SET7/9 regulates cancer cell proliferation by ... - The FASEB Journal

The FASEB Journal • Research Communication

SET7/9 regulates cancer cell proliferation by influencing b-catenin stability Changchun Shen,* Donglai Wang,* Xiangyu Liu,* Bo Gu,* Yipeng Du,* Fu-Zheng Wei,* Lin-Lin Cao,* Boyan Song,* Xiaopeng Lu,* Qiaoyan Yang,* Qian Zhu,* Tianyun Hou,* Meiting Li,* Lina Wang,* Haiying Wang,* Ying Zhao,* Yang Yang,* and Wei-Guo Zhu*,†,1 *Key Laboratory of Carcinogenesis and Translational Research, Ministry of Education, State Key Laboratory of Natural and Biomimetic Drugs, Beijing Key Laboratory of Protein Posttranslational Modifications and Cell Function, Department of Biochemistry and Molecular Biology, Peking University Health Science Center, Beijing, China; and †Peking University–Tsinghua University Center for Life Sciences, Beijing, China b-Catenin, which is a key mediator of the wingless-integration site (Wnt)/b-catenin signaling pathway, plays an important role in cell proliferation, cell fate determination, and tumorigenesis, by regulating the expression of a wide range of target genes. Although a variety of posttranslational modifications are involved in b-catenin activity, the role of lysine methylation in b-catenin activity is largely unknown. In this study, su(var)3-9, enhancer-of-zeste, trithorax (SET) domain-containing protein 7 (SET7/9), a lysine methyltransferase, interacted with and methylated b-catenin, as demonstrated both in vitro and in vivo. The interaction and methylation were significantly enhanced in response to H2O2 stimulation. A mutagenesis assay and mass spectrometric analyses revealed that b-catenin was monomethylated by SET7/9 at lysine residue 180. Methylated b-catenin was easily recognized by phosphokinase glycogen synthase kinase (GSK)-3b for degradation. Consistent with this finding, the mutated b-catenin (K180R) that cannot be methylated exhibited a longer half-life than did the methylated b-catenin. The consequent depletion of SET7/9 by shRNA or the mutation of the b-catenin (K180R) significantly enhanced the expression of Wnt/b-catenin target genes such as c-myc and cyclin D1 and promoted the growth of cancer cells. Together, these results provide a novel mechanism by which Wnt/ b-catenin signaling is regulated in response to oxidative stress.—Shen, C., Wang, D., Liu, X., Gu, B., Du, Y., Wei, F.-Z., Cao, L.-L., Song, B., Lu, X., Yang, Q., Zhu, Q., Hou, T., Li, M., Wang, L., Wang, H., Zhao, Y., Yang, Y., Zhu, W.-G. SET7/9 regulates cancer cell proliferation by influencing b-catenin stability. FASEB J. 29, 4313–4323 (2015). www.fasebj.org

ABSTRACT

Key Words: oxidative stress • Wnt/b-catenin signaling • lysine methylation Abbreviations: b-TrCP, b-transducin repeats containing protein; AKT, protein kinase B; BBR, berberine; CBB, Coomassie brilliant blue; CK, casein kinase; Ctr, control; DNMT, DNA methyltransferase 1; ERa, estrogen receptor a; FL, full-length; FoxO3, forkhead box O3; GFP, green fluorescent protein; GSK3b, glycogen synthase kinase 3b; GST, glutathione S-transferase; (continued on next page)

0892-6638/15/0029-4313 © FASEB

b-Catenin was initially discovered as part of the adherens junction complex, with cadherin and a-catenin (1, 2), and is a key mediator of the wingless-integration site (Wnt)/b-catenin signaling pathway, which triggers the transcription of the target genes that are responsible for the control of cell fate decisions in many cells and tissues (3–5). It is well known that many posttranslational modifications (PTMs) are involved in regulating b-catenin function, including phosphorylation, ubiquitination, and acetylation (6, 7). For example, the phosphorylation of b-catenin at Tyr654 by the sarcoma (src) gene and epidermal growth factor receptor (EGFR) decreases its affinity for cadherin binding and thus reduces its adhesive functions (8–11). Phosphorylation close to the hinge region-Tyr142 of b-catenin by Fyn, Fer, or the receptor tyrosine kinase c-Met significantly reduces a-catenin binding and thus impairs the adhesive function of b-catenin (12–14). In addition, the phosphorylation of b-catenin at Ser45 by casein kinase (CK)-1a, which primes phosphorylation, induces subsequent phosphorylation by glycogen synthase kinase (GSK)-3b at residues Thr41, Ser37, and Ser33 (15, 16). These phosphorylation events are coordinated by the scaffold protein axin2, which has binding sites for b-catenin, CK1, GSK3b, and other factors that are necessary for Wnt-dependent and -independent signaling events (17–19). b-Catenin, which is phosphorylated at Ser37 and Ser33, is ultimately recognized by the b-transducin repeatscontaining protein (b-TrCP) E3-ligase complex, ubiquitinated, and rapidly degraded by the 26S proteasome (20, 21). The phosphorylation by protein kinase B (AKT) of b-catenin at Ser552 results in its dissociation from cell-cell contacts and in the accumulation of b-catenin in both the cytosol and nucleus (22). In addition to phosphorylation and ubiquitination, acetylation has been reported to be involved in regulating 1

Correspondence: Department of Biochemistry and Molecular Biology, Peking University Health Science Center, Beijing 100191, China. E-mail: [email protected] doi: 10.1096/fj.15-273540 This article includes supplemental data. Please visit http:// www.fasebj.org to obtain this information.

4313

b-catenin (23–26). For example, the transcriptional coactivator p300 up-regulates b-catenin–dependent gene transcription by acetylating b-catenin at Lys345, which increases the affinity of b-catenin for transcription factor (Tcf)-4 (25). Consistent with this finding, a more recent study indicated that the acetylation of b-catenin at Lys19 and Lys49 by p300/cAMP response element-binding (CREB) protein-associated factor (PCAF) stabilizes b-catenin, induces its nuclear translocation, and increases its transcriptional activity, thereby upregulating Wnt signaling (26). Based on the evidence that b-catenin activity is largely regulated by its own PTMs, it is suspected that b-catenin is regulated by methylation. Su(var)3-9, enhancer-of-zeste, trithorax (SET) domain-containing protein 7 (SET7/9) was initially identified as an H3K4 methyltransferase associated with gene expression (27, 28). Biochemical and structural studies suggest that SET7/9 catalyzes the monomethylation of H3K4 (29, 30). More recent studies have indicated that SET7/9 is a methyltransferase preferential for nonhistone proteins, as studies on SET7/9 knockout cells have indicated no changes in the level of lysine methylation on histones (31, 32). In this regard, more and more nonhistone proteins have been identified as targets for SET7/9, including the transcription factors p53, SRY (sex determining region Y)-box 2 (Sox2), v-rel avian reticuloendotheliosis viral oncogene homolog A (RelA), estrogen receptor (ER)-a, and forkhead box O3 (FoxO3) (33–38); the enzymes su(var) 3-9 homolog 1 (SUV39H1), sirtuin (SIRT)-1, and DNA-methyltransferase (DNMT)-1 (39–41); and the transcription-initiation protein TATA box binding protein (TBP)-associated factor (TAF)-10 (42). Therefore, SET7/9 appears to function primarily by methylating various target proteins, which in turn regulates target protein stability and activity. In our study, SET7/9 interacted with and methylated b-catenin both directly in vitro and in cancer cells. The interaction between SET7/9 and b-catenin, as well as b-catenin methylation, were enhanced in response to oxidative stress (H2O2), or berberine (BBR), a SET7/9 inducer. A single lysine residue (K180) methylated by SET7/9 on b-catenin was confirmed, and the methylation at K180 was found to be important in modulating the stability of b-catenin. Our findings further deepen the understanding of the regulation of Wnt/b-catenin signaling and expand the existing knowledge of the role of SET7/9 in cancer cells. (continued from previous page) HCT, human colon cancer (cell); HEK, human embryonic kidney (cell); IP, immunoprecipitation; NP40, Nonidet P40; PCAF, p300/cAMP response element-binding (CREB) protein-associated factor; PTM, posttranslational modification; ROS, reactive oxygen species; SET7/9, su(var)3-9, enhancer-of-zeste, trithorax (SET) domain-containing protein 7; shRNA, short hairpin RNA; siRNA, small interfering RNA; SIRT1, sirtuin type 1; Sox2, SRY (sex determining region Y)-box 2; TAF10, TATA box binding protein (TBP)associated factor; Tcf, transcription factor; TEN, Tris-HCl/ EDTA/NaCl (buffer); Wnt, wingless-integration site; WT, wild-type

