Sertoli cell androgen receptor expression regulates ...

Endocrinology. First published ahead of print June 13, 2013 as doi:10.1210/en.2012-2273 REPRODUCTION-DEVELOPMENT

Sertoli cell androgen receptor expression regulates temporal fetal and adult Leydig cell differentiation, function and population size Rasmani Hazra, Mark Jimenez, Reena Desai, David J. Handelsman, and Charles M. Allan ANZAC Research Institute, University of Sydney, Concord Hospital, Sydney, New S Wales 2139, Australia

We recently created a mouse model displaying precocious Sertoli cell (SC) and spermatogenic development induced by SC-specific transgenic androgen receptor expression (TgSCAR). Here, we reveal that TgSCAR regulates the development, function and absolute number of Leydig cells (LCs). Total fetal and adult type LC numbers were reduced in postnatal and adult TgSCAR versus control testes, despite normal circulating LH levels. Normal LC:SC ratios found in TgSCAR testes indicates that SCAR-mediated activity confers a quorum-dependent relationship between total SC and LC numbers. TgSCAR enhanced LC differentiation, shown by elevated ratios of advanced:immature LC types, and reduced LC proliferation in postnatal TgSCAR versus control testes. Postnatal TgSCAR testes displayed up-regulated expression of coupled ligand-receptor transcripts (Amh-Amhr2, Dhh-Ptch1, Pdgfa-Pdgfra) for potential SCAR-stimulated paracrine pathways which may coordinate LC differentiation. Neonatal TgSCAR testes displayed normal testosterone and dihydrotestosterone levels despite differential changes to steroidogenic gene expression, with down-regulated Star, Cyp11a1 and Cyp17a1 expression contrasting with up-regulated Hsd3b1, Hsd17b3 and Srd5a1 expression. TgSCAR males also displayed elevated postnatal and normal adult serum testosterone levels, despite reduced LC numbers. Enhanced adult type LC steroidogenic output was revealed by increased pubertal testicular testosterone, dihydrotestosterone, 3␣-diol and 3␤-diol levels per LC, and up-regulated steroidogenic gene (Nr5a1, Lhr, Cyp11a1, Cyp17a1, Hsd3b6, Srd5a1) expression in pubertal or adult TgSCAR versus control males; suggesting regulatory mechanisms maintain androgen levels independently of absolute LC numbers. Our unique gain-offunction TgSCAR model has revealed that SCAR activity controls temporal LC differentiation, steroidogenic function and population size.

A

ndrogens are essential for testicular development and male fertility. The Sertoli cell (SC) plays a pivotal role coordinating local androgen actions in developing and adult testes. SC androgen receptor (SCAR) expression arises in early postnatal development and undergoes functional up-regulation during prepubertal development (15). In comparison, Leydig cells (LCs) express AR throughout postnatal development (1, 2, 6, 7), and produce androgens that provide autocrine regulation of developing LC types (8-10). Testicular androgens also exert paracrine actions via the SCAR that are crucial for SC functional differentiation (4, 11-13), which in turn provides recip-

rocal control for the postnatal completion of LC development (4, 11-13). Despite the essential role of AR activity in both SC and LC differentiation, the overall process and its temporal coordination remain poorly understood. LC development comprises two sequential but overlapping cell lineages known as the fetal and adult type LC populations, which display distinct functional characteristics reflected by different morphology, hormonal regulation and steroidogenic output. In neonatal testes, fetal LC (FLC) and early SC populations may both contribute to androgen production. Coculture studies using enriched cells from immature rodents suggested that early postnatal

ISSN Print 0013-7227 ISSN Online 1945-7170 Printed in U.S.A. Copyright © 2013 by The Endocrine Society Received December 28, 2012. Accepted June 5, 2013.

Abbreviations:

doi: 10.1210/en.2012-2273

Endocrinology

Copyright (C) 2013 by The Endocrine Society

endo.endojournals.org

1

2

Sertoli cell AR-mediated control of Leydig cells

SCs express hydroxysteroid (17␤) dehydrogenase 3 (Hsd17b3) which produces low testosterone levels from FLC-derived androstenedione (14-16). Isolated rat FLCs may also produce testosterone directly, but display rapidly down-regulated steroidogenic pathways in culture (17). In vitro findings are difficult to compare due to different methods used to enrich FLCs (16, 17), and loss of the normal regulatory endocrine and local hormonal milieu, which makes in vivo extrapolation difficult. During prepubertal development in rats, the adult type LC (ALC) arises from putative stem cells (18-22), differentiating into newly formed, immature and then mature ALC populations (23, 24). Development of functional FLC and early ALC populations proceeds independently of gonadotrophins (23, 25-27), whereas commencing late in the prepubertal period ALC differentiation requires luteinizing hormone (LH) (8, 23). The hormonal control of LC function also involves paracrine actions due to follicle-stimulating hormone (FSH), acting via the FSH receptor exclusively expressed in SCs (28). Paracrine SC-LC interactions have been studied using SC-conditioned media or SCs cocultured with isolated LC populations (29-31), or in vivo approaches such as hormone replacement after hypophysectomy or pharmacological suppression followed by in vitro analysis of isolated LC function. Such strategies showed that FSHstimulated SCs enhanced LH-induced LC steroidogenesis in the rat (14, 32, 33), pig (34) and rabbit (35), suggesting evolutionary conserved FSH-mediated SC paracrine control of LC function. Investigating the role of androgenmediated SC control of LC development is considerably more complicated, as in vitro studies are limited by reduced androgen responsiveness of isolated SC (36), and loss of viability and LH receptor expression in isolated postnatal LCs (37). Dissecting SCAR-mediated actions in vivo is not possible using steroid ligands due to confounding effects of androgens targeting AR-expressing LC and peritubular cells (38, 39) as well as pituitary-hypothalamic pathways controlling gonadotrophin secretion (4042). Genetic loss-of-function animal models have demonstrated the importance of AR-mediated paracrine control of LC development in vivo. Targeted SC-specific disruption of AR (SCARKO) function in mice showed that SCAR activity is needed for normal LC development (4, 13). However, permanent loss of SCAR activity and arrested postnatal testicular maturation in SCARKO mice does not allow research into ongoing SCAR effects during the completion of LC development. Other SC-derived factors with proposed paracrine roles in LC development, such as Pdgfa (43) and Dhh (44, 45), were also largely studied by genetic loss-of-function rodent models. The physiological roles of SCAR-mediated activity during the completion of

Endocrinology

LC development in vivo still remains obscure, since almost all information has so far been obtained from in vitro studies, or using loss-of-function in vivo approaches which ablate or arrest early LC development. We recently developed a transgenic (Tg) mouse model with SC-specific AR (TgSCAR) expression to directly determine in vivo effects of SCAR-induced actions on the completion of testicular development (5). Our unique gain-of-function model exhibits SCAR-mediated induction of premature testicular development, in the presence of normal circulating FSH levels, allowing selective in vivo analysis of SCAR actions during the completion of functional testicular development. We have now determined the biological importance of SCAR activity in the regulation of neonatal to adult LC development and steroidogenesis. To our knowledge, this study provides the first quantitative analysis of mouse FLC and ALC populations in neonatal to mature testes, with previous research describing rat LC populations, or total murine LC numbers with no distinction between FLC and ALC types (46). Our current findings show for the first time that SCAR expression regulates murine FLC and ALC function from neonatal stage to maturity, and SCAR-mediated actions dictate temporal LC differentiation and population size.

Materials and Methods TgSCAR mouse model TgSCAR mice (line TgSCAR-3) expressing SC-specific human AR cDNA were previously described (5). Hemizygous TgSCAR males were used for experimental analysis. Animals were housed under controlled conditions (12 h light-dark cycle, 1922C) with ad lib access to food and water. All animal procedures were approved by the Animal Welfare Committee of the Sydney South West Area Health Service and performed in accordance to the National Health and Medical Research Council code of practice for care and use of animals and the NSW Animal Research Act (1985).

