1 to 3 in Figures 3 and 4. The highly conserved GCCG G/C CG motif was located at approximately the center of each of the three protected regions. To investigate whether these heptameric motifs in the R4ny3D promoter were essential for this protein interaction, the crosscompetition experiments using gel-retardation assay were performed. The competitors were double-stranded synthetic oligonucleotides containing the conserved GCCG G/C CG motif (see Materials and Methods for sequence). The effects of synthetic oligomers on the binding of a nuclear protein to the promoter are shown in Figure 5. As seen in lanes 5 to 10, the specific binding-complex (B) was effectively competed by the GCCGGCG and/or the GCCGCCG oligomers. These results show that the conserved GCCG G/C CG motifs of RAmy3D directly mediate the binding of a nuclear protein to the promoter. The intensity of the non-specific bands indicated by the open arrow remained unchanged throughout the lanes 5 to 10. Consequently these bands serve as a control for quantitative change of the sequence-specific bands. The reason why the attenuation by the GCCGGCG oligomer was more effectively than by the GCCGCCG is now under discussion (lanes 6 and 8).
DISCUSSION Sugar-regulated transcriptional control of RAmy3D We identified DNA-binding factors that interacted specifically with the promoter region of R4my3D, using gel-retardation assays (Fig. 2). The results of dot-blot analysis (see preliminary
experiments) suggest that these DNA-binding factors exert positive control over the transcription of RAmy3D. DNase I footprinting analysis allowed us to localize three protein-binding regions in the promoter (Figs. 3 and 4). The highly conserved GCCG G/C CG motif was located at approximately the center of each of the three binding regions. This sequence motif was only found between positions -422 to -65 and was not present in further upstream or downstream regions of the RAmy3D promoter. In addition, the gibberellininducible rice gene for ot-amylase, RAmyJA contains no GCCG G/C CG motif in its promoter region. Subsequent crosscompetition experiments using gel-retardation assay and synthetic oligonucleotides showed that the GCCG G/C CG motifs directly mediated the binding of a nuclear protein to the promoter (Fig. 5). These observations suggest that the GCCG G/C CG motifs of RAmy3D may be functionally significant for sugar-regulated transcriptional control. Competition studies are currently being performed using oligonucleotides complementary to the promoter region of RA4myJA and other oa-amylase genes as competitive DNAs. Further studies will be aimed at identifying the protein factors that mediate the sugar-responsiveness of RAmy3D.
Promoter regions of cereal genes for ax-amylase Examination of promoter regions of cereal genes for a-amylase reveals the presence of three types of highly conserved box sequence: the pyrimidine box (C/T CTTTT C/T); the amylase box (TAACA A/G A) and the CATC box (TATCCAT) (14). Skriver et al. (10) showed that tandemly repeated copies of GGCCGATAACAAACTCCGGCC in the promoter of the barley gene Amy 6-4 for a high-pI ca-amylase fused to a minimal promoter resulted in gibberellin-responsive expression in barley aleurone protoplasts. This 21-bp sequence contains an amylase box (TAACAAA). Therefore, this TAACAAA motif is identified as a gibberellin-responsive elements (GAREs).
~0 0C, C00U
000 E E.0 oo oo o
xmoxxiLo 12 3 04
-422 TATGTGCATATACATGACGGGAGATCAAGCGGCCAGTCAAGAGGCTAACT
x x o0xi Nxxj 0
F
GCAACCCTATTATATACGATCAGCCTGCTAGAACACGTAGCACTGTCTTT
B
TTTGTCTGAACTCTGAAGATGAAAGGTTCAGAGAAATGGCTCGCCTTATC -248
-271 Box 1 -260
Box 2
-233
CAAgCGC9CATGGATGGAGGGAGAGGTAgf,ggCgCCCGCCTCAGGCAG -217
Box 3
-193
TCGTCtGATCACg9g9.CATCCCGTC&CCTTGGAGACCGGGCCCCGA 1
2 3 4 5 6 7 8 9 10
CGCGGCCGACGCGGCGCCTACGTGGCCATGCTTTATTGCCTTATCCATAT CCACGCCATTTATTGTGGTCGTCTCTCCTGATCATTCTCATTCCCCTGCC -65 ACGGTGAC
Figure 4. Summary of footprinting data from the RAnmy3D promoter. Boxes are indicated and the maximum extent of protected areas is shown by brackets. Consensus sequences (GCCG G/C CG) are underlined. Numbers indicate positions relative to the site of initiation of transcription. Asterisks indicate the conserved pyrimidine box (TC TTTT) and the CATC box (TATCCAT) (see Discussion).
