Sequences complementary to the brain-specific" identifier" sequences ...

THEJOURNAL OF BIOLOGICAL CHEMI~TRY Vol. 261,No. 4, Issue of February 5, pp. 1499-1502,lW 0 1986 by The American Society of Biological Chemists, Inc. Printed in U.S.A.

Communication

gested that ID sequences were controlling elements involved in neuronal gene expression (1-4). In course of the sequencing of the L-type pyruvate kinase mRNAs,2 we detected in the3’ untranslated extension of one of the pyruvate kinase mRNA species a sequence that was complementary to the consensus ID sequence reported by Milner et ul. (3). A 53-base long fragment of this sequence was subcloned in both orientations in the M13 single-stranded phage. Both strands hybridized to heterogeneous RNA populations which (Received for publication, September 10,1985) were especially abundant in muscle. In addition, the strand homologous to the sequence detected in the pyruvate kinase Yu-Chun Lone, Marie-Pierre Simon, Axel Kahn, mRNA (ID probe) hybridized with the small brain-specific and Jdlle Marie RNAs described by Sutcliffe et al. (1-4) while the opposite From the Laboratoire de Recherches en Ginitique et Pathologie MoEculaires, Znstitut National dela SQflteet de strand (cID probe) hybridized with a discrete muscle-specific RNA. la Recherche Midicale U. 129, C.H.U. Cochin, 75674 Paris Cedex 14, France These findings raise the problem of the significance of the ID sequence transcription in different tissues and of their hypothetical role in thecontrol of tissue-specific gene expresA sequencecomplementarytothebrain-specific identifier sequence has been found in the 3’ untrans- sion. lated extension of the heavy 3.2-kilobase (kb)long liver L-type pyruvatekinase mRNA while it is absent EXPERIMENTAL PROCEDURES in the other two 2- and 2.2-kb long pyruvate kinase Southern Blotting Analysis-High molecular weight rat liver DNA mRNA species. A 53-base fragment corresponding to was prepared as described (5). Genomic DNA wasdigested with BglII, this identifier sequence was subcloned in both orien- HindIII, and EcoRI restriction enzymes, subjected to electrophoresis tations in the single-stranded bacteriophage M13, both on 0.8% agarose gel, and then transferred to Gene Screen plus (New strands being usedas probes to detect homologousse- England Nuclear) filters (6). Prehybridation and hybridization were performed with 32P-labeled nick-translated 2Bs + llCe and 12Hz quence in different tissues.Bothstrandsaretranscribed in various tissues and are detected in hetero- purified inserts (specific activity, 2 X 108 cpm/wg) as previously geneous high molecular weight RNA species which are described (7). Sequence Analysis of cDNA-DNA sequence analysis were obespecially abundant in the adult muscle. In addition, tained by the nucleotide chain terminator method of Sanger et al. (8) the probe identical to the identifier sequence recog- after cloning restriction fragment into bacteriophage M13 (9), and nized a discrete 0.6-kb RNA species in the muscle and also identified by the chemical modification procedure of Maxam and theprobecomplementarytotheidentifier-sequence Gilbert (10). recognized the expected two small brain-specific iden- RNA Isolation and Blot Hybridization-Total cellular RNAs were tifier BC-1 and BC-2 RNAs described by Sutcliffe et prepared as described (7) and polyadenylated RNAs were isolated by d.(Sutcliffe, J. G., Milner, R. J., Bloom, F. E., and chromatography on oligo(dT)-cellulose (11).Messenger RNAs were Lerner, R.A. (1982) Proc. Natl. Acad. Sci.U. S. A. 79, fractionated onmethyl mercury hydroxide-agarose gel electrophoresis 4942-4946; Sutcliffe, J. G., Milner, R. J., Gottesfeld, (7) then blotted ontoGene Screen plus membrane. Hybridization was J. M., and Lerner,R. A. (1984) Nature 308,237-241; performed at 60 “C in 3 X SSC (1 X SSC: 0.15 M sodium chloride, 0.015 M trisodium citrate as previously reported (7)). Filters were Milner, R. J., Bloom, F. E., Lai, C., Lerner, R. A., and washed high stringency: 1 h at 65 “C in 0.2 X SSC, 1% sodium Sutcliffe, 3. G . (1984) Proc. Nat2. Acad. Sci. U. S . A. dodecyl at sulfate. 81,713-717; Sutcliffe, J. G., Milner,R. J., Gottesfeld, Subcloningof the Pyruvate Kinase I D Sequence and Preparation of J. M., and Reynolds, W. (1984) Science 225, 1308- Singh Stranded Probes-The 53-base pair AluI-AluI fragment inter1314). nal to the cID sequence of the 12H2 pyruvate kinase clone (Figs. 1

