The FASEB Journal • Research Communication
Signal transducer and activator of transcription 3 is a transcriptional factor regulating the gene expression of SALL4 J. Dien Bard,*,1 P. Gelebart,*,1 H. M. Amin,† L. C. Young,* Y. Ma,‡ and R. Lai*,2 *Department of Laboratory Medicine and Pathology, University of Alberta, Edmonton, Alberta, Canada; †Department of Hematopathology, University of Texas M. D. Anderson Cancer Center, Houston, Texas, USA; and ‡Department of Hematopathology, Nevada Cancer Center, Las Vegas, Nevada, USA Both signal transducer and activator of transcription 3 (STAT3) and SALL4 are important in maintaining the pluripotent and self-renewal state of embryonic stem cells. We hypothesized that STAT3, a latent transcriptional factor, may regulate the gene expression of SALL4. In support of this hypothesis, DNA sequence analysis of the SALL4 gene promoter revealed four putative STAT3-binding sites. Using a SALL4-luciferase reporter gene assay, we found that modulation of the STAT3 activity significantly up-regulated the luciferase activity. By chromatin immunoprecipitation, the segment of the SALL4 promoter showing the highest affinity to STAT3 was localized to ⴚ366 to ⴚ163, in which there was only one putative STAT3 binding site starting at ⴚ199. Site-directed mutagenesis of all four putative STAT3-binding sites in the SALL4 promoter significantly reduced its responsiveness to STAT3, although the most dramatic effect was seen at the binding site starting at ⴚ199. We further tested the functional relationship between STAT3 and SALL4 using MDA-MB-231, a breast cell line carrying constitutive SALL4 expression and STAT3 activity. Down-regulation of the STAT3 activity using a dominant-negative construct resulted in a significant decrease in the expression of SALL4. To conclude, our data suggest that STAT3 and SALL4 probably cooperate in both physiological and pathological states.—Dien Bard, J., Gelebart, P., Amin, H. M., Young, L. C., Ma, Y., Lai, R. Signal transducer and activator of transcription 3 is a transcriptional factor regulating the gene expression of SALL4. FASEB J. 23, 1405–1414 (2009) ABSTRACT
Key Words: cell signaling 䡠 luciferase assay 䡠 chromatin immunoprecipitation
Signal transducers and activators of transcription (STATs) consist of 7 latent cytoplasmic transcription factors that are involved in cell cycle progression, differentiation, and survival in response to various cytokines and growth factors (1, 2). In contrast to normal cells in which phosphorylation and activation of STAT3 is a transient process, cancer cells often have constitutively 0892-6638/09/0023-1405 © FASEB
active STAT3; aberrant STAT3 activation has been reported in several types of human cancers, including breast cancer (3), pancreatic cancer (4), and lymphomas (5). With the use of a variety of experimental models, it has been shown that constitutive activation of STAT3 directly contributes to oncogenesis (6, 7). Aside from its roles in oncogenesis, STAT3 has been implicated as a major player in murine embryonic development, as targeted disruption of the STAT3 gene resulted in embryonic lethality (8). STAT3 also has been strongly implicated in the maintenance of the pluripotent and self-renewal state in mouse embryonic stem (ES) cells, because blockade of STAT3 signaling using a dominant-negative construct results in a loss in pluripotency and a transition into cell differentiation in these cells (9-11). The importance of STAT3 signaling in these cells is probably related to the observation that the self-renewal property of ES cells depends on leukemia inhibitory factor, a cytokine known to trigger the activation of the Janus kinase/STAT3 signaling pathway (15, 16). In addition to STAT3, the fundamental role of several other transcription factors in the self-renewal process of ES cells also has been established (17-20). One of these proteins is SALL4, a zinc finger transcriptional factor that is one of four members of the SALL gene family originally cloned on the basis of the DNA sequence homologue to Drosophila spalt (21, 22). Mutations of SALL4 in humans has been reported in the Okihiro/Duane-radial ray syndrome, an autosomal dominant disorder that is characterized by radial ray defects and associated with defects in multiple organs (21). Recent studies have shown that SALL4 plays an essential role in maintaining the pluripotency of murine ES cells, because decreasing SALL4 expression by small interfering RNA (siRNA) results in the differentiation of ES cells to the trophoblast stage (23). Similar to STAT3, SALL4 has been implicated in tumorigenesis in humans; for instance, its direct role in 1
These authors contributed equally to this work. Correspondence: Dept. of Laboratory Medicine and Pathology, University of Alberta, 11560 University Ave., Edmonton, AB, Canada T6G 1Z2. E-mail:
[email protected] doi: 10.1096/fj.08-117721 2
1405
the pathogenesis of acute myeloid leukemia was recently documented (21, 24, 25). In hematological neoplasms, SALL4 expression was found in acute myeloid leukemia and precursor B-cell lymphoblastic leukemia/lymphoma, but not in those carrying a mature phenotype (25). This result correlates well with the normal expression pattern of SALL4, which is restricted to stem cells. Interestingly, expression of SALL4 mRNA also has been found in human epithelial ovarian cancer, a tumor type known to have constitutively active STAT3 (26, 27). Because STAT3 and SALL4 share a similar role in maintaining the pluripotent state of the ES cells, these two proteins may be functionally linked to each other. In this study, we specifically tested the hypothesis that STAT3 is a transcriptional factor regulating the gene expression of SALL4. We provide evidence that STAT3 binds to the promoter of the SALL4 gene and significantly modulates the transcriptional activity of SALL4. Our data suggest that SALL4 and STAT3 may cooperate with each other in regulating the pluripotency of ES cells and promoting tumorigenesis.