Figure 5. Cross-competition experiments using gel-retardation assay and synthetic oligonucleotides. The reaction conditions were the same as for the competition experiments and the results of lanes 1 to 4 corresponded to that of Figure 2. Lane 1, control with no nuclear protein; lane 2, positive control with no competitor DNA; lanes 3 and 4, non-isotopically labeled RAmy3D promoter used as a competitor; lane 5 and 6, the GCCGGCG oligomer as a competitor; lanes 7 and 8, the GCCGCCG oligomer as a competitor; lanes 9 and 10, the mixture of two oligomers as a competitor. Closed arrows indicate the sequence-specific bindingcomplex (B) and the free probe (F). The open arrow indicates the non-specific complex.
1952 Nucleic Acids Research, 1994, Vol. 22, No. 11 Lanahan et al. (41) reported the functional analysis of the promoter of the Amy32b gene, which encodes for a low-pI aamylase in barley. Using deletion and mutation analysis, they found that the pyrimidine box, a non-conserved GCAGTG sequence adjacent to the conserved CATC box, and an Opaque-2 binding sequence (02S) just upstream of the pyrimidine box were important in modulating the absolute level of gene expression. In subsequent experiments, they demonstrated that 02S and GARE were essential for gibberellin-induced transcription above a minimal level, and they designated the 02S and GARE together a gibberellin-response complex (GARC) (13). Recently, Gubler and Jacobsen (11) proposed that the CATC box of the promoter of a barley gene Amy pHV 19, for a high-pI a-amylase acts cooperatively with GARE to give a high level of gibberellin-regulated expression and that, together, these motifs form important components of a gibberellin-response complex in the gene for the high-pI ox-amylase. An 02S in the Amy pHV19 genes appears to be unimportant in transcriptional control. Thus, it seems that the amylase box (GAREs), located between the pyrimidine box and the CATC box, plays an important role in the responsiveness to gibberellins of cereal genes for a-amylases. The promoter region of RAm4y3D also contains a highly conserved pyrimidine box and a CATC box. However, the amylase box is absent (14, 32). The absence of the amylase box strongly suggests that the system for transcriptional control of RAmy3D differs from that of gibberellin-responsive gene for aamylases. And this also suggests that the GCCG G/C CG motifs which located between the pyrimidine box and the CATC box, may play a central role in the control of the expression of RAmy3D, instead of an amylase box.
Isozymes of cereal ca-amylases The barley genes for a-amylases have been classified into two distinct subfamilies (Amyl and Amy2), on the basis of the isoelectric points of isozymes encoded by members of the multigene family (the high-pI and low-pI group respectively) (42). The expression of both the high- and low-pI groups is induced by gibberellins at the transcriptional level. The situation in wheat is very similar to that in barley. Wheat isozymes fall into two pl groups, although there are many more isozymes in wheat than in barley (42). The two groups of isozymes differ in many ways while isozymes within groups are somewhat alike. Interesting differences are emerging between the controlling elements within the promoters of the genes for the high- and low-pI a-amylases. Although there is considerable sequence similarity among promoters within groups, there is little such similarity between groups apart from the highly conserved sequences mentioned previously. This observation suggests that the expression of genes for high- and low-pI cx-amylases is controlled in different ways (1 1). By contrast, the ax-amylase isozymes produced by germinating rice seeds have been characterized as A and B (low-pI), and D (high-pI), respectively (43). These isozymes are encoded by a multigene family of at least ten genes (14, 15) that are located on five different chromosomes (16). Recent analysis showed that gibberellin-inducible isozymes A and B are the products of transcription of RAnmyA (44, 45). Partial amino acid sequence analysis revealed that isozyme D corresponds to the product of RAmy3D (Geshi et al. submitted). Therefore, in germinating rice seed, it is possible that the
expression of the low-pI (A, B) isozyme of a-amylase is induced by gibberellins and that of the high-pI (D) isozyme is repressed by sugars. This phenomenon is very different from that in barley and wheat. To date, the effects of sugars on the expression of rice genes for ca-amylase are the only known example of sugar regulation of plant ct-amylases.
