Signaling pathways involved in induction of GADD45 gene ... - Nature

Oncogene (2004) 23, 4614–4623

& 2004 Nature Publishing Group All rights reserved 0950-9232/04 $30.00 www.nature.com/onc

Signaling pathways involved in induction of GADD45 gene expression and apoptosis by troglitazone in human MCF-7 breast carcinoma cells Fen Yin*,1, Dennis Bruemmer1, Florian Blaschke1, Willa A Hsueh1, Ronald E Law1 and Andre J Van Herle1 1

Division of Endocrinology, Diabetes and Hypertension, David Geffen School of Medicine, University of California, Los Angeles, California, CA 90095, USA

We previously reported that the PPARc agonist troglitazone (TRO) inhibits proliferation and induces apoptosis in human MCF-7 breast carcinoma cells. To understand the mechanisms of antiproliferative and pro-apoptotic effects of TRO, we screened a limited DNA array containing 23 genes involved in regulating either the cell cycle and/or apoptosis. Four of the 23 genes screened exhibited regulation by TRO, with growth arrest and DNA damage-inducible gene 45 (GADD45) being the most strongly upregulated. TRO induced GADD45 mRNA expression in a time- and dose-dependent manner. Depletion of GADD45 by siRNA abrogated TROinduced apoptosis in MCF-7 cells demonstrating the physiological relevance of GADD45 upregulation. Signaling pathways mediating TRO-induced GADD45 were also investigated. Several mitogen-activated protein kinase (MAPK) pathways were involved in the induction of GADD45 by TRO. Inhibition of the c-jun N-terminal kinase MAPK pathway by SP600125 partially abolished TRO-induced GADD45 mRNA, and protein expression and apoptosis. In contrast, inhibition of the p38 MAPK pathway by SB203580, or through overexpression of a dominant-negative mutant of p38 MAPK, augmented GADD45 mRNA induction and GADD45 promoter activation as well as cell apoptosis by TRO. Blockade of the extracellular signal-regulated kinase MAPK pathway by PD98059 also enhanced TRO’s effects on GADD45 and apoptosis. Two other PPARc agonists pioglitazone and rosiglitazone did not induce GADD45 expression. Our finding of GADD45 induction by TRO may provide a new insight concerning the mechanisms for TRO’s antiproliferative and pro-apoptotic effects in breast cancer cells. Oncogene (2004) 23, 4614–4623. doi:10.1038/sj.onc.1207598 Published online 5 April 2004 Keywords: Troglitazone; breast cancer cell; GADD45; JNK; p38; ERK1/2

*Correspondence: F Yin, David Geffen School of Medicine, UCLA, Division of Endocrinology, 900 Veteran Avenue, 24-130 Warren Hall, Los Angeles, CA 90024, USA; E-mail: [email protected] Received 5 June 2003; revised 16 December 2003; accepted 3 February 2004; Published online 5 April 2004