4314

Vol. 29

October 2015

MATERIALS AND METHODS Cell culture and establishment of stable cell lines The human embryonic kidney cell line (HEK)293T, human cervical cancer cell line HeLa, and human colon cancer cell line (HCT) 116 were maintained in DMEM supplemented with 10% fetal bovine serum and an appropriate amount of penicillin/streptomycin in a humidified incubator containing 5% CO2. For the generation of stable cell lines, HeLa cells were transfected with the pCMV3xFLAG, pCMV-3xFLAG-SET7/9-WT, or pCMV-3xFLAG-SET7/9H297A plasmid by using Lipofectamine 2000 (Life TechnologiesInvitrogen, Carlsbad, CA, USA). pSuper-control short hairpin (sh) RNA, pSuper-SET7/9 shRNA, or pSuper-SET7/9 shRNA plus RNAi-resistant SET7/9-WT or -H297A plasmid was transfected into HeLa cells for selection of stable clones. Plasmid construction The b-catenin-WT full-length (FL) and fragment cDNAs were amplified from plasmids by PCR and cloned into the pcDNA3.1myc-His, PGEX4T3, and EGFP-C2 vectors. Flag-tagged SET7/9WT or -H297A FL and fragment cDNAs were amplified from plasmids by PCR and separately subcloned into pGEX-4T3, EGFP, and pET28 vectors. K180R of b-catenin was constructed with a site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA), according to the manufacturer’s instructions.

Western blot analysis and coimmunoprecipitation In brief, the cells were harvested with a scraper and then washed once with cold PBS. The cells were then lysed in lysis buffer containing 50 mM Tris-HCl, 250 mM NaCl, 5 mM EDTA, 50 mM NaF, 0.1% Nonidet (N)P40, and 1% protease inhibitor cocktail. Equal amounts of proteins were size fractionated by 6–12% SDS-PAGE. The antibodies used and their sources were anti–b-catenin (Santa Cruz Biotechnology, Santa Cruz, CA, USA); anti–p-b-catenin, anti– non-p-b-catenin, and anti-His (Cell Signaling Technology, Danvers, MA, USA); anti-SET7/9 (Upstate Biotechnology, Lake Placid, NY, USA); anti-HA and anti-Flag (Sigma-Aldrich, St. Louis, MO, USA); anti–glutathione S-transferase (GST), anti–green fluorescent protein (GFP), and, anti-Myc (MBL, Woburn, MA, USA); anti-GAPDH (GeneTex, San Antonio, TX, USA); and anti–pan-methylation, antiubiquitin, and anti–cyclin D1 (Abcam, Cambridge, MA, USA). Immunoprecipitation (IP) was performed as described elsewhere (39). GST pull-down assay GST or GST-fusion proteins were expressed in Escherichia coli induced with isopropyl-D-thio-galactoside and purified by glutathione-Sepharose 4B beads (GE Healthcare, Kings Park, NY, USA) and then washed with TEN buffer [20 mM Tris-HCl (pH 7.4), 0.1 mM EDTA, and 100 mM NaCl]. Recombinant His-tagged proteins were expressed in and purified from E. coli by Ni (ii)Sepharose affinity (GE Healthcare). The proteins were incubated at 4°C overnight. The beads were washed 3 times with TEN buffer and boiled with 23 SDS loading buffer, and the proteins were analyzed by Western blot with an anti-His or anti-GST antibody. RNA interference Sequences of small interfering (si)RNA oligonucleotides were as follows: control siRNA, UUCUCCGAACGUGUCACGU; SET7/9 siRNA-1, GGGCACCTGGACGATGACGGA; SET7/9

The FASEB Journal x www.fasebj.org

SHEN ET AL.

siRNA-2, GCCTTGTAGGAGAAGTAAA; and b-catenin siRNA, GGTGGTGGTTAATAAGGCT. All siRNA oligonucleotides were purchased from Shanghai GenePharma (Shanghai, China). SET7/9 shRNA was designed according to the sequence of siRNA2. These siRNA oligonucleotides and shRNAs were transfected into cells with a Lipofectamine 2000 kit (Life TechnologiesInvitrogen) for 48 h, according to the manufacturer’s instructions, with re-SET7/9 sequence, AGTCTCGTTGGTGAAGTTAA. Bold indicates the mutation sites in the re-SET7/9 plasmid. In vitro methylation assay For SET7/9, GST-b-catenin was incubated with SET7/9 and 1 mCi 3H-labeled S-adenosyl methionine (3H-SAM; PerkinElmer, Waltham, MA, USA) in methylation buffer І [50 mM Tris-HCl (pH 9.0), 0.5 mM DTT, and 1 mM PMSF] for 1 h at 30°C. The products were separated by SDS-PAGE and detected by autoradiography or the appropriate antibodies.

Antibody generation Rabbits were immunized by keyhole limpet hemocyanin– conjugated peptides [CHQLS-(monomethyl) K-KEASR]. The sera were tested and collected after 4 more antigen boosters. To eliminate nonspecific recognition of nonmethylated antigen, the sera were precleaned by incubating with nonmethylated peptide (CHQLSKKEASR) and examining with affinity chromatography. The specific polyclonal antibodies were finally purified by methylated peptide affinity chromatography via CNBr-activated Sepharose 4 Fast Flow (17-0981-01; GE Healthcare).

