Journal of General Virology (2004), 85, 2953–2962
DOI 10.1099/vir.0.80254-0
Sequential modification of translation initiation factor eIF4GI by two different foot-and-mouth disease virus proteases within infected baby hamster kidney cells: identification of the 3Cpro cleavage site Rebecca Strong and Graham J. Belsham Correspondence
Institute for Animal Health, Pirbright, Woking, Surrey GU24 0NF, UK
Graham J. Belsham
[email protected]
Received 5 May 2004 Accepted 10 June 2004
Infection of cells by foot-and-mouth disease virus (FMDV) causes the rapid inhibition of cellular cap-dependent protein synthesis that results from cleavage of the translation initiation factor eIF4G, a component of the cap-binding complex eIF4F. Two FMDV proteins, the leader (L) and 3C proteases, have been shown individually to induce cleavage of eIF4GI at distinct sites within baby hamster kidney (BHK) cells. Here, sequential cleavage of eIF4GI by the L and 3C proteases was demonstrated in FMDV-infected BHK cells. The FMDV 3C cleavage site within hamster eIF4GI was localized to a small region (about 40 aa) of the protein, between the sites cleaved by the poliovirus 2A protease and the human immunodeficiency virus type 2 protease. Human eIF4GI was found to be resistant to the action of the FMDV 3C protease. On the basis of amino acid sequence alignments, it was predicted and then verified that substitution of a single amino acid residue within this region of human eIF4GI conferred sensitivity to cleavage by the FMDV 3C protease within cells. Full-length eIF4GI and both forms of the C-terminal cleavage product must be capable of supporting the activity of the FMDV internal ribosome entry site in directing translation initiation.
INTRODUCTION Foot-and-mouth disease virus (FMDV), an aphthovirus within the picornavirus family, has a positive-sense RNA genome that functions as an mRNA and encodes a large polyprotein from within a single, long open reading frame (ORF). The viral RNA has a 39 poly(A) tail but, in contrast to cellular mRNAs, there is no 59-terminal cap structure (m7GpppN...) (Belsham & Jackson, 2000). The 59 end of the genomic RNA is linked to a virus-encoded peptide, VPg (3B). The 59-cap structure on cellular mRNAs is important for their interaction with the cellular translation initiation machinery. Translation initiation factor eIF4E binds specifically to the cap. This protein is part of the capbinding complex eIF4F, which also includes eIF4A (an RNA helicase) and eIF4G (a scaffold protein) [see Gingras et al. (1999)]. Two distinct eIF4G proteins have been identified, termed eIF4GI and eIF4GII, and are about 41 % identical (Gradi et al., 1998). They appear to be functionally The GenBank/EMBL/DDBJ accession numbers for the partial eIF4GI cDNA sequences reported in this paper are AJ746218 (ovine), AJ746219 (bovine), AJ746220 (hamster), AJ746221 (equine), AJ746222 (murine), AJ746223 (porcine) and AJ746224 (rabbit).
0008-0254 G 2004 SGM
Printed in Great Britain
equivalent and each interacts with a variety of other proteins as well as eIF4E and eIF4A, including the poly(A)binding protein, eIF3 (associated with the 40S ribosomal subunit) and an eIF4E-specific protein kinase termed Mnk1 (Gingras et al., 1999). The initiation of translation of picornavirus RNA is achieved by a cap-independent mechanism and is directed by a large, complex RNA structure, the internal ribosome entry site (IRES), that is located within the long 59-untranslated region (UTR) of the viral RNA [reviewed by Belsham & Jackson (2000)]. The FMDV 59-UTR is >1300 nt in length and the IRES (about 435 nt) is located at the 39 end of this region. Initiation of protein synthesis occurs at two sites that are 84 nt apart, resulting in the synthesis of two forms of the leader (L) protein, termed Lab and Lb (Sangar et al., 1987; Belsham, 1992) at the N-terminus of the polyprotein. Both forms of the L protein are active proteases (Medina et al., 1993) that cleave the L/P1 junction within the viral polyprotein and also induce cleavage of eIF4GI and eIF4GII (Devaney et al., 1988; Medina et al., 1993; Gradi et al., 2004). Cleavage sites within eIF4GI and eIF4GII that are generated in vitro by the FMDV Lb protease (Lbpro) and the enteroand rhinovirus 2A proteases (2Apro) have been identified 2953
R. Strong and G. J. Belsham
(Lamphear et al., 1993; Kirchweger et al., 1994; Gradi et al., 2003, 2004). For eIF4GI, the cleavage sites for Lbpro and the enterovirus 2Apro are on the C-terminal side of residues G674 and R681, respectively [renumbered according to the system of Byrd et al. (2002) for the longest form, eIF4GIa, which comprises 1600 aa]. Cleavage of eIF4G separates the N-terminal domain, which interacts with the cap-binding protein eIF4E, away from the C-terminal region that interacts with eIF4A and eIF3. The C-terminal fragment is sufficient to support FMDV IRES-directed translation initiation. The FMDV IRES interacts directly with eIF4G (Lo´pez de Quinto & Martı´nez-Salas, 2000; Stassinopoulos & Belsham, 2001) and the binding site has been mapped to the J–K domains of this IRES. Similarly, the equivalent region of the encephalomyocarditis virus (EMCV) IRES also binds to eIF4G and individual bases that are important in this interaction have been identified (Kolupaeva et al., 1998, 2003; Clark et al., 2003). FMDV infection of cells results in very rapid inhibition of host-cell protein synthesis (e.g. Belsham et al., 2000; Gradi et al., 2004) and this correlates with loss of intact eIF4G. The eIF4GI and eIF4GII proteins are cleaved with similar kinetics in FMDV-infected cells (Gradi et al., 2004). Cleavage of eIF4GI induced by FMDV Lpro can be observed even in the absence of virus replication, when virus protein expression is very low (Belsham et al., 2000). It has been noted that the expression of the second trans-acting FMDV protease, 3C (termed 3Cpro), within baby hamster kidney (BHK) cells can also induce cleavage of eIF4GI (Belsham et al., 2000). This may explain the cleavage of eIF4GI, which has been detected in BHK cells infected with a mutant form of FMDV that lacks the Lbpro (Piccone et al., 1995; Belsham et al., 2000). The cleavage site generated by 3Cpro was shown to be on the C-terminal side of that generated by Lpro (Belsham et al., 2000). FMDV 3Cpro is also responsible for cleaving eIF4AI, one of two species of eIF4A that are present within the cytoplasm of the cell. The cleavage site in eIF4AI has been identified and cleavage results in loss of activity (Li et al., 2001); however, eIF4AII is not modified by FMDV 3Cpro. FMDV Lpro and 3Cpro are unrelated to each other. Lpro is related to the papain-like family of cysteine proteases (Roberts & Belsham, 1995; Guarne´ et al., 1998), whereas FMDV 3Cpro and enterovirus 2Apro are related to the serine proteases (Allaire et al., 1994; Ryan & Flint, 1997). It has been shown that proteases expressed by human immunodeficiency virus type 1 (HIV-1) and HIV-2 can also cleave eIF4GI and the cleavage sites have been identified (Ohlmann et al., 2002). Furthermore, cleavage of eIF4GI occurs in feline calicivirus-infected cells (Willcocks et al., 2004) and produced novel cleavage products. Thus, eIF4G appears to be a favoured target for viral proteases. Here, we have re-examined the cleavage of eIF4GI within wild-type (wt) FMDV-infected BHK cells by Lpro and 3Cpro. We observed that sequential cleavage of eIF4GI was induced by the two proteases, with both processing events occurring before peak viral protein synthesis was achieved. The eIF4GI 2954
proteins from a variety of mammalian species all appeared to be sensitive to cleavage by FMDV Lpro, but showed different sensitivities to the FMDV 3Cpro. Following rough mapping of the 3Cpro cleavage site, comparison of the different eIF4GI sequences suggested a single potential cleavage site for 3Cpro. We have shown that modification of a single amino acid at this site within the human eIF4GI sequence can determine the sensitivity of this protein to FMDV 3Cpro.
METHODS Infection of cells and transient expression assays. BHK cells
were infected with FMDV (O1Kaufbeuren B64) as described previously (Belsham et al., 2000). Cell extracts were prepared at the times indicated in the figure legends and analysed by SDS-PAGE and immunoblotting, using antibodies that were specific for the N- or C-terminal regions of eIF4GI (Belsham et al., 2000) with appropriate peroxidase-labelled anti-species antibodies and chemiluminescence reagents. Transient expression assays within cells infected with the recombinant vaccinia virus vTF7-3, which expresses the T7 RNA polymerase (Fuerst et al., 1986), were performed as described previously (Roberts et al., 1998). Briefly, BHK cells or human A293 cells were infected with vTF73 and transfected, by using 8 mg lipofectin (Life Technologies), with plasmid DNA (2?5 mg) that encoded poliovirus (PV) 2Apro (pAD802), FMDV Lbpro (pLb), FMDV 3Cpro (pSKRH3C, with the FMDV IRES or pSK3C) or swine vesicular disease virus (SVDV) 2Apro (pGEM3Z/J1), as used previously (Roberts et al., 1998; Belsham et al., 2000; Sakoda et al., 2001). After 20 h, cell extracts were prepared and analysed by SDS-PAGE and immunoblotting as described above. Plasmid construction, manipulation and analysis. All DNA mani-
pulations were performed by using standard methods (Sambrook et al., 1989) or those described by the manufacturers. Total RNA was extracted by using Trizol (Life Technologies) from the following tissue culture cell lines: BHK (hamster), IBRS-2 (pig), MDBK (bovine), RK13 (rabbit) and LK98 (sheep) or equine embryonic lung cells (kindly supplied by the Animal Health Trust, UK). The RNA was used to produce cDNA by using Moloney murine leukaemia virus reverse transcriptase (Promega) with the primer 4Grt (Table 1). Using this cDNA as a template, PCR was performed with primers 4Gfor and 4Grev (Table 1) and Pfu DNA polymerase (Promega) to generate a product of approximately 600 bp. The primers corresponded to sequences that are conserved between the murine and human eIF4GI sequences and included sequences to provide flanking EcoRI and NotI restriction sites (Table 1). PCR products were phosphorylated in vitro and ligated into vector pT7Blue (Novagen). Following transformation of Escherichia coli DH5a, colonies were obtained and plasmid DNA preparations were screened by digestion with EcoRI and NotI. The inserts were sequenced in both directions by using standard primers on a Beckman CEQ8000 machine. The BHK cell eIF4GI cDNA insert was excised by using EcoRI and NotI and ligated into a similarly digested plasmid to generate pGEXBHK, which expressed a GST/eIF4GI/FLAG– CAT fusion protein cassette. The vector used had been modified from the GST/eIF4GII/FLAG constructs that were described by Gradi et al. (2003, 2004). A T7 promoter sequence (from complementary oligonucleotides T7for and T7rev; Table 1) and the FMDV IRES were introduced upstream of the GST-coding sequence. Furthermore, the CAT-coding sequence (prepared by PCR with primers CATfor and CATrev; Table 1) was introduced downstream of and in frame with the FLAG epitope, to increase the size of the C-terminal cleavage product. Plasmid pGEXBHK was transfected into vTF7-3-infected cells, either alone or with plasmids encoding the viral proteases described above. Journal of General Virology 85