Introduction Peroxisome proliferator-activated receptors (PPARs) are members of a superfamily of nuclear receptors that act as ligand-inducible transcription factors when bound to peroxisome proliferator response elements (PPRE) on DNA. Among PPARs, PPARg is primarily expressed in adipose tissue and is an important regulator of adipocyte differentiation (Lowell, 1999). Recent studies have demonstrated the presence of PPARg in colon, prostate, bladder, breast, and other human cancer cells(Elstner et al., 1998; Kubota et al., 1998; Mueller et al., 1998; Sarraf et al., 1998; Chang and Szabo, 2000; Huin et al., 2002). The antitumorigenic effects of PPARg ligands have been well documented (Yang and Frucht, 2001; Haydon et al., 2002; Mossner et al., 2002; Osawa et al., 2003). Numerous studies have demonstrated that troglitazone (TRO), a synthetic PPARg ligand, causes growth inhibition, induces differentiation, and triggers apoptosis of various human malignant cells (Asou et al., 1999; Clay et al., 1999; Demetri et al., 1999; Sugimura et al., 1999; Hisatake et al., 2000; Rumi et al., 2001; Takashima et al., 2001; Begum et al., 2002; Yoshizawa et al., 2002). TRO inhibits proliferation of MCF-7 breast cancer cells by inducing cell cycle arrest and causing apoptosis (Yin et al., 2001). Little is known, however, concerning the underlying molecular mechanisms for TRO’s antiproliferative and pro-apoptotic activities. The growth arrest and DNA damage-inducible gene 45(GADD45) is a cell cycle regulator, which encodes a protein that is induced by genotoxic and certain other cellular stress. GADD45 binds to multiple regulatory proteins, such as proliferating cell nuclear antigen (PCNA) (Smith et al., 1994), p21 protein (Chen et al., 1995; Kearsey et al., 1995), core histone protein (Carrier et al., 1999), and MTK/MEK kinase 4 (MEKK4) (Takekawa and Saito, 1998), an upstream activator of the c-jun N-terminal kinase (JNK) pathway. Although the exact function of GADD45 has not been elucidated, the presence of GADD45 in these complexes strongly implicates GADD45 as an important regulator of cell cycle progression, apoptosis, and DNA repair.

Troglitazone induces GADD45 in breast cancer cells F Yin et al

4615

Mitogen-activated protein kinases (MAPKs) are key participants in cell proliferation, survival, and differentiation. Activated MAPKs, ERK, p38, and JNK regulate the activities of transcription factors or other downstream signaling kinases by phosphorylation, and thereby control both gene expression and cellular function. In general, activation of the MEK/ERK pathway is associated with cell survival and proliferation. In contrast, JNK and p38 MAPKs are primarily activated by stress stimuli (such as UV radiation and DNA-damaging agents) (Rouse et al., 1994; Raingeaud et al., 1995; Finkel and Holbrook, 2000; Tong et al., 2001) that can lead to cell growth inhibition and/or apoptosis. Since TRO induces both growth arrest and apoptosis in MCF-7 breast carcinoma cells, we examined whether upregulation of GADD45 occurred concomitant with these effects. To investigate gene expression events associated with TRO-induced apoptosis in MCF-7 cells, we used a gene array analysis technique to demonstrate that the GADD45 gene was dramatically upregulated by TRO. Specific signaling pathways mediating GADD45 induction by TRO were also examined by using specific inhibitors of the ERK, p38, and JNK MAPKs pathways, as well as a dominant-negative mutant of p38 MAPK. Our results reveal that all the three of the MAP kinase pathways contribute importantly to TRO-induced GADD45 expression in MCF-7 cells. Moreover, using siRNA, we further demonstrate that GADD45 is an essential mediator of the pro-apoptotic activity of TRO in human breast carcinoma cells. Results TRO-regulated apoptosis and cell cycle genes in MCF-7 cells TRO inhibits proliferation and induces apoptosis in MCF-7 cells (Yin et al., 2001), which likely results from its effect to regulate some cell cycle and apoptosisrelated genes. A Superarray Human Cell Cycle-1 Gene Array was employed to profile the changes in gene expression in MCF-7 cells exposed to TRO. This gene array contains probes to 23 known cell cycle and apoptosis-related genes. Messenger RNA isolated from MCF-7 cells at 24 h after TRO treatment was nonradioactive labeled and hybridized to a cDNA array membrane. A 24 h time point was chosen based on our earlier studies, which showed that maximum G1 cell cycle arrest was observed 24 h after TRO treatment (Yin et al., 2001). Different regulation levels were noticed in several of genes related to the cell cycle and apoptosis. A markedly increase of GADD45 mRNA expression level (8.3-fold) was observed (Figure 1). Furthermore, early growth response gene (egr-1) and p21cip1 genes were upregulated (2.1 and 2.5-fold, respectively), while PCNA was downregulated (3.2-fold) (Figure 1). Since GADD45 was the most dramatically regulated gene among those examined, GADD45 may play a pivotal role in TRO-induced growth inhibition, cell cycle arrest and apoptosis in tumor cells.

