Short Note Genetic relatedness provides support for a species ...

Animal Biology 65 (2015) 337–347

brill.com/ab

Short Note Genetic relatedness provides support for a species complex of myxosporeans infecting the Indian major carp, Labeo rohita Harpreet Kaur∗ and Aditya Gupta Department of Zoology and Environmental Sciences, Punjabi University, Patiala-147002, Punjab, India Submitted: July 19, 2015. Final revision received: September 10, 2015. Accepted: September 27, 2015

Abstract Myxozoans are an economically important group of microscopic metazoan parasites of fish. The myxozoan species Thelohanellus filli infects commercially important freshwater fish both in wild and in cultured habitat. This parasite causes gill hemorrhagic disease and significant damage to the respiratory surface of the infected fish. In the present study, the 18S rDNA gene sequence of morphologically identified T. filli infecting the gill lamellae of the Indian major carp, Labeo rohita, was characterized. This revealed that we are actually dealing with a species complex containing T. bifurcata, T. jiroveci and T. seni. Phylogenetically, T. filli clustered with other myxozoan parasites, with the species most closely related to T. filli having 96 to 97% sequence similarity. The intraspecific variation demonstrated in this study points towards the importance of newer approaches to facilitate reassessment of taxa and detecting species complexes and cryptic species. Keywords Indian major carp; Labeo rohita; molecular characterization; myxospores; phylogeny; Ranjit Sagar wetland; species complex; Thelohanellus filli

Introduction Myxozoans are an economically important group of microscopic metazoan parasites of fish harvested for food. Recently, many new myxosporean species have been described across the globe and there is substantial evidence that these parasites threaten general health and vigor of their fish hosts. Many myxozoan infections are relatively benign, but some species are highly pathogenic and cause great damage (Sitjà-Bobadilla & Alvarez-Pellitero, 1993; Sitjà-Bobadilla, 2008). More than 2700 ∗) Corresponding author; e-mail: [email protected] © Koninklijke Brill NV, Leiden, 2015

DOI 10.1163/15707563-00002479

338

H. Kaur and A. Gupta / Animal Biology 65 (2015) 337–347

species of Myxozoa have been described so far (Lom & Dyková, 2006), most of them occurring in teleosts (bony fish) while a small number of species have also been found parasitizing marine fishes, amphibians, reptiles and birds (Kent et al., 2001). Lom & Dyková (1992) listed 39 species under the genus Thelohanellus Kudo, 1933, and recently Zhang et al., 2013 provided a synopsis of 108 species all over the world. In India, Basu et al. (2006) and Kalavati (2007) listed 32 Indian species. More recently, many species have been described infecting freshwater fishes in wetlands and aquaculture in Punjab, India (Singh & Kaur, 2012a, b, c, d, 2014; Kaur, 2014; Kaur et al., 2014a, b; Kaur & Katoch, 2014; Singh & Kaur, 2015). Most recently, Basu et al. (2015) gave a summarized compilation of 32 species in India. These species infect various organs, such as gills, fins, scales, skin, muscles, gall bladder, kidney, and is the second most prevalent genus after Myxobolus Butschli, 1882 infecting freshwater fishes in natural and cultured habitat in India. In general, these species are mostly histozoic (within the tissues) and rarely coelozoic (in the body cavity). The identification of the genus is based on the spores, a propagative life cycle stage enclosed in pseudocyst/plasmodium. Members of the genus Thelohanellus Kudo, 1933 are characterized in having a shell with smooth valves and single polar capsule. According to Molnár (1994), some Thelohanellus species possess very strict host and tissue specificity compared to others and some species occur exclusively in carp fishes. Molecular biological methods have become increasingly applied to parasitological studies. Therefore, in this study we expanded the classical taxonomic classification of myxosporeans by incorporating a phylogenetic analysis based on a DNA marker sequence. For the identification of myxosporean species, information generated from DNA sequences accompanied with morphological traits helps to reveal diversity, intraspecific genetic variation, strains linked with geographical localities and species complexes (Atkinson et al., 2015). Material and methods Fresh specimens of Indian major carp, Labeo rohita, were collected from the local fish market at Ranjit Sagar wetland during the period from June 2014 to March 2015. The fish specimens were brought to the laboratory in an ice-box. The infected gills were removed with the help of forceps and placed in a petridish containing 0.9% saline. The pseudocysts were visible with the naked eye and appeared as creamish white pustules on the gills. The pseudocysts were teased apart on a clean slide to liberate spores and were examined under the microscope. Spores were measured with the help of a calibrated ocular micrometer. Gill Pseudocyst Index (GPI) was determined using the method given by Kaur & Attri (2015). It was determined based on number of pseudocysts counted under a stereozoom trinocular microscope on only one side of the gill of the fish examined (table 1).