MATERIALS AND METHODS Construction of STAT3Ctet-off The STAT3C construct was a generous gift from Dr. J. F. Bromberg (Memorial Sloan-Kettering Cancer Center, New York, NY, USA), and its properties have been well characterized and described (7). Details of the tetracycline-off STAT3C (STAT3Ctetoff) expression system have been described previously (28). Cell lines and culture Human breast cancer cell lines MCF-7, MDA-MB-231, MDAMB-468, and HL-60 were obtained from the American Type Culture Collection (Manassas, VA, USA). Mino cells, a mantle cell lymphoma cell line of mature B-cell immunophenotype, were described previously (29). All cell lines were grown at 37°C in 5% CO2 and maintained in Dulbecco’s modified Eagle’s medium or RPMI 1640 (Sigma-Aldrich, Oakville, ON, Canada). Culture media were enriched with 10% FBS (Life Technologies, Inc., Grand Island, NY, USA) and antibiotics (10,000 U/mL penicillin G and 10 000 g/mL streptomycin; Life Technologies, Inc.). MCF-7 cells permanently transfected with the tetracycline-controlled transactivator and TRE-STAT3C plasmids were selected and maintained by the addition of 800 g/ml geneticin (Life Technologies, Inc.) to the culture media (28). SALL4 promoter construct The 5⬘-flanking region of SALL4 was amplified using the following primer set: 5⬘-GGGGTACCGCTCAATCAATTATTATTATTAC and 3⬘-CCCAAGCTTGCGAGCATCG GGGCGCCGGGAGAG to generate a fragment of 2000 bp upstream of the first ATG carrying the Kpn and HindII restriction enzyme site at each end, respectively. Human genomic DNA isolated from the kidney was used to amplify this 5⬘-flanking region of SALL4. After Kpn and HindII digestion, this fragment was cloned into the promoterless pGL3-Basic luciferase reporter plasmid (Promega, Madison, WI, USA) to generate the SALL4/luciferase reporter. 1406
Vol. 23
May 2009
Gene transfection Transient gene transfection of cell lines with various vectors was performed using the Lipofectamine 2000 transfection reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol. Briefly, breast cancer cell lines were grown in 6-well culture plates without antibiotics. When cells reached ⬃90% confluency, the culture medium was replaced with serum-free Opti-MEM I (Life Technologies, Inc.), and cells were transfected with the DNA:lipofectamine complex. For all of the in vitro experiments, STAT3Ctet-off MCF-7 cells were subjected to transient transfection with 2 g of SALL4/luciferase and 1 g of -galactosidase (-GAL) plasmid. To regulate the expression of STAT3C in these cells, various concentrations of tetracycline (Invitrogen) were added to the cell culture. Western blot analysis and antibodies Western blot analysis was performed using standard techniques described in detail previously (29). Antibodies used included anti-FLAG (1:3000, Sigma-Aldrich), anti-STAT3 (1: 500, Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), anti-pSTAT3 (1:500, Santa Cruz Biotechnology, Inc.), antiSALL4, anti-␣-tubulin (1:1000, Santa Cruz Biotechnology, Inc.), and anti--actin (1:3000, Sigma-Aldrich). The generation of the SALL4 antibody was described previously (25). In brief, to prepare an antipeptide antibody, the peptide MSRRKQAKPQHIN of human SALL4 was chosen, and the antibody was produced in rabbits in collaboration with Lampire Biological Laboratories (Piperville, PA, USA). Nuclear extraction Nuclear extraction of MDA-MB-231, MCF-7, SU-DHL-1, and Mino cells was performed using a nuclear extraction kit according to the manufacturer’s protocol (Panomics, Fremont, CA, USA). Briefly, buffer A was added to 1 ⫻ 106 cells, and the solution was rocked on ice for 10 min at 200 rpm and centrifuged at 14,000 g for 3 min at 4°C. After the supernatant was removed (the cytoplasmic portion), buffer B was added to the cell pellets, which were rocked on ice for 2 h at 200 rpm. Samples were then centrifuged at 14,000 g for 3 min at 4°C, and the supernatant (the nuclear portion) was transferred to a new microcentrifuge tube for Western blot analysis. Reverse transcriptase-polymerase chain reaction (RT-PCR) Total cellular RNA was extracted from MCF-7, MDA-MB-231, MDA-MB-468, Mino, and HL-60 cells and 10 primary breast tumors using TRIzol extraction according to the manufacturer’s protocol (Life Technologies, Inc.). Reverse transcription was performed using 500 ng of total RNA in a first-strand cDNA synthesis reaction with SuperScript reverse transcriptase as recommended by the manufacturer (Invitrogen). Glyceraldehyde3-phosphate dehydrogenase was included as an internal control. The SALL4 primer sequences were obtained from a previously published article (30). The primer sequences for SALL4 are forward 5⬘-CATGATGGCTTCCT TAGATGCCCCAG-3⬘ and reverse 5⬘ CCGTGTGTCATGTAGTGA ACCTTTAAG-3⬘, with an expected product size of 500 bp. The primer sequences for GAPDH are forward 5⬘-AAGGTCATCCCTGAGCTGA-3⬘ and reverse 5⬘-CCCTGTTGCTGTAGCCAAAT-3⬘, with an expected product size of 316 bp. PCR was performed by adding 1 l of RT product into a 25-l volume reaction containing 1⫻ buffer, a 200 M concentration of each dNTP, oligonucleotide primer, and 0.2 U of AmpliTaq polymerase. For DNA amplification, cDNA was denatured at 94°C for 1 min and subjected to primer
The FASEB Journal
DIEN BARD ET AL.
annealing at 60°C for 1 min, followed by DNA extension at 72°C for 1 min for 40 cycles in a thermal cycler (Applied Biosystems, Foster City, CA, USA). Amplified products were analyzed by DNA gel electrophoresis in 1% agarose and visualized by the Alpha Imager 3400 (Alpha Innotech, San Leandro, CA, USA). Sequencing of the SALL4 PCR products was performed using a TOPO TA Cloning Kit (Invitrogen) and a 3130XL Genetics Analyzer (Applied Biosystems). Luciferase assay STAT3Ctet-off MCF-7 cells were subjected to double transfection with the SALL4/luciferase reporter construct and -GAL. Lysates were prepared 24 h after transfection on ice using freshly prepared lysis buffer (1 M Tris-HCl, pH 7.8; 10% Nonidet P-40; and 1 M dithiothreitol), incubated on ice for 15 min, and plated onto 96-well plates (Corning Life Sciences, Lowell, MA, USA). Samples were analyzed using the FLUOstar Optima microplate reader (BMG Labtech, Offenburg, Germany). A portion of the lysate was used to measure -GAL, an internal control for transfection efficiency. The -GAL activity was measured colorimetrically at 405 nm using a microplate reader (Bio-Rad, Mississauga, ON, Canada). The luciferase activity was normalized against the -GAL activity to minimize experimental variabilities owing to differences in cell viability or transfection efficiency. Chromatin immunoprecipitation assay Chromatin immunoprecipitation was performed using a Magna ChIP Assay Kit according to the manufacturer’s protocol (Upstate, Charlottesville, VA, USA). In brief, histones were cross-linked to DNA by adding formaldehyde to a final concentration of 1% and incubated for 10 min at room temperature. Sonication of chromatin to an average size of ⬃500 bp was performed, followed by immunoprecipitation with protein A magnetic beads and either a rabbit anti-human STAT3 antibody or normal IgG antibody overnight at 4°C. The protein A magnetic beads were then separated using a magnetic separator (Upstate) and incubated with anti-rabbit secondary antibody for 1 h at 4°C. DNA was recovered using the DNA purification spin columns provided and then used for PCR. Primer pairs were designed by Primer3 Input 0.4.0 to detect the SALL4 promoter region containing putative STAT3-binding sites. The primer sequences are as follows: primer 1 (expected product size, 209 bp) forward 5⬘-GCCCAGAGCAGTTATGGAAA-3⬘ and reverse 5⬘-ATTGA CACATGATGCCTGGA-3⬘; and primer 2 (expected product size, 220 bp) forward 5⬘-GATAGCTGGAGCAA GGATGG-3⬘ and reverse 5⬘-ATGAGCCCTGACAGCTGATT-3⬘. PCR was performed by adding 500 ng of DNA product into a 25-l reaction containing 1⫻ buffer, a 200 M concentration of each dNTP, oligonucleotide primer, and 0.2 U of AmpliTaq polymerase.
CAATC to ATGCCCAGAGCAGgcgtGGA AAGACCAATC, ⫺1270 from GATGATTTCATCATTCATTTAACATTTATTG to GATGATTTCATCAgcgtTTTAACATTTATTG, ⫺1229 from TTGTGTAAAGCAGT TAGCCAAATTAAGTATAC to TTGTGTAAAGCAGgcgtCCAAATTAAGTATAC, and ⫺199 from GATCAATGAGGGCTTATTTAAATGATCTC to GATCAATGAGG GCgcgTTTAAATGATCTC. The SALL4/luciferase reporter construct was the template used for the mutagenesis study. Mutants were screened by direct sequencing using the 3130XL Genetics Analyzer. Plasmids were amplified using a Maxi-prep kit (Qiagen, Mississauga, ON, Canada). STAT3 dominant-negative vector and SALL4 knockdown The production and characteristics of the adenoviral vector carrying a STAT3 dominant-negative construct (Ad-STAT3DN) have been described previously (32). In brief, the adenoviral vector was deleted at the E1A region. With use of the sitedirected mutagenesis technique, the STAT3 cDNA was modified such that the Tyr705 residue was replaced by phenylalanine. The expression of STAT3 was driven by the rabbit -actin promoter and cytomegalovirus enhancer. The construct was epitopetagged with FLAG (DYKDDDDK) (Kodak, Rochester, NY, USA) at the N terminus. An adenoviral vector expressing green fluorescence protein (GFP) was used as the negative control. For SALL4 knockdown, we used three short-hairpin RNA (shRNA)-expressing retroviral vectors, with one being a negative control (pRS) (Origen, Rockville, MD, USA) and two (nos. 7410 and 7412; Origen) being SALL4 specific. The production and transfection of these retroviral vectors have been described previously (33). 3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay To determine the effect of SALL4 on cell viability, MDA-MB231 cells were infected with either SALL4 shRNA or control shRNA retrovirus, and the MTS assay (Promega) was performed after 48 h. After 1000 cells were seeded in 96-well culture plates, cell viability was measured daily using a colorimetric microplate reader (Bio-Rad) at 450 nm, and absorbance values were normalized using Microplate Manager 5.2.1 (Bio-Rad). SALL4 immunohistochemistry Production of the anti-SALL4 antibody and details of antigen retrieval and immunohistochemistry have been described previously (30).
RESULTS
Site-specific mutagenesis of the SALL4 promoter
SALL4 gene promoter contains four STAT3 consensus binding sites
The human SALL4 promoter consists of ⬃2.0 kb of genomic DNA. Potential STAT3-binding sites in the SALL4 promoter were determined by searching the 2.0-kb region for consensus STAT-binding sites, (TTN(4 – 6)AA), and consensus STAT3-binding sites, TTMXXXDAA (D: A, G, or T; M: A or C) (31). Four sites at positions ⫺199, ⫺1229, ⫺1270, or ⫺1316 upstream of the initiation site were selected and specifically mutated using the GeneEditor site-directed mutagenesis system according to the manufacturer’s protocol (Promega). Oligonucleotide sequences are listed below, with mutations underscored and in lowercase: ⫺1316 from ATGCCCAGAGCAGTTATGGAAAGAC-
As summarized in Tables 1 and 2, DNA sequence analysis of the ⫺2-kb SALL4 promoter region in both humans and mice revealed 27 consensus sequences for STAT protein binding, characterized by TTN(4-6)AA (34). Four sequences in human SALL4 and 10 in mouse SALL4 contain TTMXXXDAA (D: A, G, or T; M: A or C), the consensus sequence of STAT3 (31, 35). In humans, the four STAT3 potential binding sites begin at positions ⫺199, ⫺1229, ⫺1270, and ⫺1316, upstream of the ATG transcription initiation site.
STAT3 REGULATES SALL4 EXPRESSION
1407
TABLE 1. Putative STAT3-binding sites in the human SALL4 gene promoter Site
Location relative to ATG
⫺73
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 a
⫺124 ⫺199 ⫺255 ⫺433 ⫺442 ⫺472 ⫺576 ⫺618 ⫺722 ⫺799 ⫺847 ⫺1046 ⫺1071 ⫺1092 ⫺1229 ⫺1242 ⫺1270 ⫺1316 ⫺1360 ⫺1512 ⫺1582 ⫺1622 ⫺1634 ⫺1655 ⫺1691 ⫺1879
Consensus sites TTN(4⫺6)AA
TTTCCCAA TTGATAATAA TTATTTAAAa TTTGTCACAA TTCTACGTAA TTCCAAAA TTTGGAGCAA TTGGGGGAA TTAATCAAAA TTTTGGAA TTTGTGAA TTGAAGTTAA TTAGTAACAA TTGCACAA TTTTCTGTAA TTAGCCAAAa TTGTGTAAA TTCATTTAAa TTATGGAAAa TTACAATGAA TTGTCCAA TTCAACAA TTATACATAA TTGCTTTAAA TTGGCTATAA TTATTAAA TTTTCCTTAA
STAT3 binds to the SALL4 promoter shown by chromatin immunoprecipitation To determine whether there is direct binding of STAT3 to the STAT3-binding consensus sequences on the SALL4
Specific STAT3-binding site.