Figure 1 Effect of TRO treatment on levels of GADD45, egr-1, p21 and PCNA gene expression in MCF-7 cells. MCF-7 cells were treated with TRO or with vehicle for 24 h. Total RNA of TROtreated and control cells were isolated. Non-radioactive-labeled probes were generated by reverse transcription and hybridized to Supper-Array membranes, and signals were detected according to the manufacturer’s instruction. The fold induction or repression of four genes in response to TRO treatment as compared with control cells is shown in bottom panel

TRO-stimulated significant increase of GADD45 mRNA and protein expression in MCF-7 cells Two independent cDNA array experiments assessing genes induced by TRO in MCF-7 cells established GADD45 as a target gene whose expression was significantly regulated by TRO. To confirm the gene array results, Northern blot analyses were performed to examine GADD45 mRNA expression in MCF-7 cells. TRO treatment continuously increased the steady-state levels of GADD45 mRNA by 1.5–5 fold from 4 to 24 h after treatment (Figure 2a). GADD45 mRNA levels increased in response to TRO stimulation in a dosedependent manner (Figure 2b) The highest concentration of TRO (40 mM) treatment yielded five fold induction compared to control cells. Other PPARg ligands, in addition to TRO, were examined for their effects on GADD45 expression. MCF-7 cells were treated with vehicle, TRO, pioglitazone (PIO) and rosiglitazone (RSG) for 24 h. As shown in Figure 2c, Oncogene


4616

Figure 2 Induction of GADD45 mRNA and protein expression by TRO in MCF-7 cells. (a) MCF-7 cells were treated with TRO (40 mM) for varying time periods as indicated. (b) MCF-7 cells were treated with TRO at varying concentrations as indicated for 24 h. (c) MCF-7 cells were treated by vehicle, TRO (40 mM), PIO (40 mM), and RSG (40 mM), respectively. Total RNA was isolated and expression of GADD45 mRNA was determined by Northern blot analysis; subsequently, the blot was reprobed with a GAPDH cDNA probe. A representative result from three independent experiments is shown. Quantification of GADD45 mRNA is shown in the right panel. (d) Western blot. In all, 40 mg micrograms of whole cell protein extracts from MCF-7 cells were treated with 40 mM TRO for various times, were separated on SDS/PAGE and levels of proteins were detected with antibody against GADD45; subsequently, the blot was reprobed with b-actin antibody. A representative result from two independent blots is shown

in contrast to strong induction by TRO, GADD45 mRNA levels did not change after PIO or RSG treatment compared to control cells. As shown in Figure 2d, the induction of GADD45 mRNA was accompanied by an increase in GADD45 protein at 8 h after TRO treatment, which remained elevated up to 24 h. JNK1, ERK1/2 and p38 are activated in MCF-7 cells by TRO treatment The mitogen-activated protein kinase (MAPK) family is engaged in transcriptional regulation of inducible genes in response to extracellular stimuli. In addition, recent data indicated that MAPK family members play a role in the regulation of GADD45 gene (Tong et al., 2001; Sarkar et al., 2002). To determine whether MAP kinase activities are affected by TRO treatment, cells were grown in the presence or absence of TRO. Cells were collected after various TRO-treatment times and cell lysates were prepared and analysed by using antibodies Oncogene

that recognize the phosphorylated peptide sequence representing the catalytic core of active MAPK enzymes. TRO induced a prolonged JNK1 activation starting at 4 h and continuing through 24 h after treatment initiation (Figure 3a). An early activation of ERK1/2 was observed, starting at 1 h, peaking at 2 h, and returning to basal levels by 6 h after TRO treatment (Figure 3b). Activation of p38 MAPK was detected as early as 1 h after MCF-7 cells were treated by TRO, and was sustained at 4 h. At later time-points (12 and 24 h), however, p38 MAPK activity decreased with TRO treatment compared to control cells. In combination, these results indicate that JNK, ERK, as well as p38 MAPK pathways are affected by TRO treatment in MCF-7 cells. Requirement for the JNK activity in TRO-induced GADD45 mRNA and protein expression To determine the role of the JNK pathway on TROinduced expression of GADD45 mRNA, we examined