Serum collection and tissue processing Transgenic (Tg) and wildtype (WT) littermates were sacrificed on postnatal day (PND) 5, 10, 15 and 30 to study neonatal to pubertal testis development, or collected at 70-80 d old to compare adult phenotypes. Day of birth was designated as PND 0. Serum was collected from ketamine/xylazine anesthetized PND15 to adult animals by terminal cardiac exsanguination and aliquots stored at -20C. Testes were removed and immediately frozen (liquid N2) for RNA or steroid analysis, or fixed and incubated in Bouin’s fixative for 24 h (histology, stereology) and transferred to 70% ethanol. Fixed testes were embedded in hydroxymethylmethacrylate resin (Technovit 7100, Kulzer and Co, Friedrichsdorf, Germany) as described for histology and stereology (4, 47). Tissue sections were cut using a Polycut S microtome (Reichert Jung, Nossloch, Germany). Thin (2 ␮m) and thick (20 ␮m) sections were consecutively stained with periodic

doi: 10.1210/en.2012-2273


acid-schiff (PAS), hematoxylin and Scott’s blue solution for histology and stereology respectively. Thin testis sections (3 ␮m) used for immunhistochemistry were counterstained with Harris hematoxylin.

Stereological analysis Total testicular Leydig cell populations were quantified by optical-disector stereology methods described previously (48) using CASTGRID (Olympus, Aarhus, Denmark) software. Fetal and adult LC types were identified by overall cellular and nuclear shape, size, staining pattern and age of development, based on criteria previously described (19, 23, 49).

Immunohistochemistry Immunochemical detection of 3␤-HSD was performed on 3-␮m thick testis sections, using polyclonal goat anti-3␤-HSD antibody (P-18, sc-30820, Santa Cruz Biotechnology) at a dilution of 1:500, followed by biotinylated rabbit antigoat IgG (1: 400, Vectastain-Elite ABC kit; Vector Laboratories, Burlingame, CA) as recommended by manufacturer. Antibody staining was visualized using 3,3⬘-diaminobenzidine tetrahydrochloride chromogenic substrate (Dako, Carpinteria, CA), as previously described (5). Cell proliferation was determined using a proliferating cell nuclear antigen (PCNA) kit (Zymed, San Francisco, CA) accord-

Table 1.

ing to the manufacturer’s protocol, using antigen retrieval in 10 mM citrate buffer, pH 6 for 15 min, and then 2% H2O2 treatment for 10 min. All sections were counterstained with Harris hematoxylin. The PCNA labeling index was determined by random uniform sampling CASTGRID software (Olympus, Aarhus, Denmark) as described (50), counting at least 300 cells per testis.

RNA extraction, cDNA synthesis and real-time qPCR Total RNA was extracted from testes using Trizol (Sigma) according to manufacturer’s protocol, and residual genomic DNA removed by RNase-free DNase I (0.5 U/ug RNA, Invitrogen). cDNA was obtained using oligo-dT primers and reverse transcriptase (Superscript III, Invitrogen) as recommended. Quantitative real-time PCR (qPCR) was performed using a Rotor gene 6000 (Corbett research, Sydney, Australia) and SensiMix SYBR kit (Bioline, Alexandria, Australia) according to manufacturer’s guidelines. Target transcript primer sequences are listed in Table 1. Amplicon products were assessed by melting curve analysis (Rotor gene 6000 software). Target copy number was quantitated by qPCR using the standard curve method and expressed relative to expression of two internal sample controls, Hmbs and Hprt1, verified as suitable housekeepers by GeNorm software analysis as described (5, 51). To compare LC-specific

Target transcript primer sequences and associated gene accession numbers Gene

Accession number

Star

NM_011485.4

Hsd17b3

NM_008291.3

Hsd3b1

NM_008293.3

Hsd3b6

NM_013821.3

Cyp11a1

NM_019779.3

Cyp17a1

NM_007809.3

Srd5a1

NM_175283.3

Lhr

NM_013582.2

Pdgfa

NM_008808.3

Pdgfra

NM_001083316.1

Dhh

NM_007857.4

Ptch1

NM_008957.2

Insl3

NM_013564.7

Amhr2

NM_144547.2

Nr5a1

NM_139051.3

Cyp19a1

FJ619060.1

3

Primer pairs (5ⴕ. . . . 3ⴕ) F: TTCATCCACTGGCTGGAAGTC R: CAGGTCAATGTGGTGGACAC F: CAGCTTCCAAGGCTTTTGTG R: ACAAACTCATCGGCGGTCTT F: GGTGCAGGAGAAAGAACTGC R: TGACATCAATGACAGCAGCA F: ATCCACACTGCAGCTGTCATTG R: ATGATGCTCTTCCTCGTTGC F: CGATACTCTTCTCATGCGAG R: CTTTCTTCCAGGCATCTGAAC F: ACGACGGGGAGTCCCGAGAT R: CCACCAGATCGCTGTGGCCC F: CCTGCGGAATCTGAGAAAAC R: CAGGGTGAACAGAGCAAACA F: GAGACGCTTTATTCTGCCATC R: CACCCTAAGGAAGGCATAGC F: TGAAAGAGGTCCAGGTGAGG R: CACGGAGGAGAACAAAGACC F: TGGCATGATGGTCGATTCTA R: CTCGCTGAGGTGGTAGAAGG F: TGACAGAGCGTTGCAAAGAG R: GCGCCAACAAACCATACTTA F: TCAGGCAATACGAAGCACAGC R: GACAAGGAGCCAGAGTCCAG F: TGCTCCTGGCTCTGGGGTCC R: CACTGCAGCAGCTCCCGGTC F: TTCGGGAAGATAGGTCATGC R: TGGAGAGCTGTACCCCAGTC F: GCCAGGAGTTCGTCTGTCTC R: ACCTCCACCAGGCACAATAG F: TCAAGGGCGAGATGATAAGG R: CGCTATTTGGCCTCAGAAGA

4


Endocrinology

transcript expression levels, an adjustment corrected for total LC numbers (calculated for each group by stereology) to obtain an estimate of relative transcript expression/LC, as described previously for SC-specific transcripts (5). All samples were tested in duplicate.

Quantitation of serum and intratesticular hormone levels Mouse serum LH levels were measured by immunofluorometric assay as described previously (52). Serum testosterone and intratesticular testosterone, dihydrotestosterone (DHT), 5␣-androstane 3␣, 17␤-diol (3␣-diol), 5␣-androstane 3␤, 17␤diol (3␤-diol) and estradiol levels were measured after hexaneethylacetate extraction using LC-MS/MS (quantification limits were 0.1 ng/ml and 25 pg/mg for serum and testicular testosterone, respectively, 5 pg/mg for testicular estradiol, 0.2 ng/mg for testicular dihydrotestosterone, 3␣-diol and 3␤-diol) as described for mouse samples (53).

Statistical analysis Statistical analysis was performed using SPSS, version 19.0 (SPSS, Inc.) or NCSS 2007 (NCSS). Comparisons of transgenic and developmental effects were determined by two-way ANOVA with log transformation required for serum testosterone to stabilize variance. Data for Tg versus WT samples at equal time points used unpaired t-tests, and comparison of Tg or WT samples at different time points used one-way ANOVA. Differences were regarded significant when P ⬍ .05. All data are presented as mean ⫾ SEM.

Results Effects of TgSCAR on Leydig cell number and differentiation Identification of LC types. FLC were identified by rounded nuclei with small nucleoli, darkly stained PAS positive cytoplasm, small-sized cytoplasmic lipid droplets and typical occurrence as cell clusters as previously reported (23, 49), shown in Figure 1A-B. Mesenchymal precursor and progenitor cells of the ALC lineage were not determined, as these cell types were morphologically indistinguishable, and while progenitor cells express some steroidogenic enzymes they are not likely to directly produce testosterone, unlike the more advanced ALCs (19, 23). Newly formed ALC are polygonal compared to spindle-shaped precursor-progenitor cells, smaller in size compared to immature and mature ALC, exhibit rounded nuclei featuring a distinct heterochromatin rim and prominent nucleolus, contain no (or very few) cytoplasmic lipid droplets and typically found in the central interstitium (Figure 1C-D). Immature ALCs have a larger cytoplasm with plentiful lipid droplets that appear larger than those in FLCs (Figure 1E). The final transition of mature ALCs is characterized by the disappearance of cytoplasmic lipid droplets (Figure 1G). All fetal and adult Leydig cell

Figure 1. Leydig cell morphology. Distinct Leydig cell types in postnatal mice are shown in testes sections stained for histology as described in methods (Panels A, C, E, G). Immunodetection of 3␤-HSD confirms representative LC types at different ages (Panels B, D, F, H). A) Typical FLC cluster (dotted circle) at postnatal day 5 (PND5). B) FLC cluster (dotted circle) was 3␤-HSD positive at PND5. C) Newly formed ALC (thin arrows) at PND15, which do not form clusters like FLC. D) Newly formed ALC (arrow) at PND15 were 3␤-HSD positive. E) Immature ALC (black arrow head) with larger cytoplasm and numerous lipid droplets at PND30. F) 3␤-HSD positive immature ALC. G) Mature ALC (white arrow head) with disappearance of cytoplasmic lipid droplets in adult mice, also showing newly formed ALC (arrow). H) 3␤HSD positive immature/mature ALC in adult mice.

types expressed 3␤-HSD, detected by immunohistochemistry (Figure 1B, D, F and H), confirming Leydig cell identification. In addition, the prominent expression of mouse AR normally found in postnatal/adult Leydig and peritubular cell populations was also observed in TgSCAR testes, as shown in supplementary data (Fig S1). LC numbers. To determine TgSCAR effects on LC numbers during postnatal testicular development, detailed stereological analysis determined total numbers of testicular FLC and ALC (combining newly formed, immature and mature ALC) populations in PND5 (neonatal), PND10, PND15, PND30 (pubertal) and adult (70-80 d) TgSCAR

doi: 10.1210/en.2012-2273


5

LC proliferation. To determine Leydig cell proliferation, we compared the PCNA labeling index in PND15 or PND30 TgSCAR and WT testes. The total % of PCNA positive LCs was significantly reduced (P ⬍ .05) in TgSCAR compared to WT testes at both ages (Figure 2B). Examples of PCNA positive postnatal LCs are shown in supplementary data (Fig. S2). We also examined LC apoptosis using TUNEL, and found no apoptotic LCs in postnatal and adult testes from either the TgSCAR or WT mice (data not shown). LC differentiation. To study TgSCAR effects on LC development, we compared the ratio of more advanced to immature LC populations during postnatal (PND15-30) development. The ratio of total numbers Figure 2. Total testicular Leydig cell population in TgSCAR mice. A) Total LC of newly formed ALC to FLC was populations were determined by optical disector stereology. Fetal, adult and total LC numbers significantly elevated (by 20%, P ⬍ were decreased in TgSCAR (black bars) compared to WT (white bars) littermates from PND5 to .05) in PND15 TgSCAR versus WT maturity. Leydig cell to Sertoli cell ratios were compared during postnatal to adult development testes (Figure 2C). Likewise, the raand ratios were normal at all time points examined. B) The PCNA labeling index of LCs was significantly reduced in TgSCAR versus age-matched WT mice at both PND15 and PND30. C) tio of total numbers of immature Morphological analysis showed that the ratio of newly formed adult to fetal LC, and immature to ALC to the preceding newly formed newly formed ALC, was increased in TgSCAR versus WT mice at PND15 and PND30, respectively. ALC was significantly higher (2In comparison, the ratio of mature to immature LC was equivalent in adult TgSCAR and WT mice. Values are mean ⫾ SEM (n ⫽ 5/group). * P ⬍ .05. fold, P ⬍ .01) in PND30 Tg compared to WT pubertal testes (Figure 2C). These findings show that more and age-matched WT males. Comparison of different ages developmentally advanced or differentiated LC types were showed total testicular FLC numbers were maximal in present in PND15 and PND30 TgSCAR compared to agePND15 WT mice, and then declined in pubertal and adult matched WT testes. In adult mice, the ratio of total nummales (Figure 2A). Total FLC numbers were significantly bers of mature to immature ALC was equivalent in Tgreduced (two-way ANOVA, P ⬍ .001) in TgSCAR relative SCAR compared to WT mice (Figure 2C). to WT testes (Figure 2A). In all males, ALC were not detected at PND5, present at PND10 and PND15, and then Effect of TgSCAR on Sertoli-Leydig cell paracrine numbers significantly increased (3.5-fold, P ⬍ .01) in pathways PND30 testes (Figure 2A). Absolute ALC numbers were To study TgSCAR effects on SC-to-LC paracrine pathsignificantly decreased (two-way ANOVA, P ⬍ .001) in ways, we compared expression levels of coupled ligandTgSCAR compared to WT testes (Figure 2A) Therefore, receptor transcripts (Pdgfa-Pdgfra, Dhh-Ptch1, AmhTgSCAR induced a reduction in the total LC (fetal and Amhr2) for SC-derived ligands and their associated LC adult) population in TgSCAR versus WT at all ages ex- receptors, which form proposed paracrine pathways coamined (Figure 2A). As total SC numbers are reduced in ordinating LC differentiation. Pdgfa-Pdgfra transcripts TgSCAR relative to WT testes (5), comparison of the ab- examined changes to platelet-derived growth factor (Pdgf) solute SC and LC numbers revealed that TgSCAR testes signaling. Dhh-Ptch1 transcripts determined changes to exhibited normal LC to SC ratios at all ages examined Desert Hedgehog (Dhh) and its receptor Patched 1 (Figure 2A). The 6-fold rise in total ALC numbers at (Ptch1), and Amh-Amhr2 expression examined anti-MülPND30 produced the marked increase in the LC:SC ratio lerian hormone (Amh) pathways. Testicular Pdgfa-Pdgfra found in PND30 and adult testes. and Dhh-Ptch1 mRNA levels all displayed similar expres-

6


sion patterns and significantly declined with age (two-way ANOVA, P ⬍ .01), notably in pubertal and adult testes, and showed a significant interaction with TgSCAR (twoway ANOVA, P ⬍ .01). Relative mRNA levels of PdgfaPdgfra and Dhh-Ptch1 were all increased in PND5, PND10 and PND15 (except Pdgfa) TgSCAR versus WT testes, but declined to normal (nadir) levels in adult testes (Figure 3). In contrast, different expression patterns were found for Amh and Amhr2 mRNA levels during postnatal development. Testicular Amh transcripts were elevated in neonatal-postnatal PND5-10 TgSCAR versus WT testes, then declined to normal levels in PND15-30 TgSCAR testes and were undetectable in adult testes (Figure 3). However, Amhr2 mRNA levels increased from PND5 to peak at PND15, and then significantly declined in PND30 and adult WT testes (Figure 3). Amhr2 transcript levels were elevated in PND5 to PND30 TgSCAR versus WT testes,

Figure 3. Sertoli–Leydig cell paracrine pathways. Testicular expression of potential SC-LC paracrine ligand-receptor markers were determined by qPCR as described in Material and methods. Relative testicular expression of Dhh and Ptch1 mRNA levels were significantly higher in PND5 to PND30 TgSCAR (black bars) compared to agematched WT (white bars) mice. Testicular Pdgfa and Pdgfra mRNA levels were also up-regulated in postnatal TgSCAR relative to WT mice. Likewise, Amh and Amhr2 expression levels were significantly elevated in postnatal TgSCAR testes. Data are expressed as mean ⫾ SEM (n ⫽ 6-9/group). Significant differences (P ⬍ .05) relative to age-matched controls are indicated by asterisks.