[35S]-methionine pulse chase assay Cells were incubated with methionine/cysteine-free DMEM + 10% serum for 0.5 h. The cells were then incubated with methionine/cysteine-free DMEM + 10% serum containing [35S]-labeled methionine and cysteine (200 mCi/ml) for 1 h. The medium of [35S]-methionine/cysteine-labeled cells was replaced by standard DMEM + 10% serum, and the cells were harvested at different time points. The cells were lysed in a buffer containing 20 mM Tris-HCl (pH 8.0), 137 mM NaCl, 10% glycerol, 1% NP-40, 2 mM EDTA, 1 mM PMSF, and cocktail protease inhibitors and were subjected to IP with b-catenin antibody. Immunoprecipitated proteins were analyzed by SDS-PAGE followed by autoradiography. Subcellular fraction Cells were rinsed twice in cold PBS, incubated with buffer A [50 mM Tris-HCl (pH 7.8), 420 mM NaCl, 1 mM EDTA, 0.5% NP40, 0.34 M sucrose, 10% glycerol, 1 mM Na3VO4, and protease inhibitor mixture] for 5 min on ice, scraped, and centrifuged. The supernatant was the cytoplasmic fraction, and the pellet was then lysed in buffer B [10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, 0.34 M sucrose, 10% glycerol, 0.1% Triton X-100, and protease inhibitor mixture]. After centrifugation, the supernatant collected was the nuclear fraction.

Statistical analysis For all statistical tests, P , 0.05, by unpaired Student’s t test, was considered statistically significant.

SET7/9 METHYLATES b-CATENIN

RESULTS b-Catenin interacts with SET7/9 in vitro and in vivo The biologic role of b-catenin is largely dependent on its PTMs, such as phosphorylation and ubiquitination. To better understand the molecular basis of Wnt/b-catenin signaling, we investigated whether the methylation of b-catenin is also involved in these signaling events. First, an IP assay was performed by using an anti–b-catenin antibody in HeLa cell extracts that were then probed with an anti–panmethylation antibody. It was clear that b-catenin was methylated, and its methylation levels seemed to be increased under conditions of stress, such as experimental oxidative stress (Supplemental Fig. S1A). To identify the methyltransferases for b-catenin, a co-IP assay was performed in HEK293T cells with the overexpression of GFP-SET7/9 and Flag-b-catenin, because SET7/9 preferentially methylates nonhistone proteins. The interaction between SET7/9 and b-catenin was obvious (Fig. 1A) and was also detected physiologically in HeLa cells by using an anti–b-catenin antibody followed by Western blot analysis with an antiSET7/9 antibody (Fig. 1B). In addition, a reciprocal co-IP assay was performed by precipitation with an anti-SET7/9 antibody, followed by blot analysis with an anti–b-catenin antibody. Again, an interaction between SET7/9 and b-catenin was detected (Fig. 1B). The same co-IP assay was performed in HCT116 cells, and a similar result was observed, which indicated that the interaction between SET7/ 9 and b-catenin is a universal phenomenon (Supplemental Fig. S1B, C). To further investigate the interaction between SET7/9 and b-catenin, a GST pull-down assay was performed by incubating GST-SIRT1 (as a positive control) (40), GST-b-catenin, or GST (as a negative control) with the whole-cell lysates of HeLa cells. SET7/9 interacted with GSTSIRT1 and GST-b-catenin, but not with GST alone (Fig. 1C). To further map the regions of SET7/9 for b-catenin binding, we constructed and purified the FL and several fragments of GST-SET7/9 (FL, 1–366 aa; N-terminal,1–107 aa; middle, 108–214 aa; and SET domain-containing, 215–366 aa) and then performed a GST pull-down assay. Both the N-terminal and middle fragments of SET7/9 bound to b-catenin (Fig. 1D). Next, the regions of b-catenin for SET7/9 binding from the GST pull-down assay were mapped by incubating the FL or fragments of GSTb-catenin (Supplemental Fig. S2; FL, 1–781 aa; N-terminal fragments, 1–150, 151–389, and 390–666 aa; and C-terminal fragment, 667–781 aa) with His-SET7/9. His-SET7/9 specifically interacted with the FL and the 151-389 aa fragment of GST-b-catenin, but not with GST alone (Fig. 1E). All of the above data indicate that SET7/9 directly interacts with b-catenin. b-Catenin is methylated by SET7/9 in vitro and in vivo To investigate whether b-catenin is methylated by SET7/9, an in vitro methylation assay was performed by incubating SET7/9 with 3H-SAM. GST-b-catenin was methylated by SET7/9 (Fig. 2A; Supplemental Fig. S3). However, when a methylase-deficient mutant SET7/9 (SET7/9-H297A) (27, 28) was used, no signal was detected (Fig. 2B), which confirms that SET7/9 methylates b-catenin. 4315

Figure 1. SET7/9 interacts with b-catenin in vitro and in vivo. A) Whole-cell lysates of HEK293T cells transfected with GFP-SET7/9 and Flag-b-catenin were precipitated with an anti-GFP or anti-Flag antibody, and the interactive components were analyzed by Western blot. B) HeLa cells were extracted and immunoprecipitated with an anti–b-catenin (left) or anti-SET7/9 (right) antibody. IP with rabbit IgG was used as the negative control. Western blot analysis was performed with the antibodies indicated. C) GST, GST-b-catenin, or GST-SIRT1 was incubated with whole-cell lysates of HeLa cells, and Western blot analysis was performed to detect the interaction between SET7/9 and b-catenin. GST was used as the negative control, and GST-SIRT1 was used as the positive control. D) GST-SET7/9 FL or fragments were incubated with His-b-catenin, and Western blotting was performed to detect the interaction with an anti-His antibody. E) The reciprocal pull-down assay between GST-b-catenin FL or fragments and His-SET7/9. CBB staining was used to show protein levels in (C ), (D), and (E ). #, specific protein bands.

To examine whether endogenous b-catenin is also methylated by SET7/9, HeLa cell lines overexpressing pcDNA (HeLa-pcDNA), wild-type (WT), SET7/9 (HeLaSET7/9-WT), or methylase-deficient mutant SET7/9 (HeLa-SET7/9-H297A) were generated (Supplemental Fig. S4A), and IP endogenous b-catenin from the cell lines was subjected to Western blot analysis with an anti–panmethyl-lysine antibody. The protein levels of the methylated b-catenin were significantly increased in the HeLa-SET7/ 9-WT cell line, but the same phenomenon was not found in the HeLa-SET7/9-H297A cell line (Fig. 2C). To further examine whether the methylation of b-catenin is mediated by SET7/9, HeLa cell lines depleted of nonspecific control [HeLa-sh-control (Ctr)] or SET7/9 (HeLa-sh-SET7/9) were generated (Supplemental Fig. S4B). The methylation of b-catenin was almost abolished in the HeLa-shSET7/9 cell line compared with the HeLa-sh-Ctr cell line (Fig. 2D). Together, these experiments demonstrate that SET7/9 methylates b-catenin in vitro and in vivo. SET7/9 specifically methylates b-catenin at Lys180 To determine the precise residues in b-catenin that are methylated by SET7/9, E. coli–expressed GST fusion 4316

Vol. 29

October 2015

proteins containing 4 different segments of b-catenin were purified and used as substrates with 3H-SAM in an in vitro methylation assay (Fig. 3A). Of these 4 fragments, only the GST-b-catenin 151–389 aa fragment was methylated by SET7/9. There are 14 lysine residues within this 151–389 aa fragment, which are further divided into 2 different fragments: b-catenin fragment A (151–276 aa) and b-catenin fragment B (277–389 aa), with each fragment containing 7 lysine residues (Supplemental Fig. S2). The methylated lysines were within b-catenin fragment A (151–276 aa), as demonstrated by an in vitro methylation assay (Fig. 3B). To further map the methylation sites, we performed a mass spectroscopy analysis of the methylated b-catenin fragment A (151–276 aa), and Lys180 (K180) was found to be monomethylated by SET7/9 (Supplemental Fig. S5). In addition, a mutagenesis assay that involved mutating Lys180 to arginine (K180R) in b-catenin fragment A (151–276 aa) was performed for the in vitro methylation analysis. As expected, the K180R mutation abolished SET7/9-mediated b-catenin methylation (Fig. 3C). Moreover, an in vitro methylation assay was performed with FL-b-catenin-WT or FL-b-catenin-K180R as the substrate. We found that FLb-catenin-K180R abolished methylation (Fig. 3D), a direct


SHEN ET AL.