4617

Figure 3 Effect of TRO treatment on levels of phosphorylated MAP kinases in MCF-7 cells. Cells were treated with 40 mM TRO or vehicle and harvested at indicated times. Cell extracts were separated on SDS/PAGE and levels of proteins were detected with antibodies against phosphorylated (a) JNK, (b) ERK1/2 and (c) p38 MAP kinases. After development, the membranes were stripped and reprobed with antibodies against total (phosphorylated plus nonphosphorylated) JNK, ERK1/2, and p38 MAP kinases. Blots are representative of two independent experiments

the consequence of inhibiting JNK activity for TROinduced GADD45 expression. MCF-7 cells were pretreated with various concentrations of the JNK inhibitor SP600125 for 30 min, followed by 24 h TRO treatment. As shown in Figure 4a, SP600125 significantly suppressed the induction of GADD45 mRNA expression by TRO treatment in MCF-7 cells in a concentrationdependent manner. Furthermore, TRO-mediated upregulation of GADD45 protein level was also effectively suppressed by pretreating the cells with SP600125 (Figure 4b). These results demonstrate that TRO induces GADD45 expression in MCF-7 cells through the JNK signaling pathway. Inhibition of ERK1/2 and p38 pathways enhances TROinduced GADD45 mRNA expression and GADD45 promoter activation To test whether ERK1/2 and p38 MAPK pathways played roles in TRO-mediated upregulation of GADD45, the specific ERK1/2 inhibitor PD98059 and the specific p38 inhibitor SB203580 were used to prevent phosphorylation and activation of ERK1/2 and p38. MCF-7 cells were pretreated with various concentrations of PD98059 or SB203580 for 30 min, followed by 24 h TRO treatment. Surprisingly, inhibition of ERK

Figure 4 JNK inhibitor SP600125 suppresses TRO-induced GADD45 mRNA, protein expression in MCF-7 cells. (a) MCF-7 cells were pretreated with SP600125 (0.1–10 mM) for 30 min. Then the cells were treated with TRO for 24 h. Expression of GADD45 mRNA and GAPDH was determined by Northern blot analysis. A representative result from two independent experiments is shown. The bottom panel shows GADD45 mRNA levels normalized to GAPDH mRNA levels. (b) MCF-7 cells were pretreated with SP600125 (0.1–10 mM) for 30 min. Then the cells were treated with TRO for 24 h. Expression of GADD45 protein was determined by Western blot. A representative result from two independent experiments is shown. The bottom panel shows GADD45 protein levels normalized to b-actin protein levels

and p38 signaling pathways by PD98059 and SB203580 were accompanied by a significant concentration-dependent enhancement in TRO-induced GADD45 mRNA expression (Figures 5a and 6a). Furthermore, SB203580 alone at high concentration (10 mM) also increased the GADD45 mRNA expression. Increased GADD45 mRNA levels could result from either transcriptional or post-transcriptional mechanisms. As shown in Figures 5b and 6b, inhibition of ERK and p38 MAPK pathways resulted in a concentration-dependent enhancement of GADD45 promoter activity. To better define the role of p38 MAP kinase in activation of the GADD45 promoter, and to exclude the possibility of any nonspecific effects of the SB203580 treatment on TRO-induced GADD45 expression, we Oncogene