Endocrinology

but declined to normal levels in adult TgSCAR testes (Figure 3). Overall, TgSCAR elevated the postnatal expression of transcripts encoding factors in three proposed SCto-LC paracrine pathways. TgSCAR effects on serum and intratesticular steroid levels Serum hormone levels. Serum volumes limited hormone analysis to PND15 and beyond for testosterone, and PND30 and beyond for LH measurements. Serum testosterone levels were significantly increased (two-way ANOVA, P ⬍ .01) during the development of male mice, and were higher (two-way ANOVA, P ⬍ .05) in TgSCAR relative to WT males, highlighted by elevated PND15 and PND30 testosterone levels in TgSCAR animals (Figure 4A). Serum LH levels were equivalent in PND30 and adult TgSCAR and WT males (Figure 4A). Serum levels of LH and testosterone were highly variable in adult animals, which is likely to reflect the pulsatile circulating levels previously reported in mice (54). Intratesticular steroids levels. During development, testicular testosterone levels per mg tissue were equivalent in PND5 compared to PND10 males, declined to its nadir in PND15-30 testes (approximately 75%-80% below PND5 values), and then increased in adult TgSCAR and WT males (Figure 4B). Testicular testosterone levels (/mg tissue) were higher than normal in PND10-30 TgSCAR testes (one-way ANOVA, P ⬍ .05), and normal at other time points examined. Stereological analysis enabled the calculation of androgen production per LC numbers. When corrected for total LC numbers, intratesticular testosterone levels/LC were significantly elevated (one-way ANOVA, P ⬍ .01) in pubertal and adult TgSCAR versus WT males (Figure 4B). In comparison, DHT levels (/mg tissue) were equivalent in PND5-10 TgSCAR and WT testes, not detected in PND15 testes, and then significantly higher (2.6-fold, P ⬍ .01) in pubertal PND30 TgSCAR versus WT males (Figure 4B). DHT levels per LC were significantly elevated in pubertal and adult (2 -fold, P ⬍ .01) TgSCAR compared to WT testes (Figure 4B). Therefore, LC androgen production was higher than normal in pubertal and adult TgSCAR males. Intratesticular 3␣-diol and 3␤-diol levels were not detected until PND30. Testicular levels of 3␣-diol and 3␤-diol, expressed either per mg tissue or per LC, were greatly increased (one-way ANOVA, P ⬍ .05) in PND30 TgSCAR compared to WT males, and then decreased to reach normal levels in adults (Figure 4B). Conversely, intratesticular estradiol levels were only detected at PND5 and PND10 and were significantly elevated (one-way ANOVA, P ⬍ .05) in TgSCAR compared to WT testes (Figure 4C).

doi: 10.1210/en.2012-2273


7

Figure 4. Serum testosterone, LH and intratesticular steroid levels. A) Serum testosterone levels were significantly higher (two-way ANOVA, P ⬍ .05), and serum LH levels were equivalent in TgSCAR (black bars) relative to age-matched WT (white bars) males. ND ⫽ not determined. Relative LC expression levels of Lhr were significantly increased at PND30 TgSCAR compared to WT mice and normal in PND5 to PND15. Relative expression of LC-specific Insl3 mRNA showed distinct age-related changes in TgSCAR versus WT males, with decreased expression at PND5 contrasting with increased expression at PND10 and maturity in TgSCAR. B) Intratesticular steroid levels were measured by LC tandem MS/MS analysis, and all steroid levels were significantly increased (one-way ANOVA, P ⬍ .01) in TgSCAR mice relative to WT at PND30. Testosterone and dihydrotestosterone (DHT) output per LC were higher in TgSCAR compared to WT mice at PND30 and at maturity, whereas, 3␣ and 3␤-diols were significantly elevated in TgSCAR mice at PND30. (C) Intratesticular estradiol levels were only detected at PND5–10 and were significantly increased in TgSCAR (black bars) compared to WT mice (white bars). Testicular Sult1e1 mRNA was only detected from puberty (PND30) onwards with significantly decreased levels (one-way ANOVA, P ⬍ .01) in TgSCAR compared to age-matched WT males. Relative testicular expression of Cyp19a1 mRNA was reduced in PND3, PND15 and PND30 (one way ANOVA, P ⬍ .01) TgSCAR relative to WT mice. # indicates not detectable. Values are mean ⫾ SEM (n ⫽ 7-10 /group). * P ⬍ .05.

Effect of TgSCAR on LC-specific markers and steroidogenic enzyme transcripts LC-specific markers. To examine TgSCAR effects on markers associated with LC development, we compared expression levels of LC-specific Lhr and Insl3 mRNA. Relative LC expression of Lhr mRNA was normal in PND5 to PND15 TgSCAR, and significantly elevated (one-way ANOVA, P ⬍ .05) in PND30 TgSCAR compared to WT testes, noting expression levels were markedly elevated

(5-6-fold, P ⬍ .05) in all PND30 and adult compared to PND15 mice (Figure 4A). Relative LC expression of Insl3 mRNA displayed differential age-related changes in TgSCAR compared to WT testes, with reduced Insl3 mRNA expression at PND5 contrasting with elevated expression at PND10 and maturity, and normal expression at PND15 and PND30 (Figure 4A). Steroidogenic enzyme gene expression. During postnatal

8


Endocrinology

levels for LC or SC numbers produced equivalent findings (data not shown). Postnatal Hsd17b3 mRNA levels declined to equivalent low levels in PND10-15 TgSCAR and WT males, and were significantly higher in pubertal-adult males, with higher levels (25%, one-way ANOVA, P ⬍ .01) present in TgSCAR versus control adult testes. Expression levels of Hsd3b1 mRNA were highest at PND5 and progressively declined with age and were consistently higher in postnatal (PND5 to PND30) TgSCAR versus WT males Figure 5. Expression of steroidogenic transcripts in TgSCAR testes. Relative testicular expression levels of indicated transcripts in postnatal and mature TgSCAR (black bars) (Figure 5). Conversely, Hsd3b6 compared to WT (white bars) mice were measured by qPCR. Relative testis expression levels of mRNA was first detected at PND15 Star, Cyp11a1 and Cyp17a1 were significantly reduced in TgSCAR mice compared to WT at and was markedly elevated at PND5, then normal at PND10 and then increased at PND30 and in mature TgSCAR males. In PND30. Hsd3b6 mRNA levels were comparison, expression of Hsd17b3 was up-regulated in PND5 and adult TgSCAR relative to WT testes, but normal in PND10 to PND30 TgSCAR mice. Testicular Hsd3b1 and Srd5a1 mRNA levels significantly higher in pubertal and were increased in PND5 to PND30 TgSCAR versus WT testes. The adult LC marker Hsd3b6 was adult TgSCAR versus WT testes. not detectable until PND15 and was significantly elevated in TgSCAR testes relative to WT at Neonatal Srd5a1 (encoding steroid 5 PND30 and adult age. TgSCAR expression significantly up-regulated testicular Nr5a1 mRNA levels at all ages examined. # indicates not detectable. Data are expressed as mean ⫾ SEM (n ⫽ 6-9/ alpha reductase type 1 enzyme, the group). Asterisks indicate significant differences (P ⬍ .05) between age-matched TgSCAR and predominant testicular isotype (55), WT groups. which converts testosterone to DHT) mRNA levels were greatly intesticular development the expression of the Nr5a1 gene creased (1.6-fold, P ⬍ .01) in TgSCAR compared to WT (encoding the nuclear steroidogenic factor 1) was signif- testes. In WT testes, Srd5a1 mRNA levels progressively icantly up-regulated at all time points examined in Tg- declined with age, noting the similar expression levels in SCAR versus WT males (Figure 5), consistent with en- PND15 and PND30 mice. In contrast, TgSCAR testes dishanced SC maturation and LC steroidogenesis. Neonatal played consistent Srd5a1 mRNA levels from PND10 to expression levels of steroidogenic enzyme genes Star, PND30, with above normal levels at PND15-30 (Figure Cyp11a1, and Cyp17a1 were all reduced (one-way 5), and levels declining to normal in adult mice. Correcting ANOVA, P ⬍ .05) in PND5 TgSCAR versus WT testes. In steroidogenic transcript levels for LC numbers at all-time comparison, relative expression levels of Star, Cyp11a1, points produced equivalent results (data not shown). and Cyp17a1 transcripts were markedly reduced in Expression of Cyp19a1 (encoding aromatase which PND10 compared to PND5 testes, and equivalent in Tg- converts testosterone to estradiol) did not coincide with SCAR versus WT males. Testicular Star expression in- the intratesticular levels of estradiol. Cyp19a1 primers creased to similar levels in PND15-30 TgSCAR and WT were selected to detect testis-specific Cyp19a1 transcripts males, and was significantly elevated (45%, one-way described previously (56). Low Cyp19a1 mRNA expresANOVA, P ⬍ .01) in adult TgSCAR versus WT males sion in PND5-10 testes contrasted with the maximal es(Figure 5). In comparison, testicular Cyp11a1 mRNA lev- tradiol levels found in neonatal testes. Moreover, testicuels remained low in PND15 males, and displayed a striking lar Cyp19a1 levels were highest in PND15 to adult males, rise at puberty (PND30), with higher levels found in whereas estradiol levels were not detected beyond PND15 PND30 and adult TgSCAR relative to control males (Fig- (Figure 4C). To explain the neonatal estradiol levels, we ure 5). Expression levels of Cyp17a1 mRNA displayed a examined if higher expression levels of Cyp19a1 mRNA progressive rise from PND15 to maturity, and was signif- may be present in younger (PND3) males. Testicular icantly higher in TgSCAR compared to age-matched con- Cyp19a1 mRNA levels were higher at PND3 compared to trol testes beyond PND10 (Figure 5). PND5-10, but were reduced (25%, P ⬍ .01) in TgSCAR Testicular Hsd17b3 mRNA levels were greatly elevated versus WT mice. We also examined testicular expression (2.6-fold, P ⬍ .01) in PND5 TgSCAR compared to WT levels of Sult1e1 mRNA, which encodes the estrogen sulmales (Figure 5). Correcting neonatal Hsd17b3 mRNA fotransferase involved in inactivating estradiol. Testicular

doi: 10.1210/en.2012-2273

Sult1e1 mRNA was only detected during puberty (PND30) to adulthood, and mRNA levels were significantly reduced in TgSCAR compared to WT testes (Figure 4C).

Discussion Our unique gain-of-function TgSCAR mouse model has allowed in vivo investigation of the temporal role of SCAR activity upon Leydig cell development and function. The current findings show for the first time that premature SCAR expression reduces the absolute numbers of FLC and ALC types, which are tightly linked to the total SC population size, and enhances functional ALC maturation. In addition, we demonstrate that increased steroidogenic output from LC in TgSCAR testes elevates pubertal androgen levels and maintains steady-state androgen production in mature males. Our findings show that regulatory steroidogenic pathways are adaptable to a reduced LC population without reflex changes in serum LH, indicating a local intratesticular regulatory mechanism. Expression of TgSCAR reduced the number of fetal and adult type LCs throughout the postnatal period, and ultimately decreased total LC numbers in mature testes. To date, quantitative analysis of distinct FLC and ALC development in rodents has been restricted to rats (19). Our stereological enumeration shows that FLC numbers remained relatively constant throughout prepubertal development in both TgSCAR and WT mice, resembling constant FLC numbers found throughout rat prepubertal development (19, 57). Furthermore, we show that the mouse FLC population declines by approximately 1.6and 4-fold in pubertal and adult testes, respectively, which is consistent with early work suggesting rat FLC numbers decline beyond puberty (57). In the present study, ALC were absent in neonatal (PND5) testes and then found at progressively higher numbers from PND10 to maturity, with a marked rise at puberty. Therefore, postnatal ALC development in mice resembles the temporal stage of appearance and age-related increase of ALC described in the rat (19). Expression of the LC-specific Insl3 marker exhibited differential changes in developing TgSCAR testes, initially down-regulated at neonatal PND5 but up-regulated at PND10, normal during PND15 and PND30 (pubertal) stages, and then increased in adult TgSCAR compared to control males. The striking age-related rise in Insl3 levels found in all pubertal and adult testes is consistent with high overall expression in maturing and differentiated ALC (58, 59). Overall, we show that the total LC population in TgSCAR mice displayed a progressive age-related rise with a marked elevation at puberty due to


9

ALC expansion, with absolute LC numbers reduced in TgSCAR relative to control testes. Normal LC:SC ratios found in neonatal to adult TgSCAR testes suggests that early SCAR expression induced a proportional reduction in total LC and SC numbers in TgSCAR males (5). We propose that SCAR-mediated actions confer a functional quorum-dependent SC-LC relationship which determines the ultimate testicular LC population size. Previous research showed that genetic disruption of SCAR activity in SCARKO mice reduced total LC numbers (11), whereas SC numbers remained normal (2, 4), consistent with our proposal that a normal LC:SC ratio is dependent on SCAR activity. Normal circulating LH levels, and normal or elevated LC Lhr mRNA expression levels in TgSCAR mice, combined with normal serum FSH levels (5), suggests that TgSCAR expression did not adversely affect gonadotrophin levels in postnatal TgSCAR testes. TgSCAR is not expressed in fetal (data not shown) and newborn (PND1) testes, and is first detected at PND2 (5), when the testis contains FLCs and no ALC development. Recent work shows that the differentiation and function of FLCs can influence the fate or function of ALC populations (60), so it is possible that the TgSCARinduced reduction of early postnatal FLC numbers may impact subsequent ALC development and function. TgSCAR accelerated LC development postnatally, shown by elevated ratios of advanced:immature LC types in postnatal TgSCAR versus control testes. Detailed stereological comparison revealed a significant increase in the ratio of newly formed ALC to FLC in PND15, and 2-fold higher ratio of immature to preceding newly formed ALC in PND30 TgSCAR relative to control testes, providing direct evidence for the enhanced development of more advanced LC types in TgSCAR males. We recently showed that TgSCAR accelerated SC maturation, which we proposed led to a decreased pool of immature SCs available for FSH-induced mitotic expansion, and therefore a decreased SC population (5). In addition, TgSCAR induced premature postnatal meiotic and postmeiotic germ cell development (5). Our current findings demonstrate that the SCAR-induced premature SC and spermatogenic maturation was associated with reduced postnatal and pubertal LC proliferation, consistent with advanced LC development. It is possible that elevated postnatal LC testosterone production in TgSCAR testes accelerates SCAR-induced development of androgen-dependent meiotic and postmeiotic germ cells (5), as well as LCs, in a positive and reciprocal feed-forward pathway. The orphan nuclear receptor steroidogenic factor 1, encoded by the Nr5a1 gene, is expressed in both SC and LC (61) and is crucial for postnatal SC maturation (62) and LC steroidogenesis (63). Elevated testicular expression of

10


Nr5a1 (SF-1) in neonatal to adult TgSCAR males is in agreement with enhanced functional SC and LC maturation. Transcripts encoding SC-derived ligands and LC associated receptors forming three independent paracrine pathways that regulate fetal and/or postnatal LC differentiation were examined, and all displayed up-regulated expression in TgSCAR relative to WT testes (summarized in Figure 6). Pdgfa has prominent SC localization in postnatal rodent testes (43), and elevated testicular Pdgfa expression levels in early postnatal (PND5-10) TgSCAR males, combined with reduced Pdgfa expression in SCARKO mice (11), provide in vivo evidence for SCARregulated Pdgfa expression. Pdgfa-null mice completely lack ALC development (64), and Pdgfra has a proposed role in postnatal ALC development (65). In comparison, Dhh and Ptch1 transcripts showed a similar pattern of elevated expression in postnatal TgSCAR testes. Rodents lacking Dhh have defective prenatal FLC and completely lack ALC (44, 45, 66). Higher postnatal Dhh-Ptch1 expression and reduced ALC numbers in TgSCAR compared to WT mice is consistent with recent work that found higher Hedgehog signaling lead to reduced postnatal ALC numbers (60). TgSCAR also elevated Amh mRNA levels in neonatal testes, consistent with our recent data (5). Transgenic AMH overexpression leads to decrease postnatal ALC numbers in mice (67), so it is possible that

Endocrinology

elevated Amh expression contributes to reduced ALC numbers in TgSCAR testes. Testicular Amhr2 mRNA expression was up-regulated in postnatal TgSCAR compared to control testes, and highest in PND15 mice during early ALC development, consistent with the postnatal appearance of rat AMHR2 in newly formed ALC (68). The precise integrated role of these SC-to-LC paracrine pathways within the postnatal testis is unclear, and specific SCAR-mediated action that define absolute LC numbers remains to be determined, and may also involve pathways involving other cell types (such as intermediary peritubular cells, (38) during SC-induced testicular development. Further studies on downstream LC signaling are required to clearly understand the role of potential SC-to-LC paracrine pathways in postnatal FLC and ALC development. Testosterone and DHT levels remained normal in neonatal TgSCAR testes containing FLC, despite TgSCAR inducing differential changes to steroidogenic enzyme mRNA levels. LC-specific Cyp17a1 (69) and Hsd3b1 (70) were down and up-regulated respectively, highlighting complex TgSCAR-induced transcriptional level changes in FLC. TgSCAR elevated SC-specific neonatal Hsd17b3 expression (15, 16). Intriguingly, testicular estradiol levels were significantly elevated in PND5-10 TgSCAR mice, despite normal Cyp19a1 expression. Higher Cyp19a1 mRNA levels in PND3 relative to PND5-10 testes are consistent with its more abundant expression in less differen-

Figure 6. Summary of TgSCAR effects on Leydig cell development Diagram highlights the significant TgSCAR effects upon Leydig cell (LC) development and function compared to WT testes. Age shown as days old (from birth). TgSCAR expression reduced total LC numbers and proliferation. TgSCAR accelerated the development appearance of ALC populations, shown by increased ratios of advanced:immature LC types (FLC ⫽ fetal LC; ALC ⫽ adult LC, I and NF ALC ⫽ Immature and Newly Formed ALC types), and consistent with elevated markers associated with LC differentiation (Dhh-Ptch1, Pdgfa-Pdgfra, Amh-Amhr2; ligand-receptor pairs associated with proposed Sertoli-Leydig cell pathways). TgSCAR increased the expression levels of steroidogenic transcripts Nr5a1, Hsd3b1 (FLC) and Hsd3b6 (ALC), consistent with increased testicular androgen (T, DHT) levels per LC in pubertal and adult testes.

doi: 10.1210/en.2012-2273

tiated SC (71, 72). Rat aromatase activity declines in SC and increases in LC during postnatal to adult development by in vitro-based analysis (73). Paradoxically, Cyp19a1 expression was reduced in PND3 TgSCAR testes which had higher than normal estradiol levels, and Cyp19a1 mRNA levels were greatly increased in pubertal and adult testes when testicular estradiol levels were not detectable. ALC expression of Sult1e1 in pubertal and adult testes may reduce estradiol levels, noting loss of Sult1e1 activity leads to excessive estradiol levels in mice (74). Adult human and rodent testes express LC-specific Sult1e1, which is absent in early postnatal mouse testes (75), consistent with our present findings, indicating ALC-specific expression. Despite the reduction in testes size and total LC number in TgSCAR mice, serum testosterone and LH levels, and androgen-dependent seminal vesicle weights were normal (5). We proposed that androgen production is up-regulated in LC of TgSCAR testes to maintain normal testosterone levels. Increased LC steroidogenesis in TgSCAR mice was demonstrated by the higher than normal pubertal and adult levels of testosterone and DHT per LC and up-regulated expression levels of several key steroidogenic enzymes (summarized in Figure 6). In pubertal (PND30) testes, the appearance of 3␣-diol and 3␤-diol, reappearance of DHT and relatively low testosterone levels (per mg tissue or LC) suggest a key role for 5␣-reduced androgens at this stage, which supports earlier findings in mice and rats (76-78). TgSCAR induced DHT and testosterone, and a striking rise in 3␣-diol and 3␤-diol levels in pubertal testes. The coinciding pubertal elevation in testicular Cyp17a1 and Srd5a1 mRNA levels are consistent with these increased steroid levels, noting Srd5a1 (encoding 5␣reductase isoform type 1) was previously shown to be LCspecific and the predominant 5␣-reductase isoform (relative to Srd5a2) in immature mouse testes (79). We did not detect Srd5a2 mRNA by qPCR analysis in mouse testes (data not shown). Markedly increased ALC-specific Hsd3b6 mRNA levels in pubertal and adult TgSCAR testes further highlight SCAR-mediated changes to the ALC population (70). Overall, these findings in the TgSCAR mouse show that up-regulation of LC steroidogenesis in pubertal and mature testes compensates for the reduced total LC population. In summary, our novel gain-of-function TgSCAR model directly shows a temporal postnatal regulatory role for Sertoli cell-specific AR activity on Leydig cell development and function. Normal circulating LH levels suggest intratesticular SCAR-mediated actions locally coordinate the concerted development of SC and LC populations. Indeed, normal LH and testosterone levels in adult TgSCAR mice indicates that, physiologically, an-


11

drogen-dependent processes outside the Sertoli cell may be entirely normal in this model. Targeted TgSCAR expression provides a valuable paradigm for further detailed investigations of the in vivo actions and specific molecular pathways of the SC-mediated AR response during the functional completion of testicular development and maintenance of male reproduction.

Acknowledgments We thank Mamdouh Khalil and the ANZAC Molecular Physiology Unit for mouse care, and Jenny Spaliviero for technical assistance. This work was supported by funding from National Health and Medical Research Council (NHMRC, Australia) Project Grants 464857 and 632753. Address all correspondence and requests for reprints to: Dr Charles Allan, ANZAC Research Institute, Concord Hospital, Sydney, NSW 2139, Australia. Phone: Intl⫹61-2-9767-9100. Fax: Intl⫹61-2-9767-9101. Email: [email protected]. Disclosure Summary: R.H, M.J., R.D., D.J.H., and C.M.A have nothing to disclose. This work was supported by funding from National Health and Medical Research Council (NHMRC, Australia) Project Grants 464857 and 632753.

References 1. McKinnell C, Saunders PTK, Fraser HM, Kelnar CJH, Kivlin C, Morris KD, Sharpe RM. Comparison of androgen receptor and oestrogen receptor beta immunoexpression in the testes of the common marmoset (Callithrix jacchus) from birth to adulthood: low androgen receptor immunoexpression in Sertoli cells during the neonatal increase in testosterone concentrations. Reproduction. 2001;122: 419-429. 2. Tan KAL, De Gendt K, Atanassova N, Walker M, Sharpe RM, Saunders PTK, Denolet E, Verhoeven G. The role of androgens in Sertoli cell proliferation and functional maturation: Studies in mice with total or Sertoli cell-selective ablation of the androgen receptor. Endocrinology. 2005;146:2674-2683. 3. Chemes HE, Rey RA, Nistal M, Regadera J, Musse M, GonzalezPeramato P, Serrano A. Physiological androgen insensitivity of the fetal, neonatal, and early infantile testis is explained by the ontogeny of the androgen receptor expression in Sertoli cells. J Clin Endocr Metab. 2008;93:4408-4412. 4. Lim P, Robson M, Spaliviero J, McTavish KJ, Jimenez M, Zajac JD, Handelsman DJ, Allan CM. Sertoli cell androgen receptor DNA binding domain is essential for the completion of spermatogenesis. Endocrinology. 2009;150:4755-4765. 5. Hazra R, Corcoran L, Robson M, McTavish KJ, Upton D, Handelsman DJ, Allan CM. Temporal Role of Sertoli Cell Androgen Receptor Expression in Spermatogenic Development. Mol Endocrinol. 2013;27:12-24. 6. Bremner WJ, Millar MR, Sharpe RM, Saunders PT. Immunohistochemical localization of androgen receptors in the rat testis: evidence for stage-dependent expression and regulation by androgens. Endocrinology. 1994;135:1227-1234. 7. Shan LX, Hardy MP. Developmental changes in levels of luteinizing

12

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24. 25.


hormone receptor and androgen receptor in rat Leydig cells. Endocrinology. 1992;131:1107-1114. Hardy MP, Kelce WR, Klinefelter GR, Ewing LL. Differentiation of Leydig cell precursors in vitro: a role for androgen. Endocrinology. 1990;127:488-490. Shan LX, Bardin CW, Hardy MP. Immunohistochemical analysis of androgen effects on androgen receptor expression in developing Leydig and Sertoli cells. Endocrinology. 1997;138:1259-1266. Griffin DK, Ellis PJ, Dunmore B, Bauer J, Abel MH, Affara NA. Transcriptional profiling of luteinizing hormone receptor-deficient mice before and after testosterone treatment provides insight into the hormonal control of postnatal testicular development and Leydig cell differentiation. Biol Reprod. 2010;82:1139-1150. De Gendt K, Atanassova N, Tan KAL, de Franca LR, Parreira GG, McKinnell C, Sharpe RM, Saunders PTK, Mason JI, Hartung S, Ivell R, Denolet E, Verhoeven G. Development and function of the adult generation of Leydig cells in mice with sertoli cell-selective or total ablation of the androgen receptor. Endocrinology. 2005;146:41174126. Holdcraft RW, Braun RE. Androgen receptor function is required in Sertoli cells for the terminal differentiation of haploid spermatids. Development. 2004;131:459-467. Tsai MY, Yeh SD, Wang RS, Yeh SY, Zhang CX, Lin HY, Tzeng CR, Chang CS. Differential effects of spermatogenesis and fertility in mice lacking androgen receptor in individual testis cells. Proc Natl Acad Sci USA. 2006;103:18975-18980. Verhoeven G, Cailleau J. Influence of Coculture with Sertoli Cells on Steroidogenesis in Immature Rat Leydig-Cells. Mol Cell Endocrinol. 1990;71:239-251. O’Shaughnessy PJ, Baker PJ, Heikkila M, Vainio S, McMahon AP. Localization of 17beta-hydroxysteroid dehydrogenase/17-ketosteroid reductase isoform expression in the developing mouse testis– androstenedione is the major androgen secreted by fetal/neonatal leydig cells. Endocrinology. 2000;141:2631-2637. Shima Y, Miyabayashi K, Haraguchi S, Arakawa T, Otake H, Baba T, Matsuzaki S, Shishido Y, Akiyama H, Tachibana T, Tsutsui K, Morohashi KI. Contribution of Leydig and Sertoli Cells to Testosterone Production in Mouse Fetal Testes. Mol Endocrinol. 2013; 27:63-73. Weisser J, Landreh L, Soder O, Svechnikov K. Steroidogenesis and steroidogenic gene expression in postnatal fetal rat Leydig cells. Mol Cell Endocrinol. 2011;341:18-24. Hardy MP, Zirkin BR, Ewing LL. Kinetic studies on the development of the adult population of Leydig cells in testes of the pubertal rat. Endocrinology. 1989;124:762-770. Ariyaratne HB, Chamindrani Mendis-Handagama S. Changes in the testis interstitium of Sprague Dawley rats from birth to sexual maturity. Biol Reprod. 2000;62:680-690. Ge RS, Dong Q, Sottas CM, Papadopoulos V, Zirkin BR, Hardy MP. In search of rat stem Leydig cells: identification, isolation, and lineage-specific development. Proc Natl Acad Sci USA. 2006;103: 2719-2724. Stanley EL, Johnston DS, Fan J, Papadopoulos V, Chen H, Ge RS, Zirkin BR, Jelinsky SA. Stem Leydig cell differentiation: gene expression during development of the adult rat population of Leydig cells. Biol Reprod. 2011;85:1161-1166. Stanley E, Lin CY, Jin S, Liu J, Sottas CM, Ge R, Zirkin BR, Chen H. Identification, proliferation, and differentiation of adult Leydig stem cells. Endocrinology. 2012;153:5002-5010. Mendis-Handagama SM, Ariyaratne HB. Differentiation of the adult Leydig cell population in the postnatal testis. Biol Reprod. 2001;65:660-671. Haider SG. Cell biology of Leydig cells in the testis. Int Rev Cytol. 2004;233:181-241. Siril Ariyaratne HB, Chamindrani Mendis-Handagama S, Buchanan Hales D, Ian Mason J. Studies on the onset of Leydig pre-

Endocrinology

26.

27.

28.

29.

30.

31.

32.

33.

34. 35.

36.

37.

38.

39.

40.

41.

42.

43. 44.

cursor cell differentiation in the prepubertal rat testis. Biol Reprod. 2000;63:165-171. O’Shaughnessy PJ, Baker P, Sohnius U, Haavisto AM, Charlton HM, Huhtaniemi I. Fetal development of Leydig cell activity in the mouse is independent of pituitary gonadotroph function. Endocrinology. 1998;139:1141-1146. Teerds KJ, Rijntjes E, Veldhuizen-Tsoerkan MB, Rommerts FFG, de Boer-Brouwer M. The development of rat Leydig cell progenitors in vitro: how essential is luteinising hormone? J Endocrinol. 2007; 194:579-593. Simoni M, Gromoll J, Nieschlag E. The follicle-stimulating hormone receptor: biochemistry, molecular biology, physiology, and pathophysiology. Endocr Rev. 1997;18:739-773. Janecki A, Jakubowiak A, Lukaszyk A. Stimulatory effect of Sertoli cell secretory products on testosterone secretion by purified Leydig cells in primary culture. Mol Cell Endocrinol. 1985;42:235-243. Verhoeven G, Cailleau J. A Factor in Spent Media from Sertoli CellEnriched Cultures That Stimulates Steroidogenesis in Leydig-Cells. Mol Cell Endocrinol. 1985;40:57-68. Verhoeven G, Cailleau J. Influence of coculture with Sertoli cells on steroidogenesis in immature rat Leydig cells. Mol Cell Endocrinol. 1990;71:239-251. Teerds KJ, Closset J, Rommerts FF, de Rooij DG, Stocco DM, Colenbrander B, Wensing CJ, Hennen G. Effects of pure FSH and LH preparations on the number and function of Leydig cells in immature hypophysectomized rats. J Endocrinol. 1989;120:97-106. Vihko KK, LaPolt PS, Nishimori K, Hsueh AJ. Stimulatory effects of recombinant follicle-stimulating hormone on Leydig cell function and spermatogenesis in immature hypophysectomized rats. Endocrinology. 1991;129:1926-1932. Saez JM, Tabone E, Perrard-Sapori MH, Rivarola MA. Paracrine role of Sertoli cells. Med Biol. 1986;63:225-236. Johnson BH, Ewing LL. Follicle-stimulating hormone and the regulation of testosterone secretion in rabbit testes. Science. 1971;173: 635-637. Denolet E, De Gendt K, Swinnen JV, Verrijdt G, Deboel L, Roskams T, Verhoeven G. Transfection with steroid-responsive reporter constructs shows glucocorticoid rather than androgen responsiveness in cultured Sertoli cells. J Steroid Biochem. 2006;98:164-173. Shiraishi K, Ascoli M. Lutropin/choriogonadotropin stimulate the proliferation of primary cultures of rat leydig cells through a pathway that involves activation of the extracellularly regulated kinase 1/2 cascade. Endocrinology. 2007;148:3214-3225. Welsh M, Moffat L, Belling K, de Franca LR, Segatelli TM, Saunders PTK, Sharpe RM, Smith LB. Androgen receptor signalling in peritubular myoid cells is essential for normal differentiation and function of adult Leydig cells. Int J Androl. 2012;35:25-40. Wang R, Yeh S, Tzeng C, Chang C. Androgen Receptor Roles in Spermatogenesis and Fertility: Lessons from Testicular Cell-Specific Androgen Receptor Knockout Mice. Endocr Rev. 2009;30:119132. Hayes FJ, Decruz S, Seminara SB, Boepple PA, Crowley WF. Differential regulation of gonadotropin secretion by testosterone in the human male: Absence of a negative feedback effect of testosterone on follicle-stimulating hormone secretion. J Clin Endocr Metab. 2001;86:53-58. Okada Y, Fujii Y, Moore JP, Jr., Winters SJ. Androgen receptors in gonadotrophs in pituitary cultures from adult male monkeys and rats. Endocrinology. 2003;144:267-273. Brayman MJ, Pepa PA, Berdy SE, Mellon PL. Androgen receptor repression of GnRH gene transcription. Mol Endocrinol. 2012;26: 2-13. Basciani S, Mariani S, Spera G, Gnessi L. Role of Platelet-Derived Growth Factors in the Testis. Endocr Rev. 2010;31:916-939. Yao HHC, Whoriskey W, Capel B. Desert Hedgehog/Patched 1 signaling specifies fetal Leydig cell fate in testis organogenesis. Gene Dev. 2002;16:1433-1440.

doi: 10.1210/en.2012-2273

45. Kawai Y, Noguchi J, Akiyama K, Takeno Y, Fujiwara Y, Kajita S, Tsuji T, Kikuchi K, Kaneko H, Kunieda T. A missense mutation of the Dhh gene is associated with male pseudohermaphroditic rats showing impaired Leydig cell development. Reproduction. 2011; 141:217-225. 46. Vergouwen RPFA, Huiskamp R, Bas RJ, Roepersgajadien HL, Davids JAG, Derooij DG. Postnatal-Development of Testicular CellPopulations in Mice. J Reprod Fertil. 1993;99:479-485. 47. Allan CM, Garcia A, Spaliviero J, Zhang FP, Jimenez M, Huhtaniemi I, Handelsman DJ. Complete sertoli cell proliferation induced by follicle-stimulating hormone (FSH) independently of luteinizing hormone activity: Evidence from genetic models of isolated FSH action. Endocrinology. 2004;145:1587-1593. 48. Haywood M, Spaliviero J, Jimemez M, King NJC, Handelsman DJ, Allan CM. Sertoli and germ cell development in hypogonadal (hpg) mice expressing transgenic follicle-stimulating hormone alone or in combination with testosterone. Endocrinology. 2003;144:509-517. 49. Baker P, O’Shaughnessy P. Role of gonadotrophins in regulating numbers of Leydig and Sertoli cells during fetal and postnatal development in mice. Reproduction. 2001;122:227-234. 50. Simanainen U, Allan CM, Lim P, McPherson S, Jimenez M, Zajac JD, Davey RA, Handelsman DJ. Disruption of prostate epithelial androgen receptor impedes prostate lobe-specific growth and function. Endocrinology. 2007;148:2264-72. 51. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3:RESEARCH0034. 52. Jimenez M, Spaliviero JA, Grootenhuis AJ, Verhagen J, Allan CM, Handelsman DJ. Validation of an ultrasensitive and specific immunofluorometric assay for mouse follicle-stimulating hormone. Biol Reprod. 2005;72:78-85. 53. McNamara KM, Harwood DT, Simanainen U, Walters KA, Jimenez M, Handelsman DJ. Measurement of sex steroids in murine blood and reproductive tissues by liquid chromatography-tandem mass spectrometry. J Steroid Biochem Mol Biol. 2010;121:611-618. 54. Coquelin A, Desjardins C. Luteinizing hormone and testosterone secretion in young and old male mice. Am J Physiology. 1982;243: E257–263. 55. Viger RS, Robaire B. Steady state steroid 5 alpha-reductase messenger ribonucleic acid levels and immunocytochemical localization of the type 1 protein in the rat testis during postnatal development. Endocrinology. 1995;136:5409-5415. 56. Chow JD, Simpson ER, Boon WC. Alternative 5⬘-untranslated first exons of the mouse Cyp19A1 (aromatase) gene. J Steroid Biochem Mol Biol. 2009;115:115-125. 57. Kerr JB, Knell CM. The fate of fetal Leydig cells during the development of the fetal and postnatal rat testis. Development. 1988; 103:535-544. 58. Balvers M, Spiess AN, Domagalski R, Hunt N, Kilic E, Mukhopadhyay AK, Hanks E, Charlton HM, Ivell R. Relaxin-like factor expression as a marker of differentiation in the mouse testis and ovary. Endocrinology. 1998;139:2960-2970. 59. Mendis-Handagama SMLC, Ariyaratne HBS, Mrkonjich L, Ivell R. Expression of insulin-like peptide 3 in the postnatal rat Leydig cell lineage: timing and effects of triiodothyronine-treatment. Reproduction. 2007;133:479-485. 60. Barsoum BI, Kaur J, Ge SR, Cooke PS, Yao HH 2013 Dynamic changes in fetal Leydig cell populations influence adult Leydig cell populations in mice. FASEB J. doi:10.1096/fj.12-225060. 61. Hatano O, Takayama K, Imai T, Waterman MR, Takakusu A, Omura T, Morohashi K. Sex-Dependent Expression of a Transcription Factor, Ad4bp, Regulating Steroidogenic P-450 Genes in the


62.

63.

64.

65.

66.

67.

68.

69.

70.

71.

72.

73.

74.

75.

76.

77.

78. 79.

13

Gonads during Prenatal and Postnatal Rat Development. Development. 1994;120:2787-2797. Kato T, Esaki M, Matsuzawa A, Ikeda Y. NR5A1 is required for functional maturation of Sertoli cells during postnatal development. Reproduction. 2012;143:663-672. Jeyasuria P, Ikeda Y, Jamin SP, Zhao LP, De Rooij DG, Themmen APN, Behringer RR, Parker KL. Cell-specific knockout of steroidogenic factor 1 reveals its essential roles in gonadal function. Mol Endocrinol. 2004;18:1610-1619. Gnessi L, Basciani S, Mariani S, Arizzi M, Spera G, Wang CY, Bondjers C, Karlsson L, Betsholtz C. Leydig cell loss and spermatogenic arrest in platelet-derived growth factor (PDGF)-A-deficient mice. J Cell Biol. 2000;149:1019-1025. Schmahl J, Rizzolo K, Soriano P. The PDGF signaling pathway controls multiple steroid-producing lineages. Genes Dev. 2008;22: 3255-3267. Clark AM, Garland KK, Russell LD. Desert hedgehog (Dhh) gene is required in the mouse testis for formation of adult-type Leydig cells and normal development of peritubular cells and seminiferous tubules. Biol Reprod. 2000;63:1825-1838. Racine C, Rey R, Forest MG, Louis F, Ferre A, Huhtaniemi I, Josso N, di Clemente N. Receptors for anti-mullerian hormone on Leydig cells are responsible for its effects on steroidogenesis and cell differentiation. Proc Natl Acad Sci USA. 1998;95:594-599. Lee MM, Seah CC, Masiakos PT, Sottas CM, Preffer FI, Donahoe PK, Maclaughlin DT, Hardy MP. Mullerian-inhibiting substance type II receptor expression and function in purified rat Leydig cells. Endocrinology. 1999;140:2819-2827. Majdic G, Saunders PTK, Teerds KJ. Immunoexpression of the steroidogenic enzymes 3-beta hydroxysteroid dehydrogenase and 17 alpha-hydroxylase, C17,20 lyase and the receptor for luteinizing hormone (LH) in the fetal rat testis suggests that the onset of Leydig cell steroid production is independent of LH action. Biol Reprod. 1998;58:520-525. Baker PJ, Sha JA, McBride MW, Peng L, Payne AH, O’Shaughnessy PJ. Expression of 3beta-hydroxysteroid dehydrogenase type I and type VI isoforms in the mouse testis during development. Eur J Biochem. 1999;260:911-917. Rommerts FF, de Jong FH, Brinkmann AO, van der Molen HJ. Development and cellular localization of rat testicular aromatase activity. J Reprod Fertil. 1982;65:281-288. Rosselli M, Skinner MK. Developmental regulation of Sertoli cell aromatase activity and plasminogen activator production by hormones, retinoids and the testicular paracrine factor, PModS. Biol Reprod. 1992;46:586-594. Tsai-Morris CH, Aquilano DR, Dufau ML. Cellular localization of rat testicular aromatase activity during development. Endocrinology. 1985;116:38-46. Tong MH, Jiang H, Liu P, Lawson JA, Brass LF, Song WC. Spontaneous fetal loss caused by placental thrombosis in estrogen sulfotransferase-deficient mice. Nat Med. 2005;11:153-159. Song WC, Qian Y, Sun X, Negishi M. Cellular localization and regulation of expression of testicular estrogen sulfotransferase. Endocrinology. 1997;138:5006-5012. Corpéchot C, Baulieu E, Robel P. Testosterone, dihydrotestosterone and androstanediols in plasma, testes and prostates of rats during development. Act Endocrinol. 1981;96:127-135. Killian J, Pratis K, Clifton RJ, Stanton PG, Robertson DM, O’Donnell L. 5␣-Reductase Isoenzymes 1 and 2 in the Rat Testis During Postnatal Development. Biol Reprod. 2003;68:1711-1718. Auchus RJ. The backdoor pathway to dihydrotestosterone. Trends Endocrinol Metab. 2004;15:432-438. Mahendroo M, Wilson JD, Richardson JA, Auchus RJ. Steroid 5alpha-reductase 1 promotes 5alpha-androstane-3alpha,17beta-diol synthesis in immature mouse testes by two pathways. Mol Cell Endocrinol. 2004;222:113-120.