TABLE 2. Putative STAT3-binding sites in the mouse SALL4 gene promoter
STAT3 regulates SALL4 gene expression To establish the functional relationship between the STAT3 activity and SALL4 gene expression, we used an in vitro model previously established in our laboratory, in which the expression of STAT3C (hence the STAT3 activity) in MCF-7 (a breast cancer cell line) can be down-regulated with the addition of different concentrations of tetracycline to the cell culture (28). For simplicity, these cells are labeled STAT3Ctet-off MCF-7. As shown in Fig. 1A, the FLAG epitope that has been tagged to the STAT3C construct was strongly expressed in the absence of tetracycline. With the addition of increasing doses of tetracycline to the cell culture (20 and 60 g/ml), there was a gradual decrease in the expression of the FLAG epitope. Accordingly, the total STAT3 level, which included both the endogenous STAT3 and exogenous STAT3C, was also decreased. -Actin, the loading control, was unchanged in all three lanes. We then examined the protein expression of SALL4 in STAT3tet-off cells under different concentrations of tetracycline. The blots shown in Fig. 1B was derived from the same Western blots used for Fig. 1A. Because SALL4B was previously shown to induce acute myeloid leukemia in a transgenic mice model (25), we primarily evaluated the expression of SALL4B (at 95 kDa) in this study. The protein expression of SALL4 was significantly decreased with the addition of tetracycline; it was undetectable at 60 g/ml tetracycline. To confirm these results, RT-PCR was 1408
performed and consistent results were obtained. As shown in Fig. 2, STAT3Ctet-off MCF-7 cells expressed SALL4 mRNA at a much higher level in the absence of tetracycline treatment, compared with cells treated with tetracycline, at 20 or 60 g/ml. HL-60 cells (an acute myeloid leukemia cell line) served as a positive control, whereas Mino cells (a mantle cell lymphoma cell line) served as a negative control for SALL4. The sequences of the RT-PCR amplicons for SALL4 were confirmed (results not shown). To further establish the functional relationship between the STAT3 activity and SALL4 gene expression, STAT3Ctet-off MCF-7 cells were transfected with a vector containing the human SALL4 promoter/pGL3-Basic luciferase reporter. All of the transfection experiments performed included a -GAL-expressing vector as a control for the transfection efficiency. Relatively robust luciferase activity was detectable with a high level of STAT3C expression (i.e., no tetracycline added). As shown in Fig. 3, addition of tetracycline resulted in a significant decrease in the SALL4 promoter luciferase activity. The relative luciferase activity was calculated by normalizing the luciferase activity to the -GAL activity.
Vol. 23
May 2009
Site number
Location relative to ATG
Consensus sites TTN(4⫺6)AA
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27
⫺203 ⫺410 ⫺439 ⫺482 ⫺614 ⫺683 ⫺775 ⫺794 ⫺856 ⫺869 ⫺942 ⫺955 ⫺983 ⫺1024 ⫺1041 ⫺1076 ⫺1100 ⫺1111 ⫺1137 ⫺1147 ⫺1447 ⫺1478 ⫺1692 ⫺1774 ⫺1785 ⫺1808 ⫺1919
TTATTTAAAa TTCAATAAAa TTCTAGAA TTACTACAA TTCCGTAAAa TTAGGTAA TTACAACAA TTCCGAAAAa TTCTAGCAA TTCTGGAA TTAAGTACAA TTCTAGAAAa TTCTGTAA TTCCCGAA TTAGGAAA TTGAGAAAAa TTAGCCAA TTGCAAGGAA TTCTTCAA TTAGTTGAAa TTTCTGTAA TTGCAGAA TTCCCAGAAa TTCCCTTAAa TTACACAA TTAGATAAAa TTATGAAA
a
Specific STAT3-binding site.
The FASEB Journal
DIEN BARD ET AL.
Figure 3. STAT3-regulated gene expression of SALL4. Luciferase assay was performed using STAT3Ctet-off MCF-7 cells treated with 0 and 20 g/ml tetracycline. Cells were transiently transfected with the SALL4/luciferase reported construct and -GAL. Luciferase activity was read using a luminometer, and levels were normalized with -GAL activity. Luciferase activity was significantly higher in transfected cells with no tetracycline treatment compared with cells treated with 20 g/ml tetracycline. Triplicate experiments were performed. Error bars ⫽ sd. Figure 1. SALL4 expression in STAT3Ctet-off MCF-7 cells. STAT3Ctet-off MCF-7 cells were treated with 0, 20, and 60 g/ml tetracycline, and the protein level of SALL4 was assessed by Western blots. Results shown are representative of 3 separate experiments. A) FLAG epitope tagged to STAT3C was detected using an anti-FLAG antibody. Total cellular STAT3 was detected using an anti-STAT3 antibody. Addition of increasing concentrations of tetracycline resulted in a substantial decrease in both FLAG and STAT3. B) SALL4 was detected using an anti-SALL4 antibody. Addition of tetracycline at 60 g/ml was sufficient in reducing the SALL4 expression to an undetectable level. MW, molecular weight.
schematic representation of the primer sets that were designed to include the four putative STAT3-binding sites on the human SALL4 promoter, with primer 1 spanning three STAT3 sites (⫺1316, ⫺1270, and ⫺1229) and primer 2 spanning one STAT3 site (⫺199). The use of both primer 1 and primer 2 yielded amplifiable products of the SALL4 promoter (Fig. 4B). No amplifications were observed in the immunoprecipitation reactions that contained normal IgG antibody. The input lane was included as a control for PCR effectiveness. PCR without the addition of DNA templates was used as a negative control.
promoter, chromatin immunoprecipitation was performed using MDA-MB-231, a breast cancer cell line expressing constitutively active STAT3. After extraction, chromatin was immunoprecipitated using anti-STAT3 antibody. Immunoprecipitation with normal rabbit IgG antibody was used as the negative control. Figure 4A is a
Confirmation of the STAT3-binding sites using site-directed mutagenesis
Figure 2. SALL4 mRNA expression in STAT3Ctet-off MCF-7 cells. RT-PCR studies using STAT3Ctet-off MCF-7 cells treated with 0, 20, and 60 g/ml tetracycline demonstrated a dosedependent down-regulation of SALL4, with SALL4 mRNA expression being absent at 60 g/ml tetracycline. HL-60 cells were included as the positive control, and Mino cells were included as the negative control for SALL4. GAPDH was included as an internal control. Results shown are representative of 3 separate experiments. STAT3 REGULATES SALL4 EXPRESSION
To confirm the functionality of these STAT3-binding sites on the SALL4 promoter, site-directed mutagenesis was used to mutate all of the four putative STAT3-binding sites. Mutations were confirmed by DNA sequencing and are described as follows: ⫺1316 from TTATGGAAA to gcgtGGAAA, ⫺1270 from TTCATTTAA to gcgtTTTAA, ⫺1229 from TTAGCCAAA to gcgtCCAAA, and ⫺199 from TTATTTAAA to gcgTTTAAA. STAT3Ctet-off MCF-7 cells were transfected with -GAL and with either the wild-type or mutated constructs. Subsequently, a luciferase assay was performed. After normalization with -GAL, the relative luciferase activity for each mutated constructs was compared with that of the wild-type construct. The wild-type luciferase promoter demonstrated the highest level of luciferase activity. In contrast, mutations at the promoter region at ⫺199 (i.e., mutant 4) resulted in the most significant down-regulation of SALL4 promoter activity (Fig. 5). The luciferase activity was also significantly reduced in the other mutants. These results correlated with those found in the chromatin immunoprecipitation assay, supporting the concept that there is more than one functional STAT3-binding site on the SALL4 promoter. Nevertheless, the STAT3-binding site at 1409
Figure 4. Chromatin immunoprecipitation. A) Schematic representation of primer sets specific for the SALL4 promoter used in this study. Primer 1 consisted of three putative STAT3-binding sites; primer 2 consisted of one putative STAT3-binding site. B) Chromatin immunoprecipitation was performed using MDA-MB-231 and an antibody against STAT3. Normal rabbit IgG antibody instead of anti-STAT3 served as the negative control. PCR with both primer 1 and primer 2 revealed amplicons. In contrast, no amplicons were observed in negative control samples. Results shown are representative of 3 separate experiments.
⫺199 appears to be most effective in modulating the gene expression of SALL4. STAT3 regulates the endogenous level of SALL4 in human cell lines Because much of our data presented thus far in this study were based on the use of the SALL4/luciferase reporter gene construct, we tested whether the SALL4 expression level can be regulated by modulating STAT3 activity in a native human cell line. Although the expression of SALL4 is highly restricted in human cells (30), our previous studies had allowed us to identify a variable expression level of SALL4 in several breast cancer cell lines, including MCF-7 (parental clone), MDA-MB-231, and MDA-MB468, as shown in Fig. 6A. HL-60 cells were included as the positive control, and Mino cells were included as the
Figure 5. Site-directed mutagenesis of the SALL4 gene promoter. Site-directed mutagenesis was performed using the SALL4/luciferase reporter construct, with introduction of mutations of 3-4 bp in each of the four putative STAT3binding sites: ⫺1316 (Mut 1), ⫺1270 (Mut 2), ⫺1229 (Mut 3), and ⫺199 (Mut 4). Luciferase activity was determined for each of the four mutants and for the unmutated construct. One of these constructs and -GAL were transfected into STAT3Ctet-off MCF-7 cells, and a luciferase assay was performed 24 h later. Luciferase activity was normalized against -GAL activity. Our results showed that the luciferase activity of all mutants was significantly decreased compared with that of the unmutated construct, with the most significant decrease found in Mut 4 (⫺199). This experiment was performed in triplicate. Error bars ⫽ sd. 1410
Vol. 23
May 2009
negative control. Of note, in contrast with the STAT3tet-off cells (a derivative of MCF-7), we were able to detect a low level of SALL4 in the parental MCF-7 cells. To confirm SALL4 expression in these cell lines, RT-PCR was performed and SALL4 mRNA was detected in all three breast cancer cell lines (Fig. 6B). The amplifiable PCR products were sequenced, and the products were confirmed to be full-length SALL4 (data not shown). Because SALL4 is known to be a transcriptional factor itself, it is expected to be localized to the nucleus (25). Thus, we performed nuclear cytoplasmic fractionation. As shown in Fig. 6C, we confirmed that SALL4 is localized to the nucleus in MDA-MB-231 and MCF-7 cells. Interestingly, the SALL4 nuclear protein level was higher in MDA-MB-231 cells, which correlated with a substantially higher pSTAT3 level in the nuclei of MB-231 cells. The same membrane was reprobed with an antibody reactive with ␣-tubulin, a protein largely restricted to the cytoplasm; the absence of ␣-tubulin in the nuclear fraction indicates that our fractionation method was sufficient. Using MDA-MB-231, which expressed both SALL4 and constitutively active STAT3, we determined whether STAT3 also regulates SALL4 gene expression. We inhibited STAT3 activation with the use of an adenoviral STAT3 dominant-negative construct (Ad-STAT3DN), which had been described previously in detail (36). As shown in Fig. 7, MDA-MB-231 cells infected with AdSTAT3DN for 24 h showed expression of the FLAG epitope that was tagged to the STAT3DN construct. SALL4 expression was substantially down-regulated in these cells. These results were in contrast with cells treated with an adenoviral vector expressing GFP (Ad-GFP). Furthermore, a significant decrease in viable cells was observed in cells infected with Ad-STAT3DN compared with those transfected with Ad-GFP, with no apoptotic activity detectable (see Supplemental Figs. S1 and S2). Effects of endogenous SALL4 on human cancer cell lines To assess whether STAT3-regulated expression of SALL4 is biologically meaningful, SALL4 expression was downregulated in MDA-MB-231 cells using shRNA-mediated knockdown. MDA-MB-231 cells were infected with either
The FASEB Journal
DIEN BARD ET AL.
Figure 6. SALL4 expression in human breast cancer cell lines. A) Western blot analysis confirmed the expression of SALL4 in breast cancer cell lines, MDA-MB-468, MDA-MB-231, and MCF-7. HL-60 cells were included as the positive control, and Mino cells were included as the negative control for SALL4. Results shown are representative of 3 separate experiments. B) RT-PCR studies using MDA-MB-468, MDA-MB-231, MCF-7, HL-60, and Mino cells demonstrated the presence of SALL4 in all breast cancer cell lines. HL-60 cells were included as the positive control, and Mino cells were used as the negative control for SALL4. GAPDH was included as an internal control. Results shown are representative of 3 separate experiments. C) Nuclear extraction was performed on MDA-MB-231, MCF-7, and Mino cells. Western blot analysis demonstrated the presence of nuclear SALL4 in both breast cancer cell lines. ␣-Tubulin, a cytoplasmic protein, was not detectable. Levels of nuclear SALL4 expression seem to correlate with those of STAT3 levels in the two breast cancer cell lines. Mino cells were included as the negative control for both SALL4 and pSTAT3. Results shown are representative of 3 separate experiments. MW, molecular weight.
SALL4 siRNA retrovirus or a control shRNA retrovirus for 48 h. A trypan blue exclusion assay was used to count the number of viable cells and to assess cell morphology. Similar to the results with cells treated with Ad-STAT3DN, there was a significant decrease in the number of viable cells in MDA-MB-231 cells treated with SALL4 shRNA, but no appreciable apoptosis was detectable. Western blots were performed to confirm that SALL4 expression was down-regulated with the shRNA treatment. As illustrated
in Fig. 8A, SALL4 expression was down-regulated by ⬃50%. To further assess the effects of SALL4 on cell growth, an MTS assay was performed 48 h after retroviral infection. The cell growth index was measured daily for 4 days, and a significant decrease in cell growth was observed in the SALL4 shRNA-infected cells compared with cells infected with the control shRNA (Fig. 8B). On day 4, there was an ⬃50% decrease in cell growth in the SALL4 shRNA-treated samples compared with the control samples. Expression of SALL4 in primary breast tumors Twenty randomly chosen, formalin-fixed/paraffin-embedded primary breast carcinomas were assessed for SALL4 expression. Using immunohistochemical staining, we found SALL4 expression in five cases. In contrast, normal breast epithelial cells are negative for this marker (Fig. 9). As reported previously (28), pSTAT3 was detectable only in a subset of breast cancer but not in benign breast epithelium.
Figure 7. Blockade of STAT3 signaling down-regulated SALL4. MDA-MB-231 cells were treated with Ad-STAT3DN or Ad-GFP for 24 h. In the Ad-STAT3DN-treated cells, FLAG was detectable, and total STAT3 level was increased. Correlating with these changes, SALL4 level was decreased. Cells infected with Ad-GFP served as the negative control. Results shown are representative of 3 separate experiments. STAT3 REGULATES SALL4 EXPRESSION
DISCUSSION In view of the common roles of STAT3 and SALL4 in maintaining the pluripotency of ES cells and their importance in oncogenesis, we investigated whether there is a 1411
Figure 8. Down-regulation of SALL4 inhibited cell growth. A) MDA-MB-231 cells were treated with either SALL4 shRNA retrovirus or control shRNA retrovirus, and the cell lysates obtained were subjected to Western blots. SALL4 levels were decreased in shRNA-treated cells compared with cells treated with control shRNA. Densitometry was performed to quantify SALL4 expression levels (bottom) and demonstrated ⬃50% down-regulation of SALL4 expression. Results shown are representative of 3 separate experiments. Error bars ⫽ sd. B) MTS assay was performed comparing cell growth in MDA-MD-231 cells treated with SALL4 shRNA retrovirus or control shRNA. After 48 h, treatment of MDA-MB-231 with SALL4 shRNA retrovirus resulted in a significant decrease in cell growth compared with cells treated with control shRNA. On day 4, cell growth index in cells treated with SALL4 shRNA was ⬃50% of that of cells treated with control shRNA. This experiment was performed in triplicate. Error bars ⫽ sd.
functional link between STAT3 and SALL4. Specifically, we tested whether STAT3 is a transcriptional factor for SALL4. Our results support this concept. First, we have shown that the SALL4 promoter carries four STAT3 binding consensus sequences. Second, our data support
Figure 9. Immunohistochemical staining to detect SALL4 expression in breast cancer. A) Benign breast epithelial cells showed no definitive nuclear SALL4 staining. B, C) Two cases of breast cancer also showed no definitive SALL4 nuclear staining. D) One tumor showed strong and definitive SALL4 nuclear staining. Nonspecific cytoplasmic staining was detectable in all panels.
1412
Vol. 23
May 2009
the fact that STAT3 indeed binds to these four sites and regulates the gene expression of SALL4, with the binding region starting at ⫺199 being the most influential. Third, site-directed mutations at all four STAT3-binding sites significantly reduced the luciferase activity in our SALL4/
A
B
C
D
The FASEB Journal
DIEN BARD ET AL.
luciferase reporter gene assay, and the reduction was most dramatic with mutations introduced at the ⫺199 site. Fourth, using a STAT3 dominant-negative construct, we showed that inhibition of STAT3 activity significantly decreased the expression of SALL4 in a native human breast cancer cell line, MDA-MB-231, which expresses both pSTAT3 and SALL4. Although the focus of this article was to document that STAT3 is a transcriptional factor for SALL4, we also had the opportunity to examine whether SALL4 is biologically important in breast cancer cells. In this regard, for the first time, we demonstrated that breast cancer cell lines express SALL4 at a variable level. SALL4 expression is likely to be functional in these cells, because it is localized to the nucleus. Interestingly, in a comparison of the results with MDA-MB-231 and MCF-7 (Fig. 6C), the nuclear SALL4 protein level appears to correlate with that of pSTAT3, although a more comprehensive study is required to confirm this impression. Our results further support the fact that SALL4 expression is of biological importance in breast cancer cell lines, because shRNAmediated down-regulation of SALL4 expression in MDAMB-231 led to a significant decrease in cell growth. In keeping with a previously published study (37), we also found that breast cancer cells treated with a STAT3 dominant-negative construct also showed cell cycle arrest. On the basis of the findings described in this study, the suppression of cell growth in breast cancer cell lines induced by STAT3 inhibition may be mediated via SALL4. Of note, in contrast with leukemic cells (33), SALL4 knockdown in MDA-MD-231 cells did not result in detectable apoptosis. We are not certain about this difference, but the apoptotic effects of SALL4 knockdown may be cell type-specific. The finding of relatively consistent expression of SALL4 in various breast cancer cell lines was initially surprising to us, considering that SALL4 is believed to be largely a stem cell marker (23, 38). Nevertheless, it is not uncommon for stem cell markers to be expressed in carcinoma cells. For instance, Oct4, one of the key regulators of ES cells, was detectable in a variety of human cancers including cancers of the breast, lung, pancreas, colon, and ovary (39). In addition to Oct4, a relatively recent study by Ezeh et al. (40) identified expression of Nanog, another regulator of ES cells, in breast tumors and cell lines but not in normal breast tissues. Although the biological role of Nanog and Oct4 in cancer is largely unknown, the expression of these two markers may correlate with tumor aggressiveness. Specifically, a recent study reported that expression of Nanog and Oct4 is associated with a high-grade histology (41). Similar to SALL4, the interactions between STAT3 and both Oct4 and Nanog have been reported to be essential for the maintenance of murine ES cells in a pluripotent state (42) and for oncogenesis (43). For instance, Oct4 is reported to provide antiapoptotic effects in murine ES cells, and this effect may be mediated by the STAT3 signaling pathway (44). Coexpression of STAT3, Oct4, and Nanog has been reported in bone sarcoma cells, although whether STAT3 is responsible for the expression of Oct4 STAT3 REGULATES SALL4 EXPRESSION
and Nanog in these cells was not addressed (43). In light of our findings in this study, it is tempting to speculate that STAT3 may directly contribute to the aberrant expression of these stem cell markers in various forms of human cancer. The oncogenic potential of SALL4 has been recently revealed by multiple studies. The SALL4B transgenic mice exhibit myelodysplastic-like features including ineffective hematopoiesis and an increased proportion of immature cells (25). The SALL4 level was found to be consistently increased with progression to leukemia. SALL4 is known to directly target the BMI-1 gene, a marker that is important in predicting the disease progression of acute myeloid leukemia (24). The functional categories of SALL4 target genes in leukemic cells revealed that SALL4 frequently binds to target genes involving various apoptotic pathways, including p53, BCL2, TNF, and PTEN (44). Interestingly, SALL4 has also been reported to directly bind to -catenin and activate the Wnt canonical pathway, another pathway implicated in oncogenesis (25). Thus, it is highly likely that SALL4 cooperates with a number of different physiological pathways, including the STAT3 signaling pathway, to promote tumorigenesis in various human malignancies. To conclude, we describe a novel functional link between STAT3 and SALL4 in which SALL4 is a downstream target gene of STAT3. We have located the specific STAT3-binding regions in the SALL4 gene promoter. Our data suggest that STAT3 and SALL4 probably cooperate in both physiological and pathological states. We thank Dr. Hanan Armanious for her technical assistance. This study was supported by research grants from the Canadian Institute of Health Research and the Canadian Cancer Society awarded to R.L. P.G. is a recipient of a Lymphoma Research Foundation of Canada Fellowship Award.
REFERENCES 1. 2. 3.
4.
5.
6. 7.
Clevenger, C. V. (2004) Roles and regulation of Stat family transcription factors in human breast cancer. Am. J. Pathol. 165, 1449 –1460 Yu, H., and Jove, R. (2004) The STATs of cancer—new molecular targets come of age. Nat. Rev. Cancer 4, 97–105 Garcia, R., Bowman, T. L., Niu, G., Yu, H., Minton, S., MuroCacho, C. A., Cox, C. E., Falcone, R., Fairclough, R., Parsons, S., Laudano, A., Gazit, A., Levitzki, A., Kraker, A., and Jove, R. (2001) Constitutive activation of Stat3 by the Src and JAK tyrosine kinases participates in growth regulation of human breast carcinoma cells. Oncogene 20, 2499 –2513 Scholz, A., Heinze, S., Detjen, K. M., Peters, M., Welzel, M., Hauff, P., Schirner, M., Wiedenmann, B., and Rosewicz, S. (2003) Activated signal transducer and activator of transcription 3 (STAT3) supports the malignant phenotype of human pancreatic cancer. Gastroenterology 125, 891–905 Zamo, A., Chiarle, R., Piva, R., Howes, J., Fan, Y., Chilosi, M., Levy, D. E., and Inghirami, G. (2002) Anaplastic lymphoma kinase (ALK) activates Stat3 and protects hematopoietic cells from cell death. Oncogene 21, 1038 –1047 Bowman, T., Garcia, R., Turkson, J., and Jove, R. (2000) STATs in oncogenesis. Oncogene 19, 2474 –2488 Bromberg, J. F., Wrzeszczynska, M. H., Devgan, G., Zhao, Y., Pestell, R. G., Albanese, C., and Darnell, J. E., Jr. (1999) Stat3 as an oncogene. Cell 98, 295–303
1413
8.
9. 10. 11. 12. 13.
14. 15.
16.
17. 18. 19. 20.
21.
22.
23.
24.
25.
26. 27.
1414
Takeda, K., Noguchi, K., Shi, W., Tanaka, T., Matsumoto, M., Yoshida, N., Kishimoto, T., and Akira, S. (1997) Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality. Proc. Natl. Acad. Sci. U. S. A. 94, 3801–3804 Boeuf, H., Hauss, C., Graeve, F. D., Baran, N., and Kedinger, C. (1997) Leukemia inhibitory factor-dependent transcriptional activation in embryonic stem cells. J. Cell Biol. 138, 1207–1217 Niwa, H., Burdon, T., Chambers, I., and Smith, A. (1998) Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev. 12, 2048 –2060 Raz, R., Lee, C. K., Cannizzaro, L. A., d’Eustachio, P., and Levy, D. E. (1999) Essential role of STAT3 for embryonic stem cell pluripotency. Proc. Natl. Acad. Sci. U. S. A. 96, 2846-2851 Evans, M. J., and Kaufman, M. H. (1981) Establishment in culture of pluripotential cells from mouse embryos. Nature 292, 154 –156 Martin, G. R. (1981) Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. U. S. A. 78, 7634 –7638 Skinnider, B. F., Connors, J. M., Sutcliffe, S. B., and Gascoyne, R. D. (1999) Anaplastic large cell lymphoma: a clinicopathologic analysis. Hematol. Oncol. 17, 137–148 Gearing, D. P., Thut, C. J., VandeBos, T., Gimpel, S. D., Delaney, P. B., King, J., Price, V., Cosman, D., and Beckmann, M. P. (1991) Leukemia inhibitory factor receptor is structurally related to the IL-6 signal transducer, gp130. EMBO J. 10, 2839 – 2848 Smith, A. G., Heath, J. K., Donaldson, D. D., Wong, G. G., Moreau, J., Stahl, M., and Rogers, D. (1988) Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336, 688 – 690 Chambers, I., and Smith, A. (2004) Self-renewal of teratocarcinoma and embryonic stem cells. Oncogene 23, 7150 –7160 Niwa, H. (2001) Molecular mechanism to maintain stem cell renewal of ES cells. Cell Struct. Funct. 26, 137–148 Niwa, H., Miyazaki, J., and Smith, A. G. (2000) Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24, 372–376 Vernallis, A. B., Hudson, K. R., and Heath, J. K. (1997) An antagonist for the leukemia inhibitory factor receptor inhibits leukemia inhibitory factor, cardiotrophin-1, ciliary neurotrophic factor, and oncostatin M. J. Biol. Chem. 272, 26947–26952 Al-Baradie, R., Yamada, K., St Hilaire, C., Chan, W. M., Andrews, C., McIntosh, N., Nakano, M., Martonyi, E. J., Raymond, W. R., Okumura, S., Okihiro, M. M., and Engle, E. C. (2002) Duane radial ray syndrome (Okihiro syndrome) maps to 20q13 and results from mutations in SALL4, a new member of the SAL family. Am. J. Hum. Genet. 71, 1195–1199 Kohlhase, J., Schuh, R., Dowe, G., Kuhnlein, R. P., Jackle, H., Schroeder, B., Schulz-Schaeffer, W., Kretzschmar, H. A., Kohler, A., Muller, U., Raab-Vetter, M., Burkhardt, E., Engel, W., and Stick, R. (1996) Isolation, characterization, and organ-specific expression of two novel human zinc finger genes related to the Drosophila gene spalt. Genomics 38, 291–298 Zhang, J., Tam, W. L., Tong, G. Q., Wu, Q., Chan, H. Y., Soh, B. S., Lou, Y., Yang, J., Ma, Y., Chai, L., Ng, H. H., Lufkin, T., Robson, P., and Lim, B. (2006) Sall4 modulates embryonic stem cell pluripotency and early embryonic development by the transcriptional regulation of Pou5f1. Nat. Cell Biol. 8, 1114 –1123 Yang, J., Chai, L., Liu, F., Fink, L. M., Lin, P., Silberstein, L. E., Amin, H. M., Ward, D. C., and Ma, Y. (2007) Bmi-1 is a target gene for SALL4 in hematopoietic and leukemic cells. Proc. Natl. Acad. Sci. U. S. A. 104, 10494 –10499 Ma, Y., Cui, W., Yang, J., Qu, J., Di, C., Amin, H. M., Lai, R., Ritz, J., Krause, D. S., and Chai, L. (2006) SALL4, a novel oncogene, is constitutively expressed in human acute myeloid leukemia (AML) and induces AML in transgenic mice. Blood 108, 2726 –2735 Bohm, J., Sustmann, C., Wilhelm, C., and Kohlhase, J. (2006) SALL4 is directly activated by TCF/LEF in the canonical Wnt signaling pathway. Biochem. Biophys. Res. Commun. 348, 898 –907 Burke, W. M., Jin, X., Lin, H. J., Huang, M., Liu, R., Reynolds, R. K., and Lin, J. (2001) Inhibition of constitutively active Stat3
Vol. 23
May 2009
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38. 39. 40.