4618

both negatively regulate TRO-induced GADD45 expression at the transcriptional level. Effect of MAP kinase pathways on TRO-induced apoptosis in MCF-7 cells All the three MAP kinase pathways are involved in the induction of GADD45 by TRO. We further examined whether blocking these three MAP kinase pathways would affect MCF-7 cell apoptosis after TRO treatment. MCF-7 cells were pretreated with JNK inhibitor (SP600125), p38 inhibitor (SB203580) and ERK MAP kinase inhibitor (PD98059) for 1 h prior to TRO treatment. SP600125 reduced, whereas SB203580 and PD98059 enhanced, apoptosis induced by TRO treatment in MCF-7 cells (Figure 7). Silencing of the GADD45 gene by siRNA prevents TRO induction of apoptosis in MCF-7 cells

Figure 5 Effects of ERK inhibitor PD98059 on TRO-induced GADD45 mRNA expression and GADD45 promoter activation in MCF-7 cells. (a) MCF-7 cells were pretreated with PD98059 (10– 60 mM) for 30 min. Then the cells were treated with TRO for 24 h. The expression of GADD45 mRNA and GAPDH was determined by Northern blot analysis. A representative result from two independent experiments is shown. The bottom panel shows GADD45 mRNA levels normalized to GAPDH mRNA levels. (b) MCF-7 cells were transiently transfected with the GADD45 luciferase -promoter for 6 h. Cells were then pretreated for 30 min with PD98059 (10–60 mM) before continued incubation with or without TRO. Luciferase reporter activity was measured 24 h after TRO treatment. Data are means of values from three experiments (7s.e.) with assays in triplicate

used a molecular approach by overexpressing dominantnegative forms of p38 MAP kinase, MKK3 and MKK6. MKK3 and MKK6 were investigated because they are immediate upstream kinases of p38 and specifically phosphorylate and activate p38. Dominant-negative mutant forms of p38a(fp38a (AF)), p38b (fp38b(AF)), MKK3 (MKK3b (A)) and MKK6 (MKK6b (A)) were transiently cotransfected with GADD45 promoter into MCF-7 cells in the presence of TRO or vehicle. Complementary results were obtained, as was observed for the pharmacological inhibitor SB203580. Overexpression of dominant-negative p38, MKK3 and MKK6 led to a significant enhancement in basal as well as TRO-stimulated GADD45 promoter activation (Figure 6c), indicating a role for p38 pathway in regulating GADD45 transcription. Taken together, our data demonstrate that ERK1/2 and p38 pathways Oncogene

Previously, we reported that TRO caused apoptosis in MCF-7 cells. In the present study, we report that TRO upregulates expression of GADD45, a nuclear factor implicated in apoptosis. Here, GADD45 siRNA was exploited to selectively knock down GADD45 in MCF7 cells. We confirmed the ability of these siGADD45 duplexes to suppress GADD45 induction in TROtreated MCF-7 cells and determined whether TROinduced apoptosis was affected. As shown in Figure 8a and b, administration of GADD45 siRNA to MCF-7 cells decreased both basal and TRO-induced GADD45 mRNA and protein expression at 24 and 48 h. In the presence of control luciferase siRNA, 38% of MCF-7 cells underwent apoptosis in response to 40 mM TRO for 48 h (Figure 8c). MCF-7 cells treated with GADD45 siRNA, in contrast, were refractory to TRO’s proapoptotic activity. These data demonstrate that GADD45 is an essential mediator of TRO induced apoptosis in MCF-7 cells (Figures 8 and 9).

Discussion The present study demonstrates that GADD45, a member of a family of genes coordinately induced in growth-arrested cells, is robustly upregulated by TRO in MCF-7 breast carcinoma cells. Although numerous studies have revealed that TRO inhibits growth and promotes apoptosis in human tumor cells, the exact molecular mechanisms responsible for these activities are incompletely understood. Increased expression of GADD family genes is frequently observed in response to agents that block growth or trigger apoptosis. Recent studies have shown that GADD45 is potently induced through post-transcriptional mechanisms by a synthetic retinoid that causes apoptosis in human breast and lung carcinoma cells (Rishi et al., 1999; Sakaue et al., 1999). We have previously shown that TRO inhibits proliferation in MCF-7 breast cancer cells by inducing G1 arrest with a subsequent induction of apoptosis. The current study extends those findings by identifying GADD45 as


