Short Technical Reports pBINPLUS/ARS: an improved plant transformation vector based on pBINPLUS William R. Belknap, David R. Rockhold, and Kent F. McCue USDA Agricultural Research Service, Albany, CA, USA BioTechniques 44:753-756 (May 2008) doi 10.2144/000112731
Binary plant transformation vectors are widely used for introduction of transgenes into plants via Agrobacterium tumefaciens-mediated transformation. We report the construction of a binary plant vector pBINPLUS/ARS based on the pBINPLUS vector. Improvements introduced into pBINPLUS/ARS include the use of nonproprietary (ubiquitin-3 gene of Solanum tuberosum) promoter and terminator sequences for transcription of the NptII selectable marker and introduction of rare 8-bp restriction enzyme sites flanking both the NptII coding sequence (PmeI) and the entire selectable marker gene (FseI). This vector offers all of the advantages of its predecessor pBINPLUS and its helper plasmid pUCAP, which use the proprietary nopaline synthase promoter and terminator, while allowing for facile modification of selectable marker sequences in complex binary vector constructs. pBINPLUS/ARS has been used to introduce transgenes into potato and other crop species and is available to all researchers in academic, government, and industrial laboratories for proof-of-principle and commercial applications.
INTRODUCTION pBINPLUS (1) is a widely used binary plant transformation vector. Improvements introduced into pBINPLUS relative to the pBIN19 vector (2) on which it was based included alteration of the position of the NptII selectable marker relative to the multiple cloning site and introduction of an improved Escherichia coli origin of replication and rare restriction sites flanking the multiple cloning site. A limitation of pBINPLUS in applied research programs is the inclusion of proprietary sequences to direct transcription of the selectable marker (3). The use of nonproprietary sequences to control expression of the selectable marker, such as those from the potato Ubi3 gene (4), would facilitate use of the vector in applied research programs as opposed to protected sequences (5). Also, because of both experimental and intellectual property limitations, a variety of selectable markers have been used in binary vectors (6–8). The introduction of separate rare restriction sites bordering the selectable marker coding sequence and the entire marker gene would provide added flexibility by allowing modification of this domain Vol. 44 ı No. 6 ı 2008
in completed binary constructs. For example, a binary construct containing multiple (stacked) transgenes to confer a complex phenotype could be easily modified for applications requiring alternative selectable markers. MATERIALS AND METHODS Construction of the Unique FseI Site for Selectable Marker Sequences The pBINPLUS/ARS vector (GenBank accession no. DQ320121) was constructed by modification of pBINPLUS. pBINPLUS contains unique ClaI and NruI restriction enzyme sites flanking the selectable marker gene and the left border sequence (Figure 1). The first step in construction was to generate a PCR product containing the left border flanked by ClaI and NruI restriction sites. This was accomplished by PCR amplification from pBINPLUS using primers that amplify the sequence from the 5′ end of the left border to the NruI site. The primer 5′ to the left border (5′-CCCA TCGATGGCCGGCCCAGTACATT AAAAACGTCCGCAATGTGT-3′) was designed to introduce ClaI and
Figure 1. Construction of pBINPLUS/ARS from pBINPLUS. The ClaI/NruI fragment of pBINPLUS containing the left border and NptII selectable marker was replaced with a PCR product generated from pBINPLUS. The resulting intermediate plasmid pBINPLUS (-sel) contains the identical left border to NruI sequence as pBINPLUS with the selectable marker replaced with an FseI site. The potato Ubi3 promoter and terminator, with an internal PmeI site, were cloned into the FseI restriction site. Finally, the NptII gene from pBINPLUS, modified to contain flanking PmeI sites, was introduced into this vector resulting in the final pBINPLUS/ARS construct. MCS, multiple cloning site.
www.biotechniques.com ı BioTechniques ı 753
Table 1. Transgenic Plants Regenerated Using pBINPLUS/ARS Plant
Cultivar
Transgenea
Reference
Potato
Lenape, Desirée
Sgt1
12
Lenape, Desirée
Sgt2
13
Lenape, Desirée
Sgt3
14
MSE149-5Y
RB
15
Kufri Badshah
cry1Ab
Kumar, Mb
Tobacco
Xanthi
GFP
16
Tomato
Ventura
TBI-HBsAg
17, 18
Ailsa Craig
GUS
19
Moneymaker
-
A. Kloekb
Col-O
-
A. Kloekb
-
GUS
C. Bassettb
Royal Gala
GUS
20
Malling26
Eop1, AvrRpt2ea
J. Norellib
N6-5
-
C. Mau & C. McMahanb
Connecting. Informing. Advancing. For 25 Years.
Arabidopsis
Apple
Guayule a
Reporter gene or enzyme Personal communication. GFP, green fluorescence protein, GUS, beta-glucuronidase. b
Is this someone else’s copy you are reading? Maybe it’s time you get your own copy of BioTechniques, or maybe your subscription has expired. Don’t worry, either way, you can subscribe or renew to BioTechniques. Go to: www.biotechniques.com/subscribe
Figure 2. Nucleotide sequence of the junction of the chimeric Ubi3-ubiquitin-NptII NptII translational fusion construct. The junction site is indicated by a plus (+), the processing site for the polyprotein is indicated by an asterisk (*), and the PmeI restriction enzyme recognition site is bold and underlined.
FseI sites upstream of the left border sequence when used with a primer (5′-CATCGGAGCGGGTTTAACCTAC-3′) flanking the NruI site. The resulting 689-bp PCR product was cloned into pCR2.1 using the TA Cloning kit (Invitrogen, Carlsbad, CA, USA). pBINPLUS was digested with ClaI and NruI and phosphatased, and the 689-bp left border PCR product was cloned into the plasmid. The resulting intermediate vector, pBINPLUS-sel contains a unique FseI site for introduction of selectable marker gene sequences (Figure 1). Construction of NptII Under Transcriptional Regulation of the Ubiquitin-3 Control Elements The desired selectable marker gene for insertion into the FseI site of pBINPLUS-sel contained a Ubi3(promoter)-NptII-Ubi3(term-
inator) bounded by FseI restriction sites and with PmeI sites adjacent to the NptII gene to permit replacement of the reporter gene without requiring extensive modification of the binary plasmid. The selectable marker gene was constructed in three segments. First, the previously characterized potato Ubi3 promoter and ubiquitin coding region (4) was used as a template for PCR amplification using primers designed to add a 5′ FseI site (5′-GATCGGCCGGCCATACTTATCGATTTAAAT-3′) and a 3′ PmeI site (5′-TCGAGTTTAAACCTTCGCCT GGAGGAGAGAAATC-3′). Second, the NptII gene from pBINPLUS was amplified using primers to introduce PmeI sites at both the 5′ (5′-GAAATT TCATGATTGAACAAGATGGATT GC-3′) and 3′ (5′-GATCGTTTAAAC AGATCCCGTGGGCGAAGAAC-3′) ends. The 5′ primer was designed such that the NptII coding sequence would be introduced in frame with the
Short Technical Reports
ubiquitin monomer (Figure 2) (4). The resulting translational fusion is processed such that the NPTII protein has an N-terminal residue (serine) with stabilizing properties similar to the methionine of authentic NPTII (9). The resulting PCR product was cloned into pCR2.1 using the TA Cloning kit. The polyadenylation signal of Ubi3 (4) was amplified in a similar manner using primers (5′-GATCCAAATTTT GATTTTAATGTTTAGCAAATG-3′ and 5′-TCGAGGCCGGCCAATA GTCTCGACAGACACATAGC-3′) to introduce PmeI and FseI sites to the 5′ and 3′ ends, respectively. The resulting PCR products were cloned into pCR2.1.
plasmid is available to all researchers in academic, government, and industrial laboratories. ACKNOWLEDGMENTS
The authors acknowledge funding by the Agricultural Research Service National Programs [Current Research Information System (CRIS) Project no. 5325-21420-001-00D]. COMPETING INTERESTS STATEMENT
The authors declare no competing interests.
Assembly of pBINPLUS/ARS To construct pBINPLUS/ARS, pBINPLUS-sel was digested with FseI, phosphatased, and ligated with combined FseI/PmeI fragments from the above Ubi3 promoter and terminator pCR2.1 clones. The resulting intermediate plasmid contained the Ubi3 promoter/terminator sequences flanking a unique PmeI site into which the NptII PCR product described above was cloned. The resulting pBINPLUS/ARS plasmid was verified by sequence analysis of the region containing the selectable marker and left border. RESULTS AND DISCUSSION To evaluate pBINPLUS/ARS in potato, the vector containing an antisense solanidine glycosyltransferase gene (10) was introduced into potato via Agrobacterium-mediated transformation as described previously (4,11). A transformation using 100 microtuber discs yielded 38 transgenic lines that actively expressed NPTII and the antisense transgene (10), an efficiency similar to that using vectors with other selectable markers (11). The pBINPLUS/ARS has been successfully used to introduce constructs into potato (12–14), tobacco (16), and tomato (17,18). It is currently being used for transformation in laboratories around the world in both model systems and additional crop species (Table 1). The pBINPLUS/ARS 756 ı BioTechniques ı www.biotechniques.com
REFERENCES 1. van Engelen, F.A., J.W. Molthoff, A.J. Conner, J.P. Nap, A. Pereira, and W.J. Stiekema. 1995. pBINPLUS—an improved plant transformation vector based on pBIN19. Transgenic Res. 4:288-290. 2. Bevan, M. 1984. Binary Agrobacterium vectors for plant transformation. Nucleic Acids Res. 12:8711-8721. 3. Rogers, S.G. and R.T. Fraley, inventors. Monsanto Co., assignee. Chimeric genes suitable for expression in plant cells. U.S. patent no. 5,034,322. 1991 July 23. 4. Garbarino, J.E. and W.R. Belknap. 1994. Isolation of a ubiquitin-ribosomal protein gene (ubi3) from potato and expression of its promoter in transgenic plants. Plant Mol. Biol. 24:119-127. 5. McPherson, J. and R. Kay, inventors. Monsanto Co., assignee. DNA sequence for enhancing the efficiency of transcription. U.S. patent no. 5,322,938. 1994 June 21. 6. Jones, J.D., L. Shlumukov, F. Carland, J. English, S.R. Scofield, G.J. Bishop, and K. Harrison. 1992. Effective vectors for transformation, expression of heterologous genes, and assaying transposon excision in transgenic plants. Transgenic Res. 1:285-297. 7. McCormac, A.C., M.C. Elliott, and D.F. Chen. 1997. pBECKS. A flexible series of binary vectors for Agrobacterium-mediated plant transformation. Mol. Biotechnol. 8:199-213. 8. Hellens, R.P., E.A. Edwards, N.R. Leyland, S. Bean, and P.M. Mullineaux. 2000. pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol. Biol. 42:819-832. 9. Varshavsky, A. 1992. The N-end rule. Cell 69:725-735. 10. McCue, K.F., D.L. Corsini, P.V. Allen, D.R. Rockhold, M.M. Maccree, L.V. Shepherd, C.P. Moehs, P. Joyce, et al. 2003. Reduction of total steroidal glycoalkaloids in potato tubers using antisense constructs of a gene encoding a solanidine glucosyl transferase. Acta Hortic. 619:77-86.
11. Snyder, G.W. and W.R. Belknap. 1993. A modified method for routine Agrobacteriummediated transformation of in vitro grown potato microtubers. Plant Cell Rep. 12:324-327. 12. McCue, K.F., L.V. Shepherd, P.V. Allen, M.M. Maccree, D.R. Rockhold, D.L. Corsini, H.V. Davies, and W.R. Belknap. 2005. Metabolic compensation of steroidal glycoalkaloid biosynthesis in transgenic potato tubers: using reverse genetics to confirm the in vivo enzyme function of a steroidal alkaloid galactosyltransferase. Plant Sci. 168:267-273. 13. McCue, K.F., P.V. Allen, L.V. Shepherd, A. Blake, J. Whitworth, M.M. Maccree, D.R. Rockhold, D. Stewart, et al. 2006. The primary in vivo steroidal alkaloid glucosyltransferase from potato. Phytochemistry 67:1590-1597. 14. McCue, K.F., P.V. Allen, L.V. Shepherd, A. Blake, M.M. Maccree, D.R. Rockhold, R. Novy, D. Stewart, et al. 2007. Potato glycosterol rhamnosyltransferase, the terminal step in triose side chain biosynthesis. Phytochemistry 68:327-334. 15. Kuhl, J.C., K. Zarka, J. Coombs, W.W. Kirk, and D.S. Douches. 2007. Late blight resistance or RB transgenic potato lines. J. Amer. Soc. Hort. Sci. 132:783-789. 16. Kooshki, M., A. Mentewab, and C. Stewart. 2003. Pathogen inducible reporting in transgenic tobacco using a GFP construct. Plant Sci. 165:213-219. 17. Shchelkunov, S.N., R.K. Salyaev, N.I. Rekoslavskaya, T.S. Ryzhova, S.G. Pozdnyakov, V.M. Sumtsova, N.V. Pakova, U.O. Mishutina, et al. 2004. The obtaining of transgenic tomato plant producing chimerical proteins TBI-HBsAg. Dokl. Biochem. Biophys. 396:139-142. 18. Shchelkunov, S.N., R.K. Salyaev, S.G. Pozdnyakov, N.I. Rekoslavskaya, A.E. Nesterov, T.S. Ryzhova, V.M. Sumtsova, N.V. Pakova, et al. 2006. Immunogenicity of a novel, bivalent, plant-based oral vaccine against hepatitis B and human immunodeficiency viruses. Biotechnol. Lett. 28:959-967. 19. Bassett, C.L., A.M. Callahan, T.S. Artlip, R. Scorza, and C. Srinivasan. 2007. A minimal peach type II chlorophyll a/b-binding protein promoter retains tissue-specificity and light regulation in tomato. BMC Biotechnol. 7:47. 20. Norelli, J. L., C. Bassett, T. Artlip, H.S. Aldwinckle, M. Malnoy, E. BorejszaWysocka, D. Gidoni, and M. Flaishman. 2007. Inducible DNA promoters for use in apple. Acta Hortic. 738:329-334.
Received 26 October 2007; accepted 13 December 2007. Address correspondence to Kent F. McCue, USDA Agricultural Research Service, 800 Buchanan Street, Albany, CA 94710-1105, USA. e-mail:
[email protected] To purchase reprints of this article, contact:
[email protected] Vol. 44 ı No. 6 ı 2008