Figure 2. SET7/9 methylates b-catenin in vitro and in vivo. A) An in vitro methylation assay was performed with 3H-SAM, recombinant SET7/9, and b-catenin. Autoradiography and CBB were used to show methylation and protein levels, respectively. B) Enzymatic activity of SET7/9 is necessary for the methylation of b-catenin. In vitro methylation with b-catenin and recombinant WT SET7/9 or an enzymatically inactive SET7/9-H297A mutant of SET7/9 was performed as indicated. IB analysis with an anti– pan-methyl-lysine antibody (pan-me-K) was used to detect the methylation of b-catenin. CBB was used to show the protein levels. C) SET7/9 methylates b-catenin in vivo. Stably expressed control, SET7/9-WT, or SET7/9-H297A HeLa cells were generated. The cell extracts were then precipitated with an anti–b-catenin antibody and probed with an anti–pan-me-K antibody to detect methylation of b-catenin. D) Knockdown of SET7/9 decreased the methylation levels of b-catenin. Stably expressed sh-Ctr or sh-SET7/9 HeLa cells were generated. The cell extracts were then precipitated with an anti–b-catenin antibody and probed with an anti–pan-me-K antibody to detect methylation of b-catenin.

result of the mutated lysine rather than a defect in the binding of this mutant to SET7/9, as FL-b-catenin-K180R bound to His-SET7/9 at a similar level as the FL-b-cateninWT (Supplemental Fig. S6A). To determine whether b-catenin Lys180 is methylated by SET7/9 in vivo, an antibody specific to b-catenin-K180me1 was generated. The efficiency and specificity of this antibody were evaluated and showed it to be sufficient for use in subsequent experiments (Supplemental Fig. S6B). With this specific antibody, the SET7/9-modulated methylation of b-catenin was confirmed primarily at Lys180, as demonstrated by overexpressing an myc-b-catenin-WT or myc-b-catenin-K180R with the SET7/9 plasmid, individually or in combination, in HeLa cells (Fig. 3E). To investigate whether the K180 methylation of b-catenin is induced by a physiologic stimulation, we treated HeLa cells with H2O2 at different doses, and the derived lysates were subjected to IP with an anti–b-catenin antibody followed by probing with an anti–b-catenin-K180-me1 (K180me1) antibody. The results indicate a significant H2O2dependent increase in b-catenin K180 methylation (Fig. 3F). Consistent with this result, the interaction between SET7/9 and b-catenin was significantly enhanced by H2O2 treatment (Fig. 3G, H). In addition, BBR, a chemical reagent that is a SET7/9 inducer (43), was delivered into HeLa-shCtr and HeLa-sh-SET7/9 cells, to determine the SET7/9 modulated methylation of b-catenin. After treatment with BBR at 25, 50, or 100 mM for 24 h, the derived lysates were subjected to IP with anti–b-catenin antibody followed by probing with anti–b-catenin-K180-me1 (K180-me1) antibody. There was an increase in b-catenin methylation in the HeLa-sh-Ctr cells, but not in the HeLa-sh-SET7/9 cells in response to treatment with BBR (Supplemental Fig. S6C). To clarify which cellular compartment of b-catenin SET7/9 METHYLATES b-CATENIN

was methylated, we prepared cytoplasmic and nuclear extracts from HeLa cells after treatment with H2O2 at 0.5 mM for 0.5 or 1 h. After treatment with H2O2, the methylation of b-catenin was increased in the cytoplasm, but not in the nucleus (Supplemental Fig. S6D), very likely because SET7/9 is found primarily in the cytoplasm. These results indicate that SET7/9 may regulate the cytoplasmic function of b-catenin. Taken together, the findings show that SET7/9 specifically methylates b-catenin at Lys180 in vitro and in vivo. Methylation of b-catenin by SET7/9 is associated with a decreased stability of b-catenin Lysine methylation is usually linked to the stability of nonhistone, including p53, ERa, RelA, DNMT1, FoxO3, and Sox2 (33–35, 37, 38, 41). Therefore, we examined whether the methylation of b-catenin by SET7/9 also affects the stability of b-catenin in cells. The coexpression of SET7/9 in HeLa cells down-regulated the expression of b-catenin-WT but not of b-catenin-K180R (Fig. 4A), which suggests that the SET7/9-mediated methylation of b-catenin may decrease its stability. In support of this notion, the coexpression of SET7/9 did not alter the mRNA levels of b-catenin (Fig. 4B). We also measured the half-life of b-catenin. The half-life of endogenous b-catenin was ;6 h in HeLa-sh-Ctr cells, but was prolonged dramatically in HeLa-sh-SET7/9 cells (Fig. 4C, D). To assess whether this change in the stability of b-catenin is associated with its methylation at Lys180, we compared the effect of SET7/9 on the half-life of b-catenin-WT and -K180R. The half-life of b-catenin-WT was reduced consistently from 3–6 h to ,3 h when b-catenin-WT was coexpressed with SET7/9 (Fig. 4E, 4317

Figure 3. b-Catenin is methylated at Lys180 in vitro and in vivo. A, B) The GST-b-catenin fragments indicated were incubated with SET7/9 and 3H-SAM for 1 h at 30°C. The samples were subsequently separated by SDS-PAGE, stained by CBB, or exposed by autoradiography. #, specific protein bands; NS, nonspecific bands. C) GST-b-catenin peptide (151–276 aa), with or without the Lys180 mutation were catalyzed by SET7/9 and analyzed as described in (A) and (B). #, specific protein bands. D) FL-GST-b-cateninWT or K180R was catalyzed by SET7/9 and analyzed as described in (A) and (B). E) An empty plasmid and an expression plasmid for myc-b-catenin-WT or myc-b-catenin-K180R were cotransfected, with or without Flag-SET7/9, into HeLa cells for 48 h. Western blot analysis was performed with an anti–b-catenin-K180-me1 antibody (K180-me1). F) Methylation of b-catenin Lys180 was increased in cells treated with H2O2. Proteins were extracted from HeLa cells treated with H2O2 at 0.5 mM for 0.5 or 1 h. The cell extracts were then precipitated with an anti–b-catenin antibody and probed with an anti–b-catenin-K180-me1 antibody (K180-me1). G, H ) HeLa cells were treated with H2O2, as described in (F ). The cell extracts were then precipitated with an anti–b-catenin antibody and probed with an anti-SET7/9 antibody. The relative intensity of the interaction between SET7/9 and b-catenin was quantified and is shown as a histogram. Data are means 6 SD (n = 3). *P , 0.05; **P , 0.01.

left, F; Supplemental Fig. S7A). In contrast, b-cateninK180R was more resistant to SET7/9-induced degradation, with a much longer half-life (.6 h) (Fig. 4E, right, F; Supplemental Fig. S7A). These collective findings show that the methylation of b-catenin at Lys180 by SET7/9 decreases the stability of b-catenin. The coexpression of SET7/9-WT, but not of SET7/9H297A, with myc-b-catenin in HeLa cells consistently down-regulated the expression of b-catenin (Supplemental Fig. S7B). Treatment with MG-132, a specific proteasome inhibitor, gradually reversed the expression level of b-catenin in a time-dependent fashion (Supplemental Fig. S7C) and stimulated the accumulation of b-catenin ubiquitination (Supplemental Fig. S7D, E), which suggests that 4318

Vol. 29

October 2015

the down-regulation of b-catenin is likely due to the SET7/ 9-induced ubiquitination and proteasome-mediated degradation of b-catenin. To reveal how the methylation of b-catenin influences its stability, we examined its binding capability with GSK3b (a phosphokinase and a negative regulator of Wnt signaling), by initiating b-catenin degradation (15, 17, 19, 20), in control or SET7/9-depleted cells. The interaction between GSK3b and b-catenin in SET7/9depleted cells was weaker than that observed in control cells (Fig. 4G). To further investigate the interaction between GSK3b and b-catenin, we performed a GST pulldown assay, by incubating GST-b-catenin-WT, methylated GST-b-catenin-WT (catalyzed by SET7/9), GST-b-cateninK180R (catalyzed by SET7/9), or GST with His-GSK3b.


SHEN ET AL.

Figure 4. SET7/9 reduces the stability of b-catenin. A) myc-b-catenin-WT or myc-b-catenin-K180R were cotransfected, with or without Flag-SET7/9, into HeLa cells for 48 h. Whole-cell lysates were examined by immunoblot, as indicated. B) Myc-b-cateninWT was cotransfected with or without Flag-SET7/9 or mutant Flag-SET7/9-H297A into HeLa cells for 48 h. Total RNA was extracted to detect the levels of b-catenin by real-time PCR. C) HeLa-sh-Ctr and HeLa-sh-SET7/9 cells were metabolically labeled with [35S]-methionine, followed by chasing with standard medium for the indicated periods. Cells were lysed and immunoprecipitated with anti–b-catenin antibody. D) Quantification analysis of endogenous b-catenin levels in (C ). E) HeLa cells were transfected with the expression vectors for Flag-b-catenin-WT or Flag-b-catenin-K180R, alone or together with SET7/9. At 24 h after transfection, cells were treated with cycloheximide (CHX) and examined for Flag. F ) A quantification analysis of the results in (E ). Data represent the average of 3 independent experiments. G) HeLa-sh-Ctr or HeLa-sh-SET7/9 stable cells were extracted and immunoprecipitated with anti–b-catenin antibody. IP with rabbit IgG was used as the negative control. Western blot analysis was performed with the antibodies indicated. H) GST, GST-b-catenin-WT, methylated GST-b-catenin-WT, and GSTb-catenin-K180R were incubated with His-GSK3b, and Western blot analysis was performed to detect the interaction between GSK3b and b-catenin.

GSK3b directly interacted with b-catenin, and the interaction between GSK3b and methylated b-catenin was stronger than the interaction between GSK3b and nonmethylated b-catenin (Fig. 4H). Consistent with these results, the phosphorylation of b-catenin was decreased in the HeLa-sh-SET7/9 cells (Supplemental Fig. S8A) and increased in the HeLa-SET7/9-WT cell line, but not in the HeLa-SET7/9-H297A cell line (Supplemental Fig. S8B). These findings indicate that the methylation of b-catenin promotes the interaction between GSK3b and b-catenin and down-regulates the stability of b-catenin. Knockdown of SET7/9 enhances the expression of c-Myc and cyclin D1 and promotes cell proliferation Because SET7/9 was negatively related to the stability of b-catenin, the effect of SET7/9 on the target genes of SET7/9 METHYLATES b-CATENIN

Wnt/b-catenin signaling was determined. The transcription of endogenous c-myc and cyclin D1, both of which are typical downstream targets of b-catenin (44–46), was upregulated in SET7/9 siRNA-treated HeLa cells (Fig. 5A). The protein levels of c-Myc and cyclin D1 were consistently up-regulated (Supplemental Fig. S9A). To investigate whether the increase in c-Myc and cyclin D1 occurs through Wnt/b-catenin signaling, we performed siRNA knockdown of SET7/9 and b-catenin, individually or in combination. The increase in c-Myc and cyclin D1 in SET7/9 siRNA-treated HeLa cells was abolished by b-catenin knockdown (Fig. 5B). Next, we established 4 stable HeLa cell lines expressing control shRNA, SET7/9 shRNA, and SET7/9 shRNA +siRNA-resistant SET7/9-WT or SET7/9-H297A plasmid (hereafter, these cell lines are referred to as HeLa-sh-Ctr, HeLa-sh-SET7/9, re-SET7/9-WT, or re-SET7/9-H297A); the SET7/9 and b-catenin protein levels are shown in 4319

Supplemental Fig. S9B. The number of colonies of HeLash-SET7/9 cells was significantly increased, whereas the number of colonies of re-SET7/9-H297A cells did not change compared with that of the re-SET7/ 9-WT cells (Fig. 5C, D). In addition, knockdown of b-catenin in the HeLa-sh-Ctr and HeLa-sh-SET7/ 9 cells caused the increase in the colony number of HeLa-sh-SET7/9 cells to be abolished (Fig. 5E, F). The protein levels of b-catenin and SET7/9 are shown in Supplemental Fig. S9C. The results showed that the up-regulation of SET7/9 in HeLa cells led to downregulation of cell proliferation. Moreover, to activate SET7/9, b-catenin-WT, or b-catenin-K180R, stable HeLa cells were treated with H2O2 or BBR. The b-cateninK180R HeLa cells were more resistant to the inhibition of cell proliferation induced by H2O2 or BBR (Fig. 5G, H; Supplemental Fig. S9D, E). Together, these data indicate that SET7/9 is associated with the inhibition of cell proliferation, which is partly due to the SET7/9-induced methylation of b-catenin K180.

DISCUSSION In the present study, we identified SET7/9 as a unique regulator of b-catenin stability. In light of our data, we present a model to hypothesize how SET7/9-mediated b-catenin methylation regulates cancer cell proliferation (Fig. 6). In response to H2O2 treatment, SET7/9 interacts with and methylates b-catenin at Lys180, which, in turn, interferes with the interaction of b-catenin and GSK3b and thus decreases the stability of b-catenin. The knockdown of endogenous SET7/9 by shRNA consistently decreased the methylation of b-catenin, but increased its half-life, thereby enhancing the expression of proliferation-related genes and ultimately leading to accelerated cell proliferation. Because SET7/9 does not modify nucleosomes, many studies have suggested that SET7/9 functions primarily as a nonhistone modifier (31, 32). In the current study, SET7/9 directly methylated b-catenin in vitro and in vivo (Fig. 2), which indicates that b-catenin is a newly identified substrate of SET7/9.