339

Table 1. Parameters for the evaluation of Gill Pseudocyst Index (GPI). Number of pseudocyst per gill

GPI

0 1-5 5-10 10-20 20-50 or more

0 (no infection) 1 (light infection) 2 (moderate infection) 3 (heavy infection) 4 (severe infection)

State of welfare of animals The fishes were collected in fresh form from the fisherman at the wetland site and also from the local fish market near the wetland site. At the point of time when we started to work on the myxozoan parasites of freshwater fishes we approached Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCEA), Ministry of Environment, Forest and Climate Change, Government of India, for ethical clearance. The committee informed that CPCEA instruction’s protocol for experimentation on fishes does not require CPCEA approval. Molecular analysis The pseudocysts preserved in ethanol-fixed gills were teased apart with the help of a sharp needle in a watch glass containing double distilled water. The spores collected in the watch glass were transferred into 1.5 ml microcentrifuge tubes. The spores were suspended in 500 μl lysis buffer (100 mM NaCl, 10 mM Tris, 10 mM EDTA, 0.2% SDS, 0.4 mg/ml Proteinase K) and incubated overnight at 55°C. Then, 500 μl of phenol:chloroform (1:1) was added to the digested spores, mixed gently and centrifuged at 8000g for 5 min. The upper phase was transferred to a new tube and mixed with 2.5 times chilled isopropanol. The DNA was precipitated at −20°C overnight and pelleted by centrifugation at 12 000 g for 10 min. The pellet was washed once with 80% ethanol, air-dried for several minutes and suspended in 30 μl of 1× TE buffer. The product was then quantified in a Nanodrop (Thermo Scientific, Wilmington, USA) spectrophotometer at 180 ng/μl. The primers Myx1Forward (CTAATCCCGGTAACGAACGA), Myx1Reverse (CGTCCTCGCAACAAACTGTA) and Myx2Forward (TAATCCCGGTAACGA ACGAG), Myx2Reverse (CGTCCTCGCAACAAACTGTA) were used for the amplification of 18S rDNA using a Eppendorf Master Cycler Pro S. The PCR was carried out, according to Andree et al. (1999) at the final volume of 25 μl using the primers which amplified the fragments of 1838 bp of the 18S rDNA gene. The amplification reactions were conducted with 50 ng of genomic DNA, 12.5 μl of 1× reaction buffer (Himedia), 1.0 μl of each primers, 1.0 μl of total DNA and 10.5 μl of double purified water. Amplification was done by initial denaturation at 95°C

340


for 3 min, followed by 33 cycles of denaturation at 95°C for 30 s, annealing of primers at 58°C for 30 s, extension at 68°C for 1 min 20 s. The final extension was at 68°C for 10 min. The PCR products were analyzed on a 2% agarose gel containing 0.5 μg/ml ethidium bromide in 1× Tris-acetate-EDTA (TAE) buffer and size was estimated by comparison with the 100 bp Plus DNA Ladder. Following purification of amplified PCR product by EXO-SAP treatment, the DNA was quantified and subjected to automated DNA sequencing on ABI 3730x1 Genetic Analyzer. Sequencing was carried out using BigDye® Terminator v3.1 Cycle sequencing kit following the manufacturers’ instructions. Electrophoresis and data analysis were carried out on the ABI 3730x1 Genetic Analyzer. DNA sequencing A combination of primer sets enabled sequencing in both directions of 1838 bp of SSU rDNA of T. filli. Primer sets Myx1 and Myx2 successfully amplified the different regions of the 18S rRNA gene of size 1197 bp and 915 bp respectively. Phylogenetic analysis The phylogenetic analysis was done on a selection of 18S rDNA sequences that comprised the new sequence (KR34064) and 16 additional sequences from closely related sequences showing 87% homogeneity or above in NCBI GenBank database using the basic local alignment tool (BLAST; Fiala, 2006). Ceratonova shasta (AF001579) isolated from Onchorhynchus mykiss (Walbaum) was taken as an outgroup. Genetic distance analyses were conducted using the Kimura 2-parameter model (Kimura, 1980) in MEGA6 software (Tamura et al., 2013). Included codon positions were 1st + 2nd + 3rd + Noncoding. All positions containing gaps and missing data were eliminated. The Bayesian phylogenetic analysis was conducted using MrBayes v3.2.2 (Ronquist & Huesenbeck, 2003). Sequence alignment was performed by Multiple Sequence Comparison by Log-Expectation (MUSCLE). The tree was generated using Maximum Likelihood having 1000 bootstrap values and was proportional to the number of substitutions per site. Results and discussion Morphometric results Of the total of 20 major carps screened, 10 were found to be heavily infected. The infection rate was 50% with Gill Pseudocyst Index (GPI) as 2 indicating moderate infection. The isolated pseudocysts were small, elongated and appeared as creamish white pustules on the gills. The spores measured 25.66-28.50 (27.08 ± 2.13) μm in length (LS) and 10.12-11.00 (10.56 ± 0.55) μm in width (WS). The spores were histozoic, large, elongate pyriform in valvular view, tapering anteriorly with bluntly pointed anterior end and broad rounded at the posterior end (table 2, figs. 1 and 2).

341


Table 2. Measurements (μm) and ratio of Thelohanellus filli isolated from gills of Labeo rohita (measurements in μm), where SD stands for standard deviation and CV for coefficient of variance. Characters Length of spore (LS) Width of spore (WS) Length of polar capsule Width of polar capsule LS/WS Number of coils Parietal folds

Range

Mean values

SD

CV

25.66-28.50 10.12-11.00 16.26-17.00 8.00-8.50

27.08 10.56 16.63 8.25 2.56 12-14 absent

2.13 0.55 2.03 0.81

7.86 5.20 12.20 9.81

Molecular comparison The primers Myx1 and Myx2 were used to amplify two different regions of the 18S rRNA gene of T. filli. The sequences of the two regions covered 1197 and 915 bp, respectively (see online supplementary file 1), and the resulting 1838 bp sequence was deposited in NCBI GenBank under the accession number KR340464. The BLAST analysis (edited consensus tree) showed the clustering of T. filli with other myxozoans having between 87-97% homogeneity. The most closely related species on the basis of this molecular phylogeny were T. bifurcata (Accession number KJ476886) and T. jiroveci (Accession number KJ476885) with 97% homology. They represent a paraphyletic relation with T. filli, which may be explained by the fact that they are histozoic parasites found in gills of fish present in the same geographical location (table 3).

Figure 1. Fresh spores of gill infecting Thelohanellus filli (1000×) from Indian major carp, Labeo rohita.

342


Figure 2. Line drawing of spores of Thelohanellus filli showing frontal view (A) and sutural view (B).

Discussion The sequence characterization of T. filli, and the phylogenetic analysis including T. bifurcata, T. jiroveci and T. seni support the existence of a species complex of these myxosporeans infecting the gills of the Indian major carp, Labeo rohita. Features such as tissue tropism, host, organ and geographical location are important in species identification for myxozoans. Moreover, recently molecular data based on the comparison of 18S rRNA gene sequences have been used (Kent et al., 2001; Liu et al., 2011; Seo et al., 2012; Zhu et al., 2012; Shin et al., 2013; Mondal et al., 2014). The closely related species analyzed so far were morphologically quite similar to the present species, however morphometric characters were different. Furthermore, a neighbour joining phylogenetic tree based on 18S rDNA indicates that there is correlation with spore morphology, host specificity and tissue tropism as well. Morphologically, T. filli Kaur et al., 2014 (27.08 × 10.56) closely resembled T. bifurcata Basu & Haldar, 1999 (34.89 × 9.21), T. jiroveci Kundu & Haldar, 1981 (16.3 × 6.8) and T. seni Chakravarty & Basu, 1948 (13.71 × 8.56) but differed in the size of spores. Estimates of evolutionary pair-wise divergence among the sequences of T. filli, T. bifurcata, T. jiroveci, and T. seni were measured (Kimura 2-parameter) as nil (0.00), whilethe distance from T. rohitae Chakravarty, 1943 was minimal (0.02; see online supplementary file 2). This was exhibited by the fact that T. filli clustered phylogenetically with T. bifurcata and T. jiroveci and then with other Thelohanellus species in a well-supported group (fig. 3). The length of the branches of T. filli, T. bifurcata and T. jiroveci in the phylogenetic tree, determined by a little variability among their rDNA sequences, supports that they represent a species complex (Atkinson et al., 2015). The divergence from T. catlae was measured as 0.12 and 0.36 from Ceratonova shasta (outgroup).

Accession number

KJ476886 KJ476885 KJ476884 HM624024 HQ613410 GU165832 GQ396677 DQ231155 DQ231156 KM252682 KC843624 JX458816 KM252687 KJ561441 DQ439810 AF001579

Myxozoan

T. bifurcata T. jiroveci T. seni T. kitauei T. wuhanensis T. nikolskii T. kitauei T. hovarkai T. nikolskii T. rohitae T. sp. T. sp. T. catlae M. tsangwuensis M. cycloides C. shasta

gills gills gills intestine skin fins and scales intestine abdomen fins gills skin gills gills gills swim bladder intestinal tissues

Organ infected Labeo rohita Labeo rohita Labeo rohita Cyprinus carpio nudus Carassius auratus gibelio Cyprinus carpio Cyprinus carpio Cyprinus carpio Cyprinus carpio Labeo rohita Carassius auratus gibelio Carassius auratus gibelio Catla catla Cyprinus carpio Leuciscus cephalus Oncorhynchus mykiss

Host 99 99 99 95 95 95 84 81 70 59 67 77 49 99 83 26

Query cover

97 97 96 89 89 87 88 88 89 93 91 90 89 89 87 84

Homogeneity (%) to Thelohanellus filli

Table 3. Homogeneity of 18S rRNA gene sequences of Thelohanellus filli (Accession number KR340464) and other myxobolids available in NCBI GenBank.


343

344


Figure 3. Phylogenetic tree generated by Maximum Likelihood of the 18S rRNA gene sequences of Thelohanellus filli (Accession number KR340464) and other related species. Bootstrap confidence values are shown at nodes (1000 replications). Scale bar: amount of inferred evolutionary change along the branch lengths.

In order to estimate the pattern of nucleotide substitution involving 17 nucleotide sequences, we used the GTR + G model. Rates of different nucleotide substitution (r) from one base (transitional – in bold) and to another base (transversional – in italics) were assessed. The nucleotide frequencies were 27.36% (A), 23.89 (T/U), 20.25% (C) and 28.50% (G). All positions containing gaps and missing data were eliminated. There were a total of 641 positions in the final dataset (table 4). These observations are regarded to be in conformity with those of earlier studies, espeTable 4. Transitional and transversion substitutions obtained by maximum likelihood estimate of substitution matrix in Mega 6.0 (rates of different transitional substitutions are shown in bold and those of transversion substitutions are shown in italics). Maximum composite likelihood estimate of the pattern of nucleotide substitution A T C G

A – 4.64 4.64 13.67

T 4.05 – 20.66 4.05

C 3.43 17.51 – 3.43

G 14.24 4.83 4.83 –


345

cially the one of Molnár (2002) according to whom members of the genus Thelohanellus were characterized by strict tissue specificity and those showing affinity to the epithelium, connective tissue, cartilage or vascular tissue usually occurred in a strictly defined location within the gill apparatus. SSu rRNA gene sequences have been widely used for inferring phylogenetic relationship within genera and authenticating distinct species or species complexes. Several myxozoan genera have been regarded as species complexes which often may be comprised of cryptic species (Bartošová-Sojková et al., 2014; Hartikainen et al., 2014). Further investigations are being carried out on the presence of other gill-infecting myxozoan parasites infecting Indian major carps in polyculture condition. This is important to have clarity in the assessment of the impact of these parasites on the carp fishes. Genetic data available can form the basis for development of diagnostics of this species complex. It is, therefore, concluded that myxozoan gill infections can be detrimental for the fish industry in this part of the globe and newer approaches are needed to reveal the strains, species complexes and cryptic species within the same geographical locations, host, organ and tissue location. Acknowledgements The authors acknowledge for providing financial support by University Grants Commission (UGC), Govt. of India in the form of Major Research Project (MRP). There is no conflict of interest among the authors and present work has not been published before in any form. References Andree, K.B., Székely, C., Molnár, K., Gresoviac, S.J. & Hedrick, P.P. (1999) Relationships among member of the genus Myxobolus (Myxozoa: Bivalvidae) based on small subunit ribosomal DNA sequences. J. Parasitol., 85, 68-74. Atkinson, S.D., Bartošová-Sojková, P., Whipps, C.M. & Bartholomew, J.L. (2015) Approaches for characterising Myxozoan species. In: Okamura, B. et al. (Eds.) Myxozoan Evolution, Ecology and Development, pp. 111-123. Springer International Publishing, Switzerland. Bartošová-Sojková, P., Hrabcová, M., Pecková, H., Patra, S., Kodádková, A., Jurajda, P., Tyml, T. & Holzer, A.S. (2014) Hidden diversity and evolutionary trends in malacosporean parasites (Cnidaria: Myxozoa) identified using molecular phylogenetics. Int. J. Parasitol., 44, 565-577. Basu, S., Modak, B.K. & Haldar, D.P. (2006) Synopsis of the Indian species of the genus Thelohanellus Kudo, 1933 along with description of Thelohanellus disporomorphus sp. n. J. Parasit. Dis. Appl. Anim. Biol., 15, 81-94. Basu, S., Modak, B.K. & Haldar, D.P. (2015) Biological diversity of Thelohanellus Kudo, 1933 (Myxozoa: Myxosporea: Bivalvulida) parasitizing freshwater fishes of Indian subcontinent. J. Env. Sociobiol. (online), 0, 26-27, http://www.i-scholar.in/index.php/JESEBA/article/view/62155. Fiala, I. (2006) The phylogeny of Myxosporea (Myxozoa) based on small subunit ribosomal RNA gene analysis. Int. J. Parasitol., 36, 1521-1534. Hartikainen, H., Gruhl, A. & Okamura, B. (2014) Diversification and repeated morphological transitions in endoparasitic cnidarians (Myxozoa: Malacosporea). Mol. Phylogenet. Evol., 76, 261-269.

346


Kalavati, C. & Nandi, N.C. (2007) Handbook of Myxosporidean Parasites of Indian Fishes. ZSI, India, Kolkata, 293 pp. Kaur, H. (2014) A rewiew article – Myxozoan infestation in freshwater fishes in wetlands and aquaculture in Punjab (India). Adv. Anim. Vet. Sci., 2, 488-502. Kaur, H. & Attri, R. (2015) Prevalence and tissue specificity of Myxobolus saugati Kaur and Singh, 2011 (Myxozoa; Myxosporea; Bivalvulida) causing dermal myxoboliosis in wild and cultured Indian major carps in Punjab. Species, 15, 14-18. Kaur, H. & Katoch, A. (2014) Gill disease caused by Thelohanellus bifurcata Basu and Haldar, 1999 a pathogenic myxozoan parasite in cultured Indian carp, Labeo rohita (Hamilton, 1822) in Punjab, India. J. Anim. Health. Prod., 2, 19-24. Kaur, H., Dar, S.A. & Katoch, A. (2014a) Thelohanellus dykovi sp. nov. (Myxozoa: Bivalvulidae), a pathogenic gill parasite in cultured Indian major carp, Labeo rohita (Hamilton 1822) in Punjab (India). Species, 10, 24-30. Kaur, H., Katoch, A. & Gupta, M. (2014b) Thelohanellus filli sp. n., a pathogenic myxosporean infecting gills of cultured carp, Labeo rohita (Hamilton 1822) in Punjab, India. Species, 10, 31-38. Kent, M.L., Andree, K.B., Bartholomew, J.L., El-Matbouli, M., Desser, S.S., Devlin, R.H., Feist, S.W., Hedrick, R.P., Hoffmann, R.W., Khattra, J., Hallett, S.L., Lester, R.J.G., Longshaw, M., Palenzeula, O., Siddall, M.E. & Xiao, C. (2001) Recent advances in our knowledge of the Myxozoa. J. Euk. Microbiol., 48, 395-413. Kimura, M. (1980) A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol., 16, 111-120. Liu, Y., Whipps, C.M., Liu, W.S., Zeng, L.B. & Gu, Z.M. (2011) Supplemental diagnosis of a myxozoan parasite from common carp Cyprinus carpio: synonymy of Thelohanellus xinyangensis with Thelohanellus kitauei. Vet. Parasitol., 178, 355-359. Lom, J. & Dyková, I. (1992) Protozoan Parasites of Fishes. Development in Aquaculture and Fisheries, pp. 159-235. Elsevier, Amsterdam. Lom, J. & Dyková, I. (2006) Myxozoan genera: definition and notes on taxonomy, life-cycle terminology and pathogenic species. Folia Parasitologica, 53, 1-36. Molnár, K. (1994) Comments on the host, organ and tissue specificity of fish myxosporeans and on the types of their intrapiscine development. Parasitologica Hungarica, 27, 5-20. Molnár, K. (2002) Site preference of fish myxosporean in the gill. Dis. Aqua. Org., 78, 147-153. Mondal, A., Banerjee, S., Patra, A., Adikesavalu, H., Ramudu, K.R., Dash, G., Joardar, S.N. & Abraham, T.J. (2014) Molecular and morphometric characterization of Thelohanellus caudatus (Myxosporea: Myxobolidae) infecting the caudal fin of Labeo rohita (Hamilton). Protistology, 8, 41-52. Ronquist, F. & Huelsenbeck, J.P. (2003) Bayesian phylogenetic inference under mixed models. Biogeosciences, 19, 1572-1574. Seo, J.S., Jeon, E.J., Kim, M.S., Woo, S.H., Kim, J.D., Jung, S.H., Park, M.A., Jee, B.Y., Kim, J.W., Kim, Y.C. & Lee, E.H. (2012) Molecular identification and real-time quantitative PCR (qPCR) for rapid detection of Thelohanellus kitauei, a myxozoan parasite causing intestinal giant cystic disease in the Israel carp. Korean J. Parasitol., 50, 103-111. Shin, S.P., Kim, J.H., Choresca, Jr. C., Han, J.E., Jun, J.W. & Park, S.C. (2013) Molecular identification and phylogenetic characterisation of Thelohanellus kitauei. Acta Vet. Hungarica, 61, 30-35. Singh, R. & Kaur, H. (2012a) Biodiversity of myxozoan parasites infecting freshwater fishes of three main wetlands of Punjab, India. Protistology, 7, 79-89. Singh, R. & Kaur, H. (2012b) Thelohanellus (Myxozoa: Myxosporea: Bivalvulida) infections in major carp fish from Punjab wetlands (India). Protistology, 7, 178-188.


347

Singh, R. & Kaur, H. (2012c) Myxosporean species of the genus Thelohanellus Kudo, 1933 (Myxozoa: Myxosprea: Bivalvulida) from freshwater fishes of Punjab wetlands, India. Protistology, 7, 208-217. Singh, R. & Kaur, H. (2012d) Two new Thelohanellus Kudo, 1933 (Myxozoa: Myxosprea: Bivalvulida) infecting fins of major carps in wetlands of Punjab. Trends Parasitol. Res., 1, 34-43. Singh, R. & Kaur, H. (2014) Two new and two already known species of genus Thelohanellus Kudo, 1933 (Myxozoa: Myxosporea: Bivalvulida) infecting Indian major carp fishes in Punjab wetlands (India). J. Parasitic Dis., 38, 49-60. Singh, R. & Kaur, H. (2015) Two new and one already known species of the genus Thelohanellus Kudo, 1933 (Myxozoa: Myxosporea: Bivalvulida) parasitizing fresh water fishes in wetlands of Punjab, India. Biologia, 70, 85-93. Sitjà-Bobadilla, A. (2008) Fish immune response to myxozoan parasites. Parasite, 15, 420-425. Sitjà-Bobadilla, A. & Alvarez-Pellitero, P. (1993) Pathologic effects of Sphaerospora dicentrarchi Sitjà-Bobadilla and Alvarez Pellitero, 1992 and S. testicularis Sitjà-Bobadilla and Alvarez Pellitero, 1990 (Myxosporea: Bivalvulida) parasitic in the Mediterranean sea bass Dicentrarchus labrax L. (Teleostei: Serranidae) and the cell-mediated immune reaction: a light and electron microscopy study. Parasitol. Res., 79, 119-129. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar, S. (2013) MEGA6: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol., 28, 2731-2739. Zhang, J.Y., Gu, Z.M., Kalavati, C., Eiras, J.C., Liu, Y., Guo, Q.Y. & Molnar, K. (2013) A synopsis of the species of Thelohanellus Kudo, 1933 (Myxozoa: Myxosporea: Bivalvulida). Sys. Parasitol., 86, 235-256. Zhu, Y.T., Lu, H.D. & Cai, S.J. (2012) Redescription of Thelohanellus wuhanensis Xiao et Chen (Myxozoa, Myxosporea) infecting allogynogenetic crusian carp (Carassius auratus gibelio) and phylogenetic analysis based on 18S rDNA sequence. Acta Zootaxa Sinica, 37, 681-686.