41.
42. 43.
44.
suppresses growth of human ovarian and breast cancer cells. Oncogene 20, 7925–7934 Dien, J., Amin, H. M., Chiu, N., Wong, W., Frantz, C., Chiu, B., Mackey, J. R., and Lai, R. (2006) Signal transducers and activators of transcription-3 up-regulates tissue inhibitor of metalloproteinase-1 expression and decreases invasiveness of breast cancer. Am. J. Pathol. 169, 633– 642 Amin, H. M., McDonnell, T. J., Medeiros, L. J., Rassidakis, G. Z., Leventaki, V., O’Connor, S. L., Keating, M. J., and Lai, R. (2003) Characterization of 4 mantle cell lymphoma cell lines. Arch. Pathol. Lab. Med. 127, 424 – 431 Cui, W., Kong, N. R., Ma, Y., Amin, H. M., Lai, R., and Chai, L. (2006) Differential expression of the novel oncogene, SALL4, in lymphoma, plasma cell myeloma, and acute lymphoblastic leukemia. Mod. Pathol. 19, 1585–1592 Qian, L., Chen, L., Shi, M., Yu, M., Jin, B., Hu, M., Xia, Q., Zhang, X., Shen, B., and Guo, N. (2006) A novel cis-acting element in Her2 promoter regulated by Stat3 in mammary cancer cells. Biochem. Biophys. Res. Commun. 345, 660 – 668 Kunisada, K., Tone, E., Fujio, Y., Matsui, H., Yamauchi-Takihara, K., and Kishimoto, T. (1998) Activation of gp130 transduces hypertrophic signals via STAT3 in cardiac myocytes. Circulation 98, 346 –352 Yang, J., Chai, L., Gao, C., Fowles, T. C., Alipio, Z., Dang, H., Xu, D., Fink, L. M., Ward, D. C., and Ma, Y. (2008) SALL4 is a key regulator of survival and apoptosis in human leukemic cells. Blood 112, 805– 813 Seidel, H. M., Milocco, L. H., Lamb, P., Darnell, J. E., Jr., Stein, R. B., and Rosen, J. (1995) Spacing of palindromic half sites as a determinant of selective STAT (signal transducers and activators of transcription) DNA binding and transcriptional activity. Proc. Natl. Acad. Sci. U. S. A. 92, 3041–3045 Ehret, G. B., Reichenbach, P., Schindler, U., Horvath, C. M., Fritz, S., Nabholz, M., and Bucher, P. (2001) DNA binding specificity of different STAT proteins: comparison of in vitro specificity with natural target sites. J. Biol. Chem. 276, 6675– 6688 Amin, H. M. McDonnell, T. J., Ma, Y., Lin, Q., Fujio, Y., Kunisada, K., Leventaki, V., Das, P., Rassidakis, G. Z., Cutler, C., Medeiros, L. J., and Lai, R. (2004) Selective inhibition of STAT3 induces apoptosis and G1 cell cycle arrest in ALK-positive anaplastic large cell lymphoma. Oncogene 23, 5426 –5434 Zhang, F. L. C., Halfter, H., and Liu, J. (2003) Delineating an oncostatin M-activated STAT3 signaling pathway that coordinates the expression of genes involved in cell cycle regulation and extracellular matrix deposition of MCF-7 cells. Oncogene 22, 894 –905 Elling, U., Klasen, C., Eisenberger, T., Anlag, K., and Treier, M. (2006) Murine inner cell mass-derived lineages depend on Sall4 function. Proc. Natl. Acad. Sci. U. S. A. 103, 16319 –16324 Monk, M., and Holding, C. (2001) Human embryonic genes re-expressed in cancer cells. Oncogene 20, 8085– 8091 Ezeh, U. I., Turek, P. J., Reijo, R. A., and Clark, A. T. (2005) Human embryonic stem cell genes OCT4, NANOG, STELLAR, and GDF3 are expressed in both seminoma and breast carcinoma. Cancer 104, 2255–2265 Ben-Porath, I., Thomson, M. W., Carey, V. J., Ge, R., Bell, G. W., Regev, A., and Weinberg, R. A. (2008) An embryonic stem cell-like gene expression signature in poorly differentiated aggressive human tumors. Nat. Genet. 40, 499 –507 Chambers, I. (2004) The molecular basis of pluripotency in mouse embryonic stem cells. Cloning Stem Cells 6, 386 –391 Gibbs, C. P., Kukekov, V. G., Reith, J. D., Tchigrinova, O., Suslov, O. N., Scott, E. W., Ghivizzani, S. C., Ignatova, T. N., and Steindler, D. A. (2005) Stem-like cells in bone sarcomas: implications for tumorigenesis. Neoplasia 7, 967–976 Guo, Y., Mantel, C., Hromas, R. A., and Broxmeyer, H. E. (2008) Oct-4 is critical for survival/antiapoptosis of murine embryonic stem cells subjected to stress: effects associated with Stat3/ survivin. Stem Cells 26, 30 –34
The FASEB Journal
Received for publication July 22, 2008. Accepted for publication December 4, 2008.
DIEN BARD ET AL.