Figure 5. Knockdown of SET7/9 enhances the expression of Wnt target genes and promotes cell proliferation. A) The efficacy of SET7/9 siRNA in HeLa cells was determined by mRNA levels (3 left columns). Expression of total c-Myc and cyclin D1 mRNA was evaluated with real-time PCR as indicated by the columns. B) After HeLa cells were treated with siRNA of SET7/9 or b-catenin or double siRNA, Western blot analysis was performed with the indicated antibodies. C, E) The indicated cells were cultured in a 60 mm plate for 2 wk, and the number of formed clones was analyzed with crystal violet staining. D, F) Quantification of the results in (C) and (E). Error bars, SD (n = 3). *P , 0.05; **P , 0.01. G) Stably expressed b-catenin-WT or b-catenin-K180 HeLa cells were treated with H2O2 in the indicated conditions and cultured in a 60 mm plate for 2 wk, and the cloning formation was analyzed with crystal violet staining. H) Quantification of the results in (G). Error bars, SD (n = 3). *P , 0.05; **P , 0.01.

4320

Vol. 29

October 2015


SHEN ET AL.

The interaction between b-catenin and SET7/9 in HeLa cells was enhanced by H2O2 (Fig. 3G, H), which correlates with the methylation of b-catenin and suggests that SET7/9 affects the function of b-catenin during oxidative stress. As a well-studied tumor activator, b-catenin is known to be the target of many PTMs (6, 7), some of which contribute to the regulation of b-catenin protein stability. For example, the acetylation of b-catenin at Lys19 and Lys49 by PCAF stabilizes b-catenin by blocking the b-TrCP-dependent ubiquitination of b-catenin (26). In addition, the ubiquitination of b-catenin at Lys666 and Lys671 by seven in absentia homolog (Siah)-1 promotes the degradation of b-catenin (47), and the phosphorylation of b-catenin at residues 33, 37, and 41 by GSK3b reduces the stability of b-catenin (20). In this study, the finding that methylation of b-catenin at Lys180 by SET7/9 also reduced the stability of b-catenin (Fig. 4) provides additional information on the down-regulated stability of methylated b-catenin. In addition, the methylation of bcatenin represents a previously unidentified type of PTM that adds to the growing number of PTMs on this transcription factor that can regulate its stability. The interplay between PTMs that results in the fine tuning of the stability of b-catenin remains to be investigated in the future. Methylation of nonhistone proteins regulates their function through a variety of molecular mechanisms. One of the mechanisms is that the methylation of proteins may alter their interactions with DNA or with other proteins. For example, Lys270 monomethylation of FoxO3 suppresses transcription by interfering with the ability of FoxO3 to bind to DNA (36), and Lys370 and Lys382 monomethylation of p53 represses transcription

by reducing the ability of p53 to bind to DNA (48). In contrast, TAF10 methylation at Lys189 increases its interaction with RNA polymerase II (42). SIRT1 methylation induced by SET7/9 does not change its deacetylation activity, but induces the dissociation of SIRT1 from p53 and, in turn, increases p53 activity (40). Another popular explanation is the stability and altered activity of methylated proteins. For example, the methyltransferase activity of SUV39H1 is dramatically down-regulated when it is methylated by SET7/9 at Lys105 and Lys123 (39). In addition, the stability of DNMT1 is decreased by SET7/9-mediated methylation of Lys142 (41). Consistent with the latter case, Lys180 monomethylation of b-catenin by SET7/9 decreased the stability of b-catenin in this study (Fig. 4). In response to oxidative treatment, b-catenin/TCF transcriptional activity is usually regulated by a reactive oxygen species (ROS)-dependent cellular signaling pathway (49–51). However, the effects of H2O2 in b-catenin or Wnt target genes are controversial. For example, treatment of cells with a low dose of H2O2 for a short time (0.2 mM for 20 min) induces rapid stabilization of b-catenin and a concomitant increase in the expression of endogenous Wnt target genes (52). In contrast, some studies have shown that treatment of cells with H2O2 at a low dose for longer times (0.2 mM for several hours) inhibits Wnt/b-catenin signaling, although the mechanism of this inhibition is unclear (53–56). In the current study, treatment of cells with a relatively high dose of H2O2 (0.5 mM for 0.5–1 h) inhibited Wnt/b-catenin signaling through methylation of b-catenin by SET7/9. The differing outcome of oxidative treatment may be dependent on the ROS levels. When cells are treated with H2O2 at a low dose, ROS could act as a second messenger

Figure 6. The mechanism by which SET7/9 regulates b-catenin activity.


4321

to regulate the interaction of b-catenin and FOXO or TCF (54–56). However, high levels of ROS may induce an increase in the interaction of b-catenin and SET7/9, which would lead to the methylation of b-catenin and the down-regulation of b-catenin stability. SET7/9 dynamically interacts with diverse substrates in response to various stresses. In an earlier study, we found that when the colon cancer cell line HCT116 sustains DNA damage caused by Adr, the association between SET7/9 and SIRT1 is dramatically enhanced (40). Furthermore, the interaction between SET7/9 and SUV39H1 has been found to be highly dependent on Adr treatment (39). In addition, SET7/9 regulates the cell cycle or apoptosis by mediating retinoblastoma tumor suppressor protein (pRB) or E2F1 methylation (57, 58). As such, SET7/9 seems to be a potential transducer of external stress stimulation that signals and assists the cellular response to the negative stimulus. In summary, our data newly identifies a mechanism of transcriptional regulation of b-catenin that adds methylation to the list of PTMs of the protein. To our knowledge, this is the first study to reveal that b-catenin is a substrate for SET7/9 and to show a role for SET7/9-mediated lysine methylation in the regulation of b-catenin. Because protein methylation is a reversible modification mediated by methyltransferases and demethylases (59, 60), whether and how methylated b-catenin is subject to demethylation merits further exploration. This work was supported by National Key Basic Research Program of China Grants 2011CB504200 and 2013CB911000; National Natural Science Foundation of China Grants 31070691, 81321003, and 91319302; and Ministry of Education of China “111 Project.” The authors declare no conflicts of interest.

REFERENCES 1. Miller, J. R., and Moon, R. T. (1996) Signal transduction through beta-catenin and specification of cell fate during embryogenesis. Genes Dev. 10, 2527–2539 2. Cadigan, K. M., and Nusse, R. (1997) Wnt signaling: a common theme in animal development. Genes Dev. 11, 3286–3305 3. Peifer, M., and Polakis, P. (2000) Wnt signaling in oncogenesis and embryogenesis–a look outside the nucleus. Science 287, 1606–1609 4. Clevers, H. (2006) Wnt/beta-catenin signaling in development and disease. Cell 127, 469–480 5. Clevers, H., and Nusse, R. (2012) Wnt/b-catenin signaling and disease. Cell 149, 1192–1205 6. Valenta, T., Hausmann, G., and Basler, K. (2012) The many faces and functions of b-catenin. EMBO J. 31, 2714–2736 7. Kikuchi, A., Kishida, S., and Yamamoto, H. (2006) Regulation of Wnt signaling by protein-protein interaction and post-translational modifications. Exp. Mol. Med. 38, 1–10 8. Roura, S., Miravet, S., Piedra, J., Garc´ıa de Herreros, A., and Duñach, M. (1999) Regulation of E-cadherin/catenin association by tyrosine phosphorylation. J. Biol. Chem. 274, 36734–36740 9. Lilien, J., and Balsamo, J. (2005) The regulation of cadherinmediated adhesion by tyrosine phosphorylation/dephosphorylation of beta-catenin. Curr. Opin. Cell Biol. 17, 459–465 10. Hoschuetzky, H., Aberle, H., and Kemler, R. (1994) Beta-catenin mediates the interaction of the cadherin-catenin complex with epidermal growth factor receptor. J. Cell Biol. 127, 1375–1380 11. Condello, S., Cao, L., and Matei, D. (2013) Tissue transglutaminase regulates beta-catenin signaling through a c-Src-dependent mechanism. FASEB J. 27, 3100–3112

4322

Vol. 29

October 2015

12. Piedra, J., Miravet, S., Castaño, J., Pálmer, H. G., Heisterkamp, N., Garc´ıa de Herreros, A., and Duñach, M. (2003) p120 Cateninassociated Fer and Fyn tyrosine kinases regulate beta-catenin Tyr-142 phosphorylation and beta-catenin-alpha-catenin Interaction. Mol. Cell. Biol. 23, 2287–2297 13. Bustos, V. H., Ferrarese, A., Venerando, A., Marin, O., Allende, J. E., and Pinna, L. A. (2006) The first armadillo repeat is involved in the recognition and regulation of beta-catenin phosphorylation by protein kinase CK1. Proc. Natl. Acad. Sci. USA 103, 19725–19730 14. Brembeck, F. H., Schwarz-Romond, T., Bakkers, J., Wilhelm, S., Hammerschmidt, M., and Birchmeier, W. (2004) Essential role of BCL9-2 in the switch between beta-catenin’s adhesive and transcriptional functions. Genes Dev. 18, 2225–2230 15. Liu, C., Li, Y., Semenov, M., Han, C., Baeg, G. H., Tan, Y., Zhang, Z., Lin, X., and He, X. (2002) Control of beta-catenin phosphorylation/ degradation by a dual-kinase mechanism. Cell 108, 837–847 16. Xing, Y., Clements, W. K., Kimelman, D., and Xu, W. (2003) Crystal structure of a beta-catenin/axin complex suggests a mechanism for the beta-catenin destruction complex. Genes Dev. 17, 2753–2764 17. Behrens, J., Jerchow, B. A., Würtele, M., Grimm, J., Asbrand, C., Wirtz, R., Kühl, M., Wedlich, D., and Birchmeier, W. (1998) Functional interaction of an axin homolog, conductin, with betacatenin, APC, and GSK3beta. Science 280, 596–599 18. Amit, S., Hatzubai, A., Birman, Y., Andersen, J. S., Ben-Shushan, E., Mann, M., Ben-Neriah, Y., and Alkalay, I. (2002) Axin-mediated CKI phosphorylation of beta-catenin at Ser 45: a molecular switch for the Wnt pathway. Genes Dev. 16, 1066–1076 19. Hart, M. J., de los Santos, R., Albert, I. N., Rubinfeld, B., and Polakis, P. (1998) Downregulation of beta-catenin by human Axin and its association with the APC tumor suppressor, beta-catenin and GSK3 beta. Curr. Biol. 8, 573–581 20. Hart, M., Concordet, J. P., Lassot, I., Albert, I., del los Santos, R., Durand, H., Perret, C., Rubinfeld, B., Margottin, F., Benarous, R., and Polakis, P. (1999) The F-box protein beta-TrCP associates with phosphorylated beta-catenin and regulates its activity in the cell. Curr. Biol. 9, 207–211 21. Aberle, H., Bauer, A., Stappert, J., Kispert, A., and Kemler, R. (1997) beta-catenin is a target for the ubiquitin-proteasome pathway. EMBO J. 16, 3797–3804 22. Fang, D., Hawke, D., Zheng, Y., Xia, Y., Meisenhelder, J., Nika, H., Mills, G. B., Kobayashi, R., Hunter, T., and Lu, Z. (2007) Phosphorylation of beta-catenin by AKT promotes beta-catenin transcriptional activity. J. Biol. Chem. 282, 11221–11229 23. Wolf, D., Rodova, M., Miska, E. A., Calvet, J. P., and Kouzarides, T. (2002) Acetylation of beta-catenin by CREB-binding protein (CBP). J. Biol. Chem. 277, 25562–25567 24. Lim, J. H., Park, J. W., and Chun, Y. S. (2006) Human arrest defective 1 acetylates and activates beta-catenin, promoting lung cancer cell proliferation. Cancer Res. 66, 10677–10682 25. Lévy, L., Wei, Y., Labalette, C., Wu, Y., Renard, C. A., Buendia, M. A., and Neuveut, C. (2004) Acetylation of beta-catenin by p300 regulates beta-catenin-Tcf4 interaction. Mol. Cell. Biol. 24, 3404–3414 26. Ge, X., Jin, Q., Zhang, F., Yan, T., and Zhai, Q. (2009) PCAF acetylates beta-catenin and improves its stability. Mol. Biol. Cell 20, 419–427 27. Nishioka, K., Chuikov, S., Sarma, K., Erdjument-Bromage, H., Allis, C. D., Tempst, P., and Reinberg, D. (2002) Set9, a novel histone H3 methyltransferase that facilitates transcription by precluding histone tail modifications required for heterochromatin formation. Genes Dev. 16, 479–489 28. Wang, H., Cao, R., Xia, L., Erdjument-Bromage, H., Borchers, C., Tempst, P., and Zhang, Y. (2001) Purification and functional characterization of a histone H3-lysine 4-specific methyltransferase. Mol. Cell 8, 1207–1217 29. Wilson, J. R., Jing, C., Walker, P. A., Martin, S. R., Howell, S. A., Blackburn, G. M., Gamblin, S. J., and Xiao, B. (2002) Crystal structure and functional analysis of the histone methyltransferase SET7/9. Cell 111, 105–115 30. Xiao, B., Jing, C., Wilson, J. R., Walker, P. A., Vasisht, N., Kelly, G., Howell, S., Taylor, I. A., Blackburn, G. M., and Gamblin, S. J. (2003) Structure and catalytic mechanism of the human histone methyltransferase SET7/9. Nature 421, 652–656 31. Ivanov, G. S., Ivanova, T., Kurash, J., Ivanov, A., Chuikov, S., Gizatullin, F., Herrera-Medina, E. M., Rauscher III, F., Reinberg, D., and Barlev, N. A. (2007) Methylation-acetylation interplay activates p53 in response to DNA damage. Mol. Cell. Biol. 27, 6756–6769


SHEN ET AL.

32. Kurash, J. K., Lei, H., Shen, Q., Marston, W. L., Granda, B. W., Fan, H., Wall, D., Li, E., and Gaudet, F. (2008) Methylation of p53 by Set7/9 mediates p53 acetylation and activity in vivo. Mol. Cell 29, 392–400 33. Calnan, D. R., Webb, A. E., White, J. L., Stowe, T. R., Goswami, T., Shi, X., Espejo, A., Bedford, M. T., Gozani, O., Gygi, S. P., and Brunet, A. (2012) Methylation by Set9 modulates FoxO3 stability and transcriptional activity. Aging (Albany, N.Y.) 4, 462–479 34. Chuikov, S., Kurash, J. K., Wilson, J. R., Xiao, B., Justin, N., Ivanov, G. S., McKinney, K., Tempst, P., Prives, C., Gamblin, S. J., Barlev, N. A., and Reinberg, D. (2004) Regulation of p53 activity through lysine methylation. Nature 432, 353–360 35. Subramanian, K., Jia, D., Kapoor-Vazirani, P., Powell, D. R., Collins, R. E., Sharma, D., Peng, J., Cheng, X., and Vertino, P. M. (2008) Regulation of estrogen receptor alpha by the SET7 lysine methyltransferase. Mol. Cell 30, 336–347 36. Xie, Q., Hao, Y., Tao, L., Peng, S., Rao, C., Chen, H., You, H., Dong, M. Q., and Yuan, Z. (2012) Lysine methylation of FOXO3 regulates oxidative stress-induced neuronal cell death. EMBO Rep. 13, 371–377 37. Yang, X. D., Huang, B., Li, M., Lamb, A., Kelleher, N. L., and Chen, L. F. (2009) Negative regulation of NF-kappaB action by Set9mediated lysine methylation of the RelA subunit. EMBO J. 28, 1055–1066 38. Fang, L., Zhang, L., Wei, W., Jin, X., Wang, P., Tong, Y., Li, J., Du, J. X., and Wong, J. (2014) A methylation-phosphorylation switch determines Sox2 stability and function in ESC maintenance or differentiation. Mol. Cell 55, 537–551 39. Wang, D., Zhou, J., Liu, X., Lu, D., Shen, C., Du, Y., Wei, F. Z., Song, B., Lu, X., Yu, Y., Wang, L., Zhao, Y., Wang, H., Yang, Y., Akiyama, Y., Zhang, H., and Zhu, W. G. (2013) Methylation of SUV39H1 by SET7/9 results in heterochromatin relaxation and genome instability. Proc. Natl. Acad. Sci. USA 110, 5516–5521 40. Liu, X., Wang, D., Zhao, Y., Tu, B., Zheng, Z., Wang, L., Wang, H., Gu, W., Roeder, R. G., and Zhu, W. G. (2011) Methyltransferase Set7/9 regulates p53 activity by interacting with Sirtuin 1 (SIRT1). Proc. Natl. Acad. Sci. USA 108, 1925–1930 41. Estève, P. O., Chin, H. G., Benner, J., Feehery, G. R., Samaranayake, M., Horwitz, G. A., Jacobsen, S. E., and Pradhan, S. (2009) Regulation of DNMT1 stability through SET7-mediated lysine methylation in mammalian cells. Proc. Natl. Acad. Sci. USA 106, 5076–5081 42. Kouskouti, A., Scheer, E., Staub, A., Tora, L., and Talianidis, I. (2004) Gene-specific modulation of TAF10 function by SET9-mediated methylation. Mol. Cell 14, 175–182 43. Hu, H. Y., Li, K. P., Wang, X. J., Liu, Y., Lu, Z. G., Dong, R. H., Guo, H. B., and Zhang, M. X. (2013) Set9, NF-kB, and microRNA-21 mediate berberine-induced apoptosis of human multiple myeloma cells. Acta Pharmacol. Sin. 34, 157–166 44. He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da Costa, L. T., Morin, P. J., Vogelstein, B., and Kinzler, K. W. (1998) Identification of c-MYC as a target of the APC pathway. Science 281, 1509–1512 45. Tetsu, O., and McCormick, F. (1999) Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 398, 422–426


46. Shtutman, M., Zhurinsky, J., Simcha, I., Albanese, C., D’Amico, M., Pestell, R., and Ben-Ze’ev, A. (1999) The cyclin D1 gene is a target of the beta-catenin/LEF-1 pathway. Proc. Natl. Acad. Sci. USA 96, 5522–5527 47. Dimitrova, Y. N., Li, J., Lee, Y. T., Rios-Esteves, J., Friedman, D. B., Choi, H. J., Weis, W. I., Wang, C. Y., and Chazin, W. J. (2010) Direct ubiquitination of beta-catenin by Siah-1 and regulation by the exchange factor TBL1. J. Biol. Chem. 285, 13507–13516 48. Huang, J., Perez-Burgos, L., Placek, B. J., Sengupta, R., Richter, M., Dorsey, J. A., Kubicek, S., Opravil, S., Jenuwein, T., and Berger, S. L. (2006) Repression of p53 activity by Smyd2-mediated methylation. Nature 444, 629–632 49. Korswagen, H. C. (2006) Regulation of the Wnt/beta-catenin pathway by redox signaling. Dev. Cell 10, 687–688 50. Hoogeboom, D., and Burgering, B. M. (2009) Should I stay or should I go: beta-catenin decides under stress. Biochim. Biophys. Acta 1796, 63–74 51. Kajla, S., Mondol, A. S., Nagasawa, A., Zhang, Y., Kato, M., Matsuno, K., Yabe-Nishimura, C., and Kamata, T. (2012) A crucial role for Nox 1 in redox-dependent regulation of Wnt-beta-catenin signaling. FASEB J. 26, 2049–2059 52. Funato, Y., Michiue, T., Asashima, M., and Miki, H. (2006) The thioredoxin-related redox-regulating protein nucleoredoxin inhibits Wnt-beta-catenin signalling through dishevelled. Nat. Cell Biol. 8, 501–508 53. Shin, S. Y., Kim, C. G., Jho, E. H., Rho, M. S., Kim, Y. S., Kim, Y. H., and Lee, Y. H. (2004) Hydrogen peroxide negatively modulates Wnt signaling through downregulation of beta-catenin. Cancer Lett. 212, 225–231 54. Hoogeboom, D., Essers, M. A., Polderman, P. E., Voets, E., Smits, L. M., and Burgering, B. M. (2008) Interaction of FOXO with betacatenin inhibits beta-catenin/T cell factor activity. J. Biol. Chem. 283, 9224–9230 55. Essers, M. A., de Vries-Smits, L. M., Barker, N., Polderman, P. E., Burgering, B. M., and Korswagen, H. C. (2005) Functional interaction between beta-catenin and FOXO in oxidative stress signaling. Science 308, 1181–1184 56. Almeida, M., Han, L., Martin-Millan, M., O’Brien, C. A., and Manolagas, S. C. (2007) Oxidative stress antagonizes Wnt signaling in osteoblast precursors by diverting beta-catenin from T cell factor- to forkhead box O-mediated transcription. J. Biol. Chem. 282, 27298–27305 57. Munro, S., Khaire, N., Inche, A., Carr, S., and La Thangue, N. B. (2010) Lysine methylation regulates the pRb tumour suppressor protein. Oncogene 29, 2357–2367 58. Kontaki, H., and Talianidis, I. (2010) Lysine methylation regulates E2F1-induced cell death. Mol. Cell 39, 152–160 59. Bannister, A. J., and Kouzarides, T. (2005) Reversing histone methylation. Nature 436, 1103–1106 60. Klose, R. J., Gardner, K. E., Liang, G., Erdjument-Bromage, H., Tempst, P., and Zhang, Y. (2007) Demethylation of histone H3K36 and H3K9 by Rph1: a vestige of an H3K9 methylation system in Saccharomyces cerevisiae? Mol. Cell. Biol. 27, 3951–3961 Received for publication March 24, 2015. Accepted for publication June 22, 2015.

4323