Comparison of the promoter sequences of sugar-regulated genes In plants, the mechanisms of metabolic regulation are not well understood. However, several sugar-repressed genes have been reported (46, 47) and a comparison of the promoter region of these genes has been reported elsewhere (24). The analysis revealed six homologous elements which ranged from 6 to 7 base pairs, in a 2000-bp region upstream from the site of initiation of transcription in RAmy3D, gene 1 for chlorophyll a/b-binding protein (CAB) ofZea mays (47), the gene for the C-4 type phosphoenolpyruvate carboxylase (PEPC) of Z. mays (47) and the gene for the sucrose synthase (Shl) of Z. mays (46). One of these elements, a hexanucleotide CGGCGC motif is partially identical to the GCCG G/C CG motif. However, the total length of this motif is not the same in these genes. By contrast, in microorganisms, single-celled eukaryotes and higher animals (48, 49, 50), many sugar-regulatory mechanisms act at the level of gene transcription. It is of interest that expression of a gene for the ca-amylase is strongly repressed by dietary glucose in the larvae of Drosophila melanogaster and D. virilis. A sequence comparison between the promoters from D. melanogaster (51) and D. virilis (52) indicated that the sequence elements required for repression by glucose in Drosophila species are conserved. However, the GCCG G/C CG motif was not found in either promoter region (52). These observations conflict with the conclusion that GCCG G/C CG motif is a sugarregulated cis-acting element. On the other hand, Hintz and Lagosky (53) reported a putative binding sequence (GCGGGGC) for the glucose-responsive repressor protein CreA at two positions in the gene for alcohol dehydrogenase I (alcA) of Aspergillus nidulans. The composition of this binding sequence is very similar to the GCCG G/C CG motif, suggesting that a tandemly repeated 7-bp sequence with high GC content might play a crucial role in the binding of sugarregulated trans-acting factors.
ACKNOWLEDGEMENTS We would like to thank Dr T.Akazawa, N.Geshi and Dr T.Mitsui for generously providing us with unpublished data. We also grateful to Dr S.Muto and his staff at the laboratory of Cell Signalling, Nagoya University, BioScience Center for their helpful discussions. This research was supported in part by Grants-in Aid no. 05276102 for Special Research on Priority Areas and no. 03559002 from the Ministry of Education, Science and Culture (monbusho), Japan.
REFERENCES 1. Fincher,G.B. (1989) Annu. Rev. Plant Physiol. Plant Mol. Biol. 40,
305-346. 2. Akazawa,T., Yamaguchi,J. and Hayashi,M. (1990) In Takahashi,N., Phinney,B.O. and MacMillan,J. (eds.), Gibberellins. Springer-Verlag, New York, pp. 114-124.
Nucleic Acids Research, 1994, Vol. 22, No. 11 1953 3. Mitsunaga,S., Tashiro,T. and Yamaguchi,J. (1994) Theor. Appl. Genet. 87, 705-712. 4. Higgins,T.J.V., Zwar,J.A. and Jacobsen,J.V. (1976) Nature 260, 166-169. 5. Jacobsen,J.V. and Beach,L.R. (1985) Nature 316, 275-277. 6. Chandler,P.M., Zwar,J.A., Jacobsen,J.V., Higgins,T.J.V. and Inglis,A.S. (1984) Plant Mol. Biol. 3, 407-418. 7. Huttly,A.K., Martienssen,R.A. and Baulcombe,D.C. (1988) Mol. Gen. Genet. 214, 232-240. 8. Khursheed,B. and Rogers,J.C. (1988) J. Biol. Chem. 263, 18953-18960. 9. Karrer,E.E., Litts,J.C. and Rodriguez,R.L. (1991) Plant Mol. Biol. 16, 797-805. 10. Skriver,K., Olsen,F.L., Rogers,J.C. and Mundy,J. (1991) Proc. Natd. Acad. Sci. USA 88, 7266-7270. 11. Gubler,F. and Jacobsen,J.V. (1992) Plant Cell 4, 1435-1441. 12. Huttly,A.K., Phillips,A.L. and Tregear,J.W. (1992) Plant Mol. Biol. 19, 903-911. 13. Rogers,J.C. and Rogers,S.W. (1992) Plant Cell 4, 1443-1451. 14. Huang,N., Sutliff,T.D., Litts,J.C. and Rodriguez,R.L. (1990) Plant Mol. Biol. 14, 655-668. 15. Sudliff,T.D., Huang,N., Litts,J.C. and Rodriguez,R.L. (1991) Plant Mol. Biol. 26, 579-591. 16. Ranjhan,S., Litts,J.C., Foolad,M.R. and Rodriguez,R.L. (1991) Theor. Appl. Genet. 82, 481-488. 17. Rodriguez,R.L., Huang,N., Sudiff,T.D., Ranjhan,S., Karrer,E.E. and Litts,J.C. (1990) In Rice Genetics, Proceedings of the 2nd International Rice Genetics Symposium, IRRI, Island Publishing House Inc. Manila, Philippines, pp. 417-429. 18. Huang,N., Reinl,S.J. and Rodriguez,R.L. (1992) Gene 111, 223-228. 19. Huang,N., Stebbins,G.L. and Rodriguez,R.L. (1992) Proc. Natd. Acad. Sci. USA 89, 7526-7530. 20. Okamoto,K. and Akazawa,T. (1979) Plant Physiol. 63, 336-340. 21. Okamoto,K., Kitano,H. and Akazawa,T. (1980) Plant Cell Physiol. 21, 201-204. 22. Okamoto,K., Murai,T., Eguchi,G., Okamoto,M. and Akazawa,T. (1982) Plant Physiol. 70, 905-911. 23. Akazawa,T., Mitsui,T and Hayashi,M. (1988) In Preiss J. (ed.), The Biochemistry of Plants. 14. Academic Press, New York, pp. 465-492. 24. Karrer,E.E. and Rodriguez,R.L. (1992) Plant J. 2, 517-523. 25. Ranjhan,S., Karrer,E.E. and Rodriguez,R.L. (1992) Plant Cell Physiol. 33, 73-79. 26. Yu,S-M., Kuo,Y-H., Sheu,G., Sheu,Y-J. and Liu,L-F. (1991) J. Biol. Chem. 266, 21131-21137. 27. Yu,S-M., Tzou,W-S., Lo,W-S., Kuo,Y-H., Lee,H-T. and Wu,R. (1992) Gene 122, 247-253. 28. Kyozuka,J., Hayashi,Y. and Shimamoto,K. (1987) Mol. Gen. Genet. 206, 408-413. 29. Ohira,K., Ojima,K. and Fujiwara,A. (1973) Plant Cell Physiol. 14, 1113-1121. 30. Murashige,T. and Skoog,F. (1962) Physiol. Plant. 15, 473 -497. 31. Mikami,K., Tabata,T., Kawata,T., Nakayama,T. and Iwabuchi,M. (1987) FEBS Lett. 223, 273 -278. 32. Huang,N., Koizumi,N., Reinl,S. and Rodriguez,R.L. (1990) Nucl. Acids Res. 18, 7007-7014. 33. Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A laboratory Manual. Cold Spring Harbor University Press, Cold Spring Harbor. 34. Mikami,K., Nakayama,T., Kawata,T., Tabata,T. and Iwabuchi,M. (1989) Plant Cell Physiol. 30, 107-119. 35. Amino,S. and Tazawa,M. (1988) Plant Cell Physiol. 29, 483-487. 36. Chiba,Y., Ui,M., Kato,Y., Nakajima,T. and Ichishima,E. (1990) Phytochemistry 29, 2075 -2078. 37. O'Neill,S.D., Kumagai,M.H., Majumder,A., Huang,N., Sutliff,T.D. and Rodriguez,R.L. (1990) Mol. Gen. Genet. 221, 235-244. 38. Huttly,A.K. and Baulcombe,D.C. (1989) EMBO J. 8, 1907-1913. 39. Kim,J-K., Cao,J. and Wu,R. (1992) Mol. Gen. Genet. 232, 383-393. 40. Rushton,P.J., Hooley,R. and Lazarus,C.M. (1992) Plant Mol. Biol. 19, 891-901. 41. Lanahan,M.B., Ho,T-H.D., Rogers,S.W. and Rogers,J.C. (1992) Plant Cell 4, 203-211. 42. MacGregor,E.A. and MacGregor,A.W. (1987) CRC Crit. Rev. Biotech. 5, 129-142. 43. Daussant,J., Miyata,S., Mitsui,T. and Akazawa,T. (1983) Plant Physiol. 71, 88-95. 44. Kumagai,M.H., Shah,M., Terashima,M., Vrkljan,Z., Whitaker,J.R. and Rodriguez,R.L. (1990) Gene 94, 209-216.
Mitsunaga,S. and Yamaguchi,J. (1993) Plant Cell Physiol. 34, 243-249. Maas,C., Schaal,S. and Werr,W. (1990) EMBO J. 9, 3447-3452. Sheen,J. (1990) Plant Cell 2, 1027-1038. Carlson,M. (1987) J. Bacteriol. 169, 4873-4877. Adhya,S. (1989) Annu. Rev. Genet. 23, 227-250. Renkawitz,R. (1990) Trends Genet. 6, 192-196. Magoulas,C., Bally-Cuif,L., Loverre-Chyurlia,A., Benkel,B. and Hickey,D.A. (1993) Genetics 134, 507-515. 52. Magoulas,C., Loverre-Chyurlia,A., Abukashawa,S., Bally-Cuif,L. and Hickey,D.A. (1993) J. Mol. Evol. 36, 234-242. 53. Hintz,W.E. and Lagosky,P.A. (1993) Bio/Technology 11, 815-818.
45. 46. 47. 48. 49. 50. 51.