eIF4GI cleavage by FMDV 3C protease
Table 1. Oligonucleotide primers Relevant restriction enzyme sites within the primers are indicated in italics. Primer 4Grt 4Gfor 4Grev T7for T7rev CATfor CATrev 4GIPTfor 4GIPTrev 4GIfor 4GIrev 4GIseqfor
Sequence (5§R3§) AGGTCAATGACCCCTTT TAGCGAATTCAAGTCAGATCAGTGGAAGCCT TAGCGCGGCCGCTCCTTGTCGTCATCGTCCTTGTAGTCCACTTGCTTCATCAGCT ACTATAATACGACTCACTATAGGGCAAGCTTACGATGAGCCCTAT TATAGGGCTCATCGTAAGCTTGCCCTATAGTGAGTCGTATTATAG TAGCGCGGCCGCAAATGGAGAAAAAAATCACTGG TAGCGCGGCCGCTTAAAAAAATTACGCC GGACCCCGAAAAGAAACGCGCAAG CTTGCGCGTTTCTTTTCGGGGTCC GGAGTCAAGCCCAGAGCTTG CTGGTTGAAATACTGATCC GCCACATATCAGTGACGTGG
After 20 h, cell extracts were prepared and incubated with anti-FLAG M2–agarose affinity resin (Sigma). Bound proteins were analysed by SDS-PAGE and immunoblotting using rabbit anti-CAT antibodies (Eppendorf–5 Prime) and peroxidase-labelled anti-rabbit Ig with chemiluminescence reagents (both from Amersham Biosciences). The T7 epitope-tagged eIF4GI plasmid (pAD4Gwt; Lamphear & Rhoads, 1996) was kindly provided by R. Rhoads (Louisiana State University) and expressed the form of eIF4GI that corresponds to aa 197–1600 of the full-length protein. Mutagenesis was achieved by using overlap PCR; primary products were prepared by using primers 4GIfor with 4GIPTrev and 4GIPTfor with 4GIrev (Table 1) on the pAD4Gwt template. The two fragments were purified and mixed and a secondround PCR was performed by using primers 4GIfor with 4GIrev. The fragment generated (approx. 1?8 kbp) was inserted into vector pT7Blue (Novagen) and digested with AflII. The mutant eIF4GI fragment (approx. 1?5 kbp) was then inserted into the similarly digested parental pAD4Gwt plasmid to create pAD4GP713T. The orientation of the mutated fragment was determined by enzyme digestion and the sequence change was verified by using primer 4GIseqfor (Table 1). Transient expression of the wt and mutant T7-tagged eIF4GI in vTF73-infected cells was performed as described above. Cell extracts were analysed directly or following incubation with cap-analogue affinity resin (m7GDP–Sepharose; Amersham Biosciences). All samples were analysed by 6 % SDS-PAGE and immunoblotting using anti-T7 epitope antibodies (Novagen) or anti-eIF4GI antibodies, as described previously (Belsham et al., 2000).
RESULTS Cleavage of eIF4GI within FMDV-infected cells generates multiple products FMDV infection of BHK cells results in the rapid loss of host-cell protein synthesis and this is accompanied by the coincident cleavage of eIF4GI and eIF4GII (Belsham et al., 2000; Gradi et al., 2004). As the cleavage products of eIF4GI generated by Lpro and 3Cpro migrate slightly differently, it was possible to examine the kinetics of eIF4GI cleavage mediated by these distinct proteases. BHK cells were infected with FMDV and cells were harvested at intervals http://vir.sgmjournals.org
of 1 h. The samples were analysed by SDS-PAGE on large gels and immunoblotting using antibodies that were specific for both the N- and C-termini of eIF4GI. As observed previously (Belsham et al., 2000), rapid cleavage of eIF4GI was apparent within infected cells (Fig. 1). By 1 h postinfection (p.i.), a major portion of eIF4GI had been cleaved and by 2 h p.i., there was little or no intact protein remaining. Multiple forms of the N-terminal cleavage product were detected (Fig. 1a), presumably reflecting the multiple start sites that are used for the initiation of protein synthesis on the eIF4GI mRNA (Bradley et al., 2002; Byrd et al., 2002). The pattern of N-terminal cleavage products remained constant between 2 and 3 h p.i.; however, the product subsequently decayed quite rapidly and was no longer detectable by 4 h p.i. In contrast, at 1 h p.i., a single C-terminal cleavage product was detected (Fig. 1b). However, by 2 h p.i., a second, slightly faster-migrating species was also apparent and by 3 h p.i., only the faster-migrating species was observed (see also Fig. 2). This product also decayed gradually, but at a slower rate than the N-terminal cleavage products (compare Fig. 1a and b). Sequential cleavage of eIF4GI generated by FMDV Lpro and 3Cpro during infection Expression of FMDV Lpro and 3Cpro individually can be achieved from plasmids by using transient expression assays in BHK cells infected with the recombinant vaccinia virus vTF7-3, which expresses the T7 RNA polymerase. Distinct Cterminal cleavage products of eIF4GI were generated by the expression of FMDV Lbpro and 3Cpro (Fig. 2), as observed previously (Belsham et al., 2000). The product generated by Lbpro (CPCL) co-migrated with the initial form of the C-terminal cleavage product that was observed in FMDVinfected cells, whereas 3Cpro induced a product (CPC3C) that co-migrated with the second, faster-migrating C-terminal cleavage product (Fig. 2). Thus, within FMDV-infected BHK cells, cleavage of eIF4GI is induced initially by Lpro, but this is 2955
R. Strong and G. J. Belsham
Fig. 1. Modification of eIF4GI within FMDV-infected cells. BHK cells were infected with FMDV. At the indicated times (h p.i.), extracts were prepared from mock- or FMDV-infected cells and analysed by 6 % SDS-PAGE on large gels (15615 cm) and immunoblotting using rabbit polyclonal antibodies that were specific for the N-terminus (a) or C-terminus (b) of eIF4GI, as described in Methods. Detection was achieved by using peroxidase-labelled anti-rabbit antibodies and chemiluminescence reagents. Mobilities of molecular mass standards (kDa) are indicated.
followed closely by cleavage within the C-terminal cleavage product by 3Cpro. Hence, FMDV 3C-mediated cleavage of eIF4GI can occur either on the full-length protein as observed previously (Belsham et al., 2000) or on the primary cleavage product that is generated by FMDV Lpro. Both of these cleavages occur in advance of the peak time of viral protein synthesis at about 3 h p.i. Thus, the FMDV IRES must be able to operate efficiently with at least three different forms of eIF4GI (intact eIF4GI, CPCL or CPC3C). eIF4GI proteins from different species show different sensitivities to FMDV 3Cpro The studies described above and previously (Belsham et al., 2000) show clearly that endogenous eIF4GI expressed within BHK cells is highly susceptible to cleavage by FMDV 3Cpro. To test the generality of this process, FMDV 3Cpro and Lbpro were expressed within other cell types. It was observed that FMDV Lbpro induced cleavage of human eIF4GI within A293 cells, but no cleavage of eIF4GI was observed in these cells when FMDV 3Cpro was expressed (Fig. 3). Similar results were also observed in COS cells, derived from African green monkey kidney (data not shown). In contrast, both FMDV Lbpro and 3Cpro induced cleavage of murine eIF4GI from 3T3 cells (data not shown), as seen for hamster eIF4GI in BHK cells (Fig. 3). 2956
Mapping of protease cleavage sites within eIF4GI To map the location of the FMDV 3Cpro cleavage site in hamster eIF4GI more precisely, plasmid pGEXBHK was prepared, which expressed (from a T7 promoter) a fusion protein that contained the central region of hamster eIF4GI, flanked by GST and FLAG–CAT epitope tag sequences (Fig. 4a). This plasmid was transfected into cells, either alone or with other plasmids that expressed PV 2Apro, FMDV Lbpro, FMDV 3Cpro or HIV-2 protease. Cell extracts were prepared, incubated with anti-FLAG M2–agarose affinity resin and the bound proteins were analysed by using SDS-PAGE and immunoblotting with anti-CAT antibodies (Fig. 4b). Each of the proteases induced cleavage of the fusion protein as expected. The C-terminal cleavage products generated by FMDV Lbpro and PV 2Apro comigrated. This showed that the cleavage sites within the GST/eIF4GI/FLAG–CAT fusion protein that are created by these proteases within cells are close together. This is consistent with the identification of the cleavage sites in vitro on the C-terminal side of G674 and R681, respectively (Lamphear et al., 1993; Kirchweger et al., 1994) [it should be noted that the PV 2Apro-induced cleavage site has been verified in PV-infected cells by Zamora et al. (2002).] The C-terminal cleavage product from the fusion protein generated by FMDV 3Cpro migrated faster than the Lbpro- or Journal of General Virology 85
eIF4GI cleavage by FMDV 3C protease
Fig. 2. Cleavage of eIF4GI induced by FMDV Lpro precedes cleavage by FMDV 3Cpro in FMDV-infected cells. BHK cells were infected with FMDV (as described in the legend to Fig. 1) or with the recombinant vaccinia virus vTF7-3 and transfected with plasmids that expressed the viral proteases indicated. FMDV-infected cell extracts were harvested at 1–3 h p.i. as indicated and transfected cells were harvested at 20 h p.i. All cell extracts were analysed by 6 % SDS-PAGE on large gels (15615 cm) and immunoblotting using rabbit antisera that were specific for the C-terminus of eIF4GI. Detection was achieved by using peroxidase-labelled anti-rabbit Ig and chemiluminescence reagents. The intact eIF4GI protein and the distinct C-terminal cleavage products that were generated by the different proteases are indicated.
2Apro-induced products, but slower than that produced with the HIV-2 protease (Fig. 4b). These results indicated that the 3Cpro-generated site is upstream of the bonds that are cleaved by the HIV-2 protease, which have been mapped to the C-terminal side of A718 and L721 in the human protein (see Fig. 5). This leaves a fairly small window of approximately 40 aa within which the cleavage site for FMDV 3Cpro within BHK eIF4GI must occur. Importantly, the cleavage site should differ between the human and hamster sequences. Amino acid sequence comparison of eIF4GI around the protease cleavage sites To understand the basis of the differential modification of eIF4GI from different species by FMDV 3Cpro, we wanted to compare the amino acid sequences of the eIF4GI protein in this region. The sequence of eIF4GI has been determined previously from a variety of different species, including man and mouse (Fig. 5), but the BHK cell (hamster) sequence had not been obtained previously. By using RT-PCR with http://vir.sgmjournals.org
Fig. 3. FMDV 3Cpro induces cleavage of hamster, but not human, eIF4GI. BHK and human A293 cells were infected with the recombinant vaccinia virus vTF7-3 and transfected with plasmids that expressed FMDV Lbpro (pLb) or 3Cpro (pSKRH3C) by using Lipofectin. After 20 h, cell extracts were prepared and analysed by SDS-PAGE and immunoblotting using sheep antisera that were specific for the C-terminus of eIF4GI. Detection was achieved by using peroxidase-labelled anti-sheep Ig and chemiluminescence reagents. Cleavage products and full-length proteins are indicated.
primers corresponding to highly conserved sequences within eIF4GI, a fragment of cDNA that corresponded to the human eIF4GI sequence of aa 604–778 was isolated from hamster, bovine, sheep, pig and equine cells (which were all susceptible to FMDV infection, with the exception of equine cells). This region of eIF4GI includes the eIF4E-binding region (Mader et al., 1995) and the sites identified as cleavage sites for FMDV Lbpro, entero-/rhinovirus 2Apro and the HIV-2 protease (Lamphear et al., 1993; Kirchweger et al., 1994; Ohlmann et al., 2002). The cDNA fragments were sequenced and the predicted amino acid sequences were aligned with the known human and murine sequences (Fig. 5). The sequences were clearly highly related, as expected, but there were short regions that differed and these modifications must determine the differential sensitivities of the proteins to FMDV 3Cpro. It should be noted that the previously documented protein sequence for rabbit eIF4GI (Yan et al., 1992; Lamphear et al., 1993; GenBank accession number L22090) was significantly different from the other mammalian sequences in this region. Hence, this portion of rabbit eIF4GI was also amplified by RT-PCR from rabbit cells (RK13) and the sequence was redetermined. The RK13 cell-derived sequence (as shown in Fig. 5) was related much more closely to the other mammalian sequences in this region. Comparison of these derived amino acid sequences showed only two positions at which amino acid substitutions had occurred between the sites that are cleaved by entero- or rhinovirus 2Apro and that modified by the HIV-2 proteases. These were at aa 707 (only different 2957
R. Strong and G. J. Belsham
Fig. 4. Mapping of the cleavage site for FMDV 3Cpro within hamster eIF4GI. (a) Plasmid pGEXBHK, which expresses (under control of a T7 promoter) a GST/ hamster eIF4GI/FLAG–CAT fusion protein, was constructed as described in Methods. (b) pGEXBHK was transfected into vTF7-3infected BHK cells either alone or with plasmids that expressed the viral proteases indicated. After 20 h, cell extracts were prepared and incubated with anti-FLAG affinity resin. Bound proteins were analysed by SDS-PAGE and immunoblotting using rabbit antibodies that were specific for the CAT protein, which recognized the full-length fusion protein plus the C-terminal cleavage products, as indicated. Detection was achieved by using peroxidase-labelled antirabbit Ig and chemiluminescence reagents.
in the rabbit sequence) and at aa 713. The PRT change at aa 713 was the only change in this region between the 3Cproresistant human sequence and the 3Cpro-sensitive hamster or murine sequences. A single amino acid substitution renders human eIF4GI sensitive to FMDV 3Cpro On the basis of these considerations, it seems probable that the E/P bond (aa 712–713) in the human eIF4GI sequence may determine the resistance of the human protein to FMDV 3Cpro (Fig. 5). Within the BHK eIF4GI sequence at this position, there is an E/T bond. The E/T amino acid pair in the BHK sequence is similar to many cleavage sites that are used by FMDV 3Cpro (e.g. E/G, E/S, E/V; Table 2). However, a P residue is not found on either side of the bonds that are cleaved by picornavirus proteases and thus the human protein, which contains a P residue at this position, could be expected to be resistant to cleavage. To test the importance of P713 in determining the susceptibility of human eIF4GI to FMDV 3Cpro, the codon for this residue was mutated to encode a T residue (as in the BHK and murine sequences) within a plasmid (pAD4Gwt) that expressed the T7 epitope-tagged form of human eIF4GI (Lamphear & Rhoads, 1996). The wt and P713T mutant proteins were expressed in BHK cells alone and with plasmids that expressed FMDV Lpro, FMDV 3Cpro and SVDV 2Apro. Cell extracts were prepared and analysed directly by SDS-PAGE and immunoblotting using anti-eIF4GI (which recognizes the C-terminus; Fig. 6a) and anti-T7 tag (which recognizes the N-terminus; Fig. 6b). The anti-eIF4GI antibody detects both the human eIF4GI and the endogenous BHK cell eIF4GI and their C-terminal cleavage products. From this analysis, it was apparent that all three of the proteases induced cleavage of the hamster protein as 2958
expected (Fig. 6a). However, by using the anti-T7 tag antibodies (which only recognize the T7-tagged human eIF4GI), cleavage of the wt human T7-tagged eIF4GI was observed with FMDV Lbpro and SVDV 2Apro, but not with 3Cpro (also as expected; see also Fig. 3). In contrast, the P713T mutant was cleaved efficiently by each of the proteases, including FMDV 3Cpro (Fig. 6b). Thus, the single P713T amino acid substitution modified the sensitivity of human eIF4GI to FMDV 3Cpro. To authenticate this result, cells were transfected with pAD4GP713T and cell extracts incubated with m7GDP– Sepharose (which captures eIF4E and associated eIF4G) and the bound proteins were analysed by immunoblotting using anti-T7 tag antibodies. The P713T mutant human T7tagged eIF4GI protein was captured on this cap-affinity resin (Fig. 6c). This suggested that the P713T mutant form of the human eIF4GI protein was structured correctly and had assembled into eIF4F complexes within BHK cells. Furthermore, when the P713T mutant human eIF4GI was cleaved in the presence of FMDV 3Cpro, the N-terminal T7-tagged cleavage product was also retained on the capaffinity resin through its interaction with eIF4E (Fig. 6c). Note that the C-terminal cleavage products of eIF4G were not bound to the cap-affinity resin as expected (data not shown). The T7-tagged N-terminal cleavage product that was generated from the P713T mutant migrated slightly slower than the products that were generated by Lbpro or 2Apro (Fig. 6b and c). This is consistent with the FMDV 3Cpro-generated cleavage site being at the E713/T bond on the C-terminal side of the sites that are cleaved in cells expressing the Lbpro or 2Apro, as observed previously for the BHK cell eIF4GI (Belsham et al., 2000). It was thus concluded that the amino acid residue at position 713 is critical for determining the ability of the protein to be cleaved by FMDV 3Cpro. Journal of General Virology 85
eIF4GI cleavage by FMDV 3C protease
Fig. 5. Sequence comparison of eIF4GI from a variety of mammalian species to predict the FMDV 3Cpro cleavage site. Alignment of a central region of eIF4GI from the indicated species is shown. The portion of the protein sequences includes the eIF4E-binding site (black bar), together with the mapped cleavage sites generated by FMDV Lbpro, entero-/rhinovirus 2Apro and the HIV-1/2 proteases. Identical amino acids have a black background, whereas amino acid differences are highlighted. The predicted FMDV 3Cpro cleavage site is also indicated.
DISCUSSION The results presented here have characterized the modification of eIF4GI by FMDV 3Cpro. Cleavage of initiation factor eIF4GI occurred very early within FMDV-infected cells. The initial cleavage was brought about by FMDV Lpro and this has been shown to occur in the absence of any virus replication (Belsham et al., 2000). The secondary cleavage of the C-terminal fragment of eIF4GI by FMDV 3Cpro occurred at approximately 2–3 h p.i., about the time that FMDV proteins become readily detectable; thus, this is still quite early in infection. The cleavage of eIF4GI by FMDV 3Cpro significantly precedes the cleavage of eIF4AI by the same protease (Belsham et al., 2000). The cleavage of eIF4AI only commences at approximately 3 h p.i. and is never completed. Mapping of the FMDV 3Cpro cleavage site, both within the native eIF4GI and within a recombinant http://vir.sgmjournals.org
GST/eIF4GI/FLAG–CAT fusion protein, indicated that the cleavage site generated by 3Cpro was just to the C-terminal side of the sites recognized by FMDV Lpro and enterovirus 2Apro, but was on the N-terminal side of the cleavage sites generated by HIV-2 protease. This left a fairly small window of about 40 aa for the cleavage site. Comparison of the amino acid sequences of eIF4GI from different species indicated a high degree of conservation and only the amino acid substitution of P713RT between the 3Cpro-resistant human eIF4GI and the 3Cpro-sensitive hamster and murine sequences appeared to be capable of explaining this pattern of reactivity. This prediction was verified by modifying P713RT within human eIF4GI and demonstrating that the mutant protein was indeed sensitive to FMDV 3Cpro. It could be argued that the P713RT amino acid substitution is not necessarily at the cleavage site, as the presence of a P 2959
R. Strong and G. J. Belsham
Table 2. Comparison of FMDV 3Cpro cleavage sites The human eIF4GI sequence (EP, boxed) is not cleaved by FMDV 3C. Note the requirement for a Q (glutamine) or E (glutamate) residue at the P1 position (underlined) and the limited range of uncharged residues at the P4 position (shown in bold). The FMDV sequences are all from the O1Kaufbeuren strain (GenBank accession no. X00871). Site VP2–VP3 VP3–VP1 VP1–2A 2B–2C 2C–3A 3A–3B1 3B1–3B2 3B2–3B3 3B3–3C 3C–3D Human eIF4AI Hamster eIF4GI Human eIF4GI
establish that all known functions of this protein are unperturbed by modification at this site. The FMDV 3Cpro cleavage site within eIF4GI is upstream of the region that has been shown to interact with the EMCV
Scissile bond Q E V V E H E K A N P T Q Q
F D A R P Q L P L E N G G
P A P A I P P V I P V P P
S R V E F Q Q V V H R R R
K E G I F A E T T S K Q T L N K Q L K A K Q I S I A E G P Y Q E G P Y K E G P Y T E S G A H E G L I A E V Q K K E T R K K E P R K
P A F R P A A E P V L I I
V A G E D L D I S Q G P G P G P P T D T Q M I S I A
residue could induce a conformational change in the protein. However, the proposed BHK cleavage site sequence (E/T) and its flanking sequences are similar to other FMDV 3Cpro cleavage sites (see Table 2). Furthermore, the lack of other significant amino acid sequence differences in this region of eIF4GI and the correct location relative to the sites cleaved by the FMDV Lbpro, enterovirus 2Apro and HIV-2 proteases suggest strongly that the cleavage of hamster eIF4GI occurs at the E712/T713 bond. It should be noted that the P713T mutant assembled into eIF4F complexes and was still cleaved correctly in cells expressing FMDV Lbpro and enterovirus 2Apro (Fig. 6b and c). These results argue strongly that the overall conformation of the mutant eIF4GI was not perturbed significantly by this single amino acid substitution. Clearly, a more detailed analysis is required to
Fig. 6. Identification of the FMDV 3Cpro cleavage site in eIF4GI. (a, b) Plasmids encoding the wt and P713T mutant forms of the T7 epitope-tagged human eIF4GI were transfected into vTF7-3infected BHK cells either alone or with plasmids encoding the viral proteases indicated. After 20 h, cell extracts were prepared and analysed directly by 6 % SDS-PAGE and immunoblotting using sheep antibodies that were specific for the C-terminus of eIF4GI (a) or for the N-terminal T7 epitope tag (b). Detection was achieved by using the appropriate peroxidase-labelled antispecies Ig and chemiluminescence reagents. (c) BHK cells were transfected with pAD4GP713T either alone or with plasmids encoding the proteases indicated. Cell extracts were prepared and incubated with m7GDP–Sepharose (cap-affinity resin) and the bound proteins were eluted and analysed by using anti-T7 tag antibodies as in (b). 2960
Journal of General Virology 85
eIF4GI cleavage by FMDV 3C protease
IRES and with eIF4A (Imataka & Sonenberg, 1997; Lomakin et al., 2000). Hence, it would be expected that the 3Cprogenerated C-terminal fragment of eIF4GI would remain functional for translation of the FMDV RNA within FMDVinfected BHK cells. This is therefore consistent with the high level of viral protein synthesis that occurs at approximately 3 h p.i., when both Lpro and 3Cpro have modified eIF4G (Belsham et al., 2000).
important for FMDV infection within bovine, ovine or porcine cells. It is interesting to note that eIF4GI within BHK cells is also cleaved by the equine rhinitis A virus (ERAV) 3Cpro (Hinton et al., 2002). ERAV is the only aphthovirus other than FMDV. However, on the basis of the eIF4GI-coding sequence (Fig. 5), it appears that the equine eIF4GI should also be resistant to the aphthovirus 3Cpro.
The 3Cpro-generated cleavage site is just 6 and 9 aa upstream of the two sites that are recognized by the HIV-2 protease. In a recent study, it was shown that cleavage of eIF4GI by the HIV-2 protease had no effect on EMCV IRES function, as expected (Pre´voˆt et al., 2003). However, it was suggested that ribosome scanning is greatly impaired in vitro under these conditions. It was shown that the HIV-2 protease enhanced utilization of the first FMDV initiation codon and blocked utilization of the second start site (which is probably recognized following ribosome scanning; Belsham, 1992) within a cell-free translation system. Thus, it was suggested that removal of a region of about 40 aa from the C-terminal cleavage product of eIF4GI that exhibits general RNAbinding properties blocked ribosome scanning. We therefore investigated the effect of FMDV 3Cpro on recognition of the two FMDV start sites within BHK cells. In these experiments, we were not able to detect any significant differential effect of FMDV 3Cpro or the HIV-2 protease on utilization of the two different start sites (data not shown). This may reflect differences in the assay systems used.
ACKNOWLEDGEMENTS
The region of about 40 aa in eIF4GI between the site that is cleaved by the enterovirus 2Apro and sites that are cut by the HIV-2 protease does have unusual features. It includes nine G residues and about eight (seven in mouse/hamster and nine in rabbit) P residues (including four G/P pairs), plus six R residues, so that over half of this region is made up of these three different amino acids. As mentioned above, studies by Pre´voˆt et al. (2003) indicated that this region had general RNA-binding properties and this appears to be consistent with the high proportion (about 20 %) of positively charged residues. However, it is interesting to note that the eIF4GII homologue of eIF4GI has a deletion of 12 aa within this region, compared with eIF4GI [see Gradi et al. (2003)]. Currently, there is no known functional difference between eIF4GI and eIF4GII, despite their extensive sequence diversity. Comparison of eIF4GI sequences downstream of the eIF4Ebinding site and around the viral protease cleavage sites demonstrated that the proteins from different mammalian species are closely related, but there are small variable regions. The cleavage sites in eIF4GI that are used by the different viral proteases appear to cluster around these variable regions of eIF4GI (Fig. 5). On the basis of the derived amino acid sequences, it is possible to predict that each of the eIF4GI proteins examined would be susceptible to cleavage by FMDV Lpro, but 3Cpro cleavage appears to be restricted (among the species examined) to the hamster and mouse sequences. Thus, this cleavage does not appear to be http://vir.sgmjournals.org
R. S. gratefully acknowledges a studentship from the Biotechnology and Biological Sciences Research Council. We thank Robert Rhoads for the pAD4Gwt plasmid, Theo Ohlmann for the HIV-2 protease plasmid and the Animal Health Trust (Newmarket, UK) for providing equine cells. We also thank Natalie Ross-Smith for technical assistance in the early part of this work.
REFERENCES Allaire, M., Chernaia, M. M., Malcolm, B. A. & James, M. N. G. (1994).
Picornaviral 3C cysteine proteinases have a fold similar to chymotrypsin-like serine proteinases. Nature 369, 72–76. Belsham, G. J. (1992). Dual initiation sites of protein synthesis on
foot-and-mouth disease virus RNA are selected following internal entry and scanning of ribosomes in vivo. EMBO J 11, 1105–1110. Belsham, G. J. & Jackson, R. J. (2000). Translation initiation on
picornavirus RNA. In Translational Control of Gene Expression Monograph 39, pp. 869–900. Edited by N. Sonenberg, J. W. B. Hershey & M. B. Mathews. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Belsham, G. J., McInerney, G. M. & Ross-Smith, N. (2000). Foot-
and-mouth disease virus 3C protease induces cleavage of translation initiation factors eIF4A and eIF4G within infected cells. J Virol 74, 272–280. Bradley, C. A., Padovan, J. C., Thompson, T. L., Benoit, C. A., Chait, B. T. & Rhoads, R. E. (2002). Mass spectrometric analysis of the N
terminus of translational initiation factor eIF4G-1 reveals novel isoforms. J Biol Chem 277, 12559–12571. Byrd, M. P., Zamora, M. & Lloyd, R. E. (2002). Generation of multiple
isoforms of eukaryotic translation initiation factor 4GI by use of alternate translation initiation codons. Mol Cell Biol 22, 4499–4511. Clark, A. T., Robertson, M. E. M., Conn, G. L. & Belsham, G. J. (2003). Conserved nucleotides within the J domain of the
encephalomyocarditis virus internal ribosome entry site are required for activity and for interaction with eIF4G. J Virol 77, 12441–12449. Devaney, M. A., Vakharia, V. N., Lloyd, R. E., Ehrenfeld, E. & Grubman, M. J. (1988). Leader protein of foot-and-mouth disease
virus is required for cleavage of the p220 component of the capbinding protein complex. J Virol 62, 4407–4409. Fuerst, T. R., Niles, E. G., Studier, F. W. & Moss, B. (1986).
Eukaryotic transient expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase. Proc Natl Acad Sci U S A 83, 8122–8126. Gingras, A.-C., Raught, B. & Sonenberg, N. (1999). eIF4 initiation
factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu Rev Biochem 68, 913–963. Gradi, A., Imataka, H., Svitkin, Y. V., Rom, E., Raught, B., Morino, S. & Sonenberg, N. (1998). A novel functional human eukaryotic
translation initiation factor 4G. Mol Cell Biol 18, 334–342. Gradi, A., Svitkin, Y. V., Sommergruber, W., Imataka, H., Morino, S., Skern, T. & Sonenberg, N. (2003). Human rhinovirus 2A proteinase
2961
R. Strong and G. J. Belsham cleavage sites in eukaryotic initiation factors (eIF) 4GI and eIF4GII are different. J Virol 77, 5026–5029. Gradi, A., Foeger, N., Strong, R., Svitkin, Y. V., Sonenberg, N., Skern, T. & Belsham, G. J. (2004). Cleavage of eukaryotic translation
initiation factor 4GII within foot-and-mouth disease virus-infected cells: identification of the L-protease cleavage site in vitro. J Virol 78, 3271–3278. Guarne´, A., Tormo, J., Kirchweger, R., Pfistermueller, D., Fita, I. & Skern, T. (1998). Structure of the foot-and-mouth disease virus
leader protease: a papain-like fold adapted for self-processing and eIF4G recognition. EMBO J 17, 7469–7479.
Mader, S., Lee, H., Pause, A. & Sonenberg, N. (1995). The trans-
lation initiation factor eIF-4E binds to a common motif shared by the translation factor eIF-4c and the translational repressors 4Ebinding proteins. Mol Cell Biol 15, 4990–4997. Medina, M., Domingo, E., Brangwyn, J. K. & Belsham, G. J. (1993).
The two species of the foot-and-mouth disease virus leader protein, expressed individually, exhibit the same activities. Virology 194, 355–359. Ohlmann, T., Pre´voˆt, D., De´cimo, D., Roux, F., Garin, J., Morley, S. J. & Darlix, J.-L. (2002). In vitro cleavage of eIF4GI but not eIF4GII by
HIV-1 protease and its effects on translation in the rabbit reticulocyte lysate system. J Mol Biol 318, 9–20.
Hinton, T. M., Ross-Smith, N., Warner, S., Belsham, G. J. & Crabb, B. S. (2002). Conservation of L and 3C proteinase activities across
Piccone, M. E., Rieder, E., Mason, P. W. & Grubman, M. J. (1995).
distantly related aphthoviruses. J Gen Virol 83, 3111–3121.
The foot-and-mouth disease virus leader proteinase gene is not required for viral replication. J Virol 69, 5376–5382.
Imataka, H. & Sonenberg, N. (1997). Human eukaryotic translation
initiation factor 4G (eIF4G) possesses two separate and independent binding sites for eIF4A. Mol Cell Biol 17, 6940–6947. Kirchweger, R., Ziegler, E., Lamphear, B. J. & 8 other authors (1994). Foot-and-mouth disease virus leader proteinase: purification of the Lb form and determination of its cleavage site on eIF-4c.
J Virol 68, 5677–5684. Kolupaeva, V. G., Pestova, T. V., Hellen, C. U. T. & Shatsky, I. N. (1998). Translation eukaryotic initiation factor 4G recognizes a
Pre´voˆt, D., De´cimo, D., Herbreteau, C. H., Roux, F., Garin, J., Darlix, J.-L. & Ohlmann, T. (2003). Characterization of a novel RNA-
binding region of eIF4GI critical for ribosomal scanning. EMBO J 22, 1909–1921. Roberts, P. J. & Belsham, G. J. (1995). Identification of critical
amino acids within the foot-and-mouth disease virus leader protein, a cysteine protease. Virology 213, 140–146. Roberts, L. O., Seamons, R. A. & Belsham, G. J. (1998). Recognition
specific structural element within the internal ribosome entry site of encephalomyocarditis virus RNA. J Biol Chem 273, 18599–18604.
of picornavirus internal ribosome entry sites within cells; influence of cellular and viral proteins. RNA 4, 520–529.
Kolupaeva, V. G., Lomakin, I. B., Pestova, T. V. & Hellen, C. U. T. (2003). Eukaryotic initiation factors 4G and 4A mediate conforma-
Ryan, M. D. & Flint, M. (1997). Virus-encoded proteinases of the picornavirus super-group. J Gen Virol 78, 699–723.
tional changes downstream of the initiation codon of the encephalomyocarditis virus internal ribosomal entry site. Mol Cell Biol 23, 687–698.
Sakoda, Y., Ross-Smith, N., Inoue, T. & Belsham, G. J. (2001). An
Lamphear, B. J. & Rhoads, R. E. (1996). A single amino acid change
attenuating mutation in the 2A protease of swine vesicular disease virus, a picornavirus, regulates cap- and internal ribosome entry sitedependent protein synthesis. J Virol 75, 10643–10650.
in protein synthesis initiation factor 4G renders cap-dependent translation resistant to picornaviral 2A proteases. Biochemistry 35, 15726–15733.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning:
Lamphear, B. J., Yan, R., Yang, F., Waters, D., Liebig, H.-D., Klump, H., Kuechler, E., Skern, T. & Rhoads, R. E. (1993). Mapping the cleavage site in protein synthesis initiation factor eIF-4c of the 2A
Sangar, D. V., Newton, S. E., Rowlands, D. J. & Clarke, B. E. (1987).
proteases from human coxsackievirus and rhinovirus. J Biol Chem 268, 19200–19203.
Stassinopoulos, I. A. & Belsham, G. J. (2001). A novel protein–
Li, W., Ross-Smith, N., Proud, C. G. & Belsham, G. J. (2001).
Cleavage of translation initiation factor 4AI (eIF4AI) but not eIF4AII by foot-and-mouth disease virus 3C protease: identification of the eIF4AI cleavage site. FEBS Lett 507, 1–5. Lomakin, I. B., Hellen, C. U. T. & Pestova, T. V. (2000). Physical
association of eukaryotic initiation factor 4G (eIF4G) with eIF4A strongly enhances binding of eIF4G to the internal ribosomal entry site of encephalomyocarditis virus and is required for internal initiation of translation. Mol Cell Biol 20, 6019–6029.
a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. All foot and mouth disease virus serotypes initiate protein synthesis at two separate AUGs. Nucleic Acids Res 15, 3305–3315. RNA binding assay: functional interactions of the foot-and-mouth disease virus internal ribosome entry site with cellular proteins. RNA 7, 114–122. Willcocks, M. M., Carter, M. J. & Roberts, L. O. (2004). Cleavage
of eukaryotic initiation factor eIF4G and inhibition of host-cell protein synthesis during feline calicivirus infection. J Gen Virol 85, 1125–1130. Yan, R., Rychlik, W., Etchison, D. & Rhoads, R. E. (1992). Amino acid sequence of the human protein synthesis initiation factor eIF-4c.
J Biol Chem 267, 23226–23231.
Lo´pez de Quinto, S. & Martı´nez-Salas, E. (2000). Interaction of the
Zamora, M., Marissen, W. E. & Lloyd, R. E. (2002). Multiple eIF4GI-
eIF4G initiation factor with the aphthovirus IRES is essential for internal translation initiation in vivo. RNA 6, 1380–1392.
specific protease activities present in uninfected and poliovirusinfected cells. J Virol 76, 165–177.
2962
Journal of General Virology 85