Sequences Complementary to the Brain-specific “Identifier” Sequences Exist in L-type Pvruvate Kinase mRNA (A Liver-specific Messenger) and in Transcripts Especially Abundant in Muscle*

Identifier sequences, first described by Sutcliffe and coworkers (1-4) were novel repetitive family elements, present in the ratgenome in 1-1.5 X lo6copies. These “1D”l sequences were detected within introns of genes specifically expressed during brain differentiation. The ID sequences were also transcribed by RNA polymerase 111 under the form of two cytoplasmic RNAs of 160 and 100 nucleotides, present exclusively in neural tissues. It was sug-

and 2) was cloned into theSmuI site of bacteriophage (M13mplO (9). Phages containing a single copy of ID or cID sequences were identified by sequencing using the nucleotide chain terminator method of Sanger et al. (8).The probe was a single-stranded 32P-labeledID or cID fragment synthesized from Ml3mplO phage, using the universal 17mer sequencing primer as reported first by Church et al. (12) and modified byde Keyser et al.3 RESULTS AND DISCUSSION

We recently isolated several cDNA clones complementary to rat liver L-type pyruvate kinase mRNA which recognized either a single 3.2-kb mRNA species, or, the same species * The costs of publication of this article were defrayed in part by together with 2 shorter species of 2.2 and 2 kb (7, 13, 14). the payment of page charges. This article must therefore be hereby These three different pyruvate kinase mRNAs only differ by marked “advertisement” in accordance with 18 U.S.C. Section 1734 their 3’ untranslated extension? Most of the cDNA clones solely to indicate this fact. ’ The abbreviations used are: ID, identifier; cID, complementary identifier; kb, kilobase.

1499

* J. Marie et al., manuscript in

preparation. de Keyser et al., manuscript in preparation.

Identifier Sequences in Non Brain-specific Transcripts

1 2 3

llkbp 72

-5 4

,

0

-4

4

a r

23

n

18

I

f

r

*n

i

n‘r ”.,

-

15 Kb

I

3‘

5’

e

Q p

T 5

Ac

p.n l

llC6

Ac

LI

.

I .

q q p

I

, I

p

I

’

12H2

u

2 88

A32

FIG.1. A-B, Southern blot analysis of rat liver DNA. 10 pg of high molecular weight rat liver DNA was digested with restriction enzymes. (BglII; HindIII; EcoRI), and hybridized to 32P-labeled2Ba + llCe (A) and 12H2 ( B ) purified inserts. PK, pyruvate kinase. Bottom, partialrestriction maps of three L-type pyruvate kinase recombinant plasmids. The following restriction enzymes were indicated in the cDNA inserts; AvaII (Au); AluI (a); SauIIIA (S);AccI (AC). llCe insert hybridized with the 3.2,2.2, and 2-kb of L-type pyruvate kinase mRNA, while 2Ba and 12H2 insertsrecognized only the 3.2-kb species (7, 13). The TGA stop codon and poly(A) tail are indicated. Restriction fragmentspanning the cID sequence was underlined by a solid bar. 5 -’ 1

reverse-transcribed from the heavier mRNA species hybridized with sequences whichare highly repetitive in the genome (Fig. 1).Sequencingof these clones revealedthat thishybridization with repetitive sequences was due to the presence of both Alu-like and ID-complementary sequences in the 3‘ untranslated extension of the 3.2-kb mRNA species (Fig. 2). A 53-base pair fragment of the ID-complementarysequence was obtained by digestion withthe enzyme AluIand inserted into the SmuI site of phage M13mplO (9). Clones containing a singlecopy of this sequence in both orientations were identified by sequencing, and used to obtain highly specific single-stranded radioactive probes (12 and de Keyser et d 3 ) whichwillbe referred to as ID probes (complementary to Sutcliffe’s IDsequence) or cID probes (identical to Sutcliffe’s ID sequence). The probes were hybridizedto Northern blots of total and poly(A+) RNA purified from adult and fetal muscle, adult and fetal brain, and adult liver, testis, and pancreas. In order to rule out the possibility that the observed hybridization might be due to contaminant DNA, the preparations were first treated with DNAse 1 or RNAse A before the electrophoretic separation, and the filters were treated with 0.5 M NaOH for 30 min at room temperature after blotting; the blots wereperformed using nylon filters such that bound DNA was not removed by this NaOH treatment (6). RNAse and alkali treatments abolished the hybridization signal almost completely while DNAse not, did indicating that RNAs and not contaminant DNA are responsiblefor the observed results (not shown). Both ID and cID probes hybridized with heterogeneous RNAs that are especially abundant in muscle, less abundant in brain, and relatively rare in liver and other tissues. The hybridization pattern was that of a smear corresponding to RNAs with lengths between 15 kb and about 2 kb (Fig. 3). In addition, the ID probe recognized the BC-1 and BC-2 mRNA first described by Sutcliffe et al. (1-4) in the brain, while the cID probe hybridizedto a discrete muscle-specific RNAspecies of 0.6 kb (Fig. 3) which is absent in the othertissues and in fetal muscle (not shown). The amount of sequences hybridizingwith both the ID and

-

80 A a ‘AGCT~;GGTACTGGAGAGAACTAAGACAGGCTGGCTTTTCTCTCTCTCTCTTTTTTTTTTTTTCTTTT~TTTTTCTTTTTT PK mRNA ____*_”_____”-_”__________-

AAAAAAARAAAAAA

81

A n

e

e

160 n

n

TCGGAGCTGGGGACCGAACCCAGGGCATTGTGTTGCTAGGCAAGCGCTCTACCACTGAGCTAAATCCCCAACCCCAGCTT ”” AGCCTCGACCCCTGGCTTGGGTCCCGGAACRCAAGGATCCRTTCGCGAGATGGTGACTCGATTTAGGGGTYGGGG

i

-

A

_”””“””””“”“”””””””””“”””

161

A

J

241

PK mRNA I D sequence

-5’ 240

TTCTCTTTTTAATACAAGCTCTCACTGGCCTCAAACTCCTAAGTCCTCCTGCCTGGCCCTCCTAAGGGTAGGGACTACAG

””””~”””””~--~”---~”~~~””””””””””*”-

I D sequence

PK mRNA

A

n3 ’

GCATGAGTGACCAGCT

””””””

FIG.2. Sequence comparison of the 3’ noncoding extension of the pyruvate kinase (PK)cDNA region containing the repetitive element and the consensus identifier sequence. The nucleotide sequence of AluI-AluI (A-A) fragment isolated from 12Hz PK cDNA clone is shown on the topline. The correspondent cID sequence complementary to the identifier sequence is underlined by a thick line; it is surrounded by two Alu-like sequence underlined by stippled line. The second line indicates the consensus ID sequence (3) written in the opposite orientation, where Y indicates pyrimidine; R, purine; and * represents a nucleotide change. The arrows show the AluI-AluI fragment which was inserted into theS m I site of phage M13mplO vector.

Identifier Sequences Nonin 1

A2

3

1

t 16s

4s

2

3

B

1

2

3

4

“ I

FIG. 3. Northern blot analysis of various tissues with cID probe ( A )and ID probe ( B ) .2 pg of polyadenylated cellular RNA from rat liver in lanes I, muscle in lanes 2, and brain in l a n e s 3 were hybridized with either cID probe ( A ) or ID probe ( B ) . In B the autoradiograms were exposed for 15 h (at theleft) or 2 h (at theright) at room temperature.

L

FIG. 4. Quantitation of transcripts containing ID sequence ( B )or cID sequence ( A )of various tissues by dot blot analysis. Total cellular RNA(T) and poly(A+) RNA ( A ) from rat brain ( I ) , muscle (Z),and liver tissues (3) were dotted onto Gene Screen plus (New England Nuclear) membrane as described previously (14)using a Schleicher & Schull minifold apparatus. Hybridization with cID and ID probes were performed as described in thelegend to Fig. 3.

Brain-specific Transcripts

1501

read-through transcription from adjacent structural gene promotors. The difficulty of obtaining pure nuclear RNA from muscle, whichis a tissue containing very low amounts of RNA (18),precluded the direct comparison of cytosolic and nuclear RNAs. The high molecular weight of the ID and cID sequencecontaining transcript suggests strongly that they do correspond to nuclear precursors, the ID and cID sequences being located in introns andperhaps, as for pyruvate kinase, in the 3‘ untranslated extension of some RNAs. Whatever these transcripts may be, their expression is in any case tissue-specific. Ourresults show therefore that Sutcliffe’s IDsequences, whichare repeated about 150,000times/ haploid genome, are transcribed on both strands. One type of transcript is found in the brain in the form of the two discrete BC-1 and BC-2 RNA species whose expression is hypothesized by Sutcliffe et al. (1-4) to play a role in the identification of the genes to be expressed during brain differentiation while the other type, detected in the 3‘ untranslated region of a liver-specific transcript (L-type pyruvate kinase mRNA), recognizes a 0.6-kb RNA species in adult muscle. Both strands seem to be also present in heterogeneous high molecular weight poly(A)-containingRNAs expressed in all tissues, but at an especially high level in adult muscle. Sutcliffe et al. (4) hypothesized that the small BC-1 and BC2 RNAs transcribed byRNA polymerase I11 could act as “identifiers” of genes which were to be transcribed by RNA polymerase I1 during brain differentiation. These brain-specific, RNA polymerase 11-dependent transcripts were reported to frequently include ID sequences intheir introns, and Sutcliffe et al. (4) have suggested frompreliminary experiments that they could playthe role of tissue-specific enhancers. The same type ofmodelcouldbeproposedformuscle differentiation where a discrete RNA species of 0.6 kb that hybridizes with a cID probe coexists with ID- and cID-containing high molecular weight RNAs that are expressed massively. The orientation of transcription of the genomic ID repeats could then determine what types of cell differentiation they stimulate. The ID sequences must also be regarded as a particular family of repeated sequences like the A h , Kpn, and other families (19,Zl) andraise the same type of unsolved questions on their significance and role. Our results indicate, in any case, that thephenomena in which they are involved are not limited to their function as hypothetical brain specific identifiers since we demonstrate here that, transcribed in either orientation, they are expressed in different types of tissues. The same type of results has been very recently reported by Owens et al. (22). The possibility exists, however, that the discrete RNA species transcribed in opposite sense in brain and muscle play a specific, as yet undetermined, role.

cID probes in different tissues was more accurately appreciated by dot blot analysis (Fig. 4). The intensity of the radioactive spots was measured by scanning the autoradiograms after different contact times of the dot blots with the films. Hybridization was 10-fold higher in brain than in liver, and 40-fold higher in adult muscle than in brain. The hybridization intensity was comparable using either 2 pg of oligo(dT)cellulose-retainedRNA or 10 pg of total RNA, whichindicates that the hybridizing sequences were, at least in part, polyadenylated. If all the ID-containing RNA species were polyAcknowledgments-We thank Therese Wetzel for typing the manadenylated and if the yield of poly(A+) RNA recovering by uscript and Allan Strickland for his linguistic revision. oligo(dT)-cellulosechromatography was loo%, a stronger hybridization had been expected for the poly(A+) fraction. In REFERENCES fact, some of the nuclear transcripts could be not yet polyadeJ. G., Milner, R. J., Bloom, F. E., and Lerner, R. A. nylated and, above all, it is known that some heavy poly(A)- 1. Sutcliffe, (1982)Pm. Natl. Acad. Sci. U.S. A. 79,4942-4946 containing RNAs are not well retained on oligo(dT)-cellulose 2. Sutcliffe, J. G., Milner, R. J., Gottesfeld, J. M., and Lerner, R. (15, 16), which probablyexplains the results of Fig. 4. A.. (1984)Nature 308,237-241 Hybridization of these heterogeneous RNA populations to 3. Milner, R. J., Bloom, F. E., h i , C., Lerner, R. A., and Sutcliffe, J. G. (1984)Proc. Natl. Acad. Sci. U.S. A. 81,713-717 both strands of the ID sequenceindicates that they are either 4. Sutcliffe, J. G., Milner, R. J., Gottesfeld, J. M., and Reynolds, W. composed of species containing one or other of the two ID (1984)Science 225,1308-1314 strands, or that some species couldcontain both ID and cID 5. Gregori, C., Besmond, C., Odievre, M., Kahn, A., and Dreyfus, J. sequences. Such a result is reminiscent of the recent finding C.(1984)Ann. Hum. Genet. 48.291-296 of Jackson et al. (17) who show that both strands of a non6. Southern, E. (1975)J. Mol. Biol. 98,503-517 7. Simon, M. P., Besmond, C., Cottreau, D., Weber, A., ChaumetAlu repetitive sequence family(R) areequally transcribed, via

1502

Identifier Sequences Non in

Riffaud, P., Dreyfus, J. C., Sala-Trepat, J., Marie, J., and Kahn, A. (1983)J. Biol. Chem. 258, 14576-14584 8. Sanger, F.,Nicklen, S., and Colson, A. R. (1977)Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467 9. Messing, J. (1983)Methods Enzymol. 101,20-79 10. Maxam, A. M., and Gilbert, W. (1980)Methods Enzymol. 128, 120-129 11. Aviv, H., and Leder, P. (1972)Proc. Natl. Acad. Sci. U. S. A. 69, 1408-1412 12. Church, G . M., and Gilbert, W. (1984)Proc.Natl. Acad. Sci. U. S. A . 81, 1991-1995 13. Weber, A., Marie, J., Cottreau, D., Simon, M. P., Besmond, C., Dreyfus, J. C., and Kahn, A. (1984)J. Biol. Chem. 259, 17981802 14. Munnich, A., Marie, J., Reach, G., Vaulont, S., Simon, M. P.,

Brain-specific Transcripts and Kahn, A. (1984)J. Biol. Chem. 259,10228-10231 15. Mac h o d , A. R., Karn, J., and Brenner, S. (1981)Nature, 291, 386-390 16. Vogt, V. M. (1973)Eur. J. Biochem. 33, 192-200 17. Jackson, M., Keller, D., and Leinwand, L. (1985)Nuckic Acids Res. 13,3389-3403 18. Kahn, A., Cottreau, D., Daegelen, D., and Dreyfus, J. C. (1981) Eur. J. Biochern. 116,7-12 19. Schmid, C.W., and Jelinek, W. R. (1982)Science 216, 10651070 20. Sun, L., Paulson, K. E., Schmid, C. W., Kadyk, L., and Leinwand, L. (1984)Nucleic Acids Res. 12.2669-2690 21. Vasseur, M., Condamine, H., and Duprey, H. (1985)EMBO J. 4, 1749-1753 22. Owens, G . P.,Nand Hahn Chaudhari, W. E. (1985)Science 229, 1263-1265