4619

Figure 6 Effects of p38 inhibitor SB203580 and dominant-negative mutants of p38 and MKK3/6 on TRO-induced GADD45 mRNA expression and GADD45 promoter activation in MCF-7 cells. (a) MCF-7 cells were pretreated with SB203580 (0.1–10 mM) for 30 min. Then the cells were treated with TRO for 24 h. The expression of GADD45 mRNA and GAPDH were determined by Northern blot analysis. A representative result from two independent experiments is shown. The bottom panel shows GADD45 mRNA levels normalized to GAPDH mRNA levels. (b). MCF-7 cells were transiently transfected with the GADD45 luciferase-promoter for 6 h. Then, the cells were pretreated for 30 min with SB203580 (0.1–10 mM) before continued incubation with or without TRO. Luciferase reporter activity was measured 24 h after TRO treatment. Data are means of values from three experiments (7s.e.) with assays in triplicate. (c) Dominant-negative mutant forms of p38a (fp38a(AF)), p38b (fp38b(AF)), MKK3 (MKK3b (A)) and MKK6 (MKK6b (A)) and control vector were transiently cotransfected with GADD45 luciferase-promoter to MCF-7 cells. At 6 h after transfection, the medium was changed into normal growth medium with or without TRO. Luciferase reporter activity was measured 24 h after TRO treatment. Data are means of values from three experiments (7s.e.) with assays in triplicate

a target transcriptionally regulated by TRO in MCF-7 cells. Activation of the GADD45 promoter by TRO contributes majorly to the increased levels of GADD45 mRNA. Measurement of GADD45 mRNA stability using actinomycin D revealed that its half-life was unchanged by TRO treatment (data not shown). Regulation of GADD45 expression by TRO, therefore, occurs principally at the transcriptional level. Induction of GADD45 by TRO was accompanied by activation of the ERK, p38 and JNK MAPK pathways. Blockade of those pathways by either pharmacological inhibitors or dominant-negative mutant protein kinases reveals a complex interplay of positive or negative regulatory inputs from each MAPK that controls the GADD45 response elicited by TRO.

The principal finding of the present study is that although the JNK, ERK and p38 MAPK pathways are all activated by TRO in MCF-7 cells, they play different roles in regulating GADD45 expression. Blockade of the JNK pathway attenuated GADD45 induction by TRO, consistent with JNK functioning as a critical positive regulator of GADD45. In contrast, inhibition of either ERK or p38 MAPK activation by TRO markedly potentiated its effect to elevate GADD45 mRNA levels and induce GADD45 promoter activity. Initially discovered in a yeast two-hybrid screen, GADD45 can physically interact with MEKK4, an upstream MAPK kinase for both JNK and p38 MAPK (Takekawa and Saito, 1998). Binding of GADD45 to MEKK4 induces a conformational change that frees the MEKK4 kinase domain from its interaction with an NOncogene


4620

Figure 7 Differential effects of SP600125, SB203580, and PD98059 on TRO-induced apoptosis in MCF-7 cells. MCF-7 cells were pretreated with SP600125 (15 mM), SB203580 (5 mM), and PD98059 (40 mM) for 1 h. Cells were then treated with TRO or without TRO, harvested after 48 h treatment and subjected to Annexin V staining and flow cytometric analysis. Data are shown as means of three independent experiments (7s.e.). The significance of results of inhibitor treatment when compared with TROtreated cells is *Po0.05

terminal autoinhibitory domain which permits recognition and phosphorylation of MKK6 and SEK1 that, in turn, directly activates p38 MAPK and JNK (Mita et al., 2002). Another study, however, found that GADD45 null cells activated JNK to a similar extent as GADD45 þ / þ cells, after exposure to ultraviolet light and hydrogen peroxide (Wang et al., 1999). Thus, unmasking of the MEKK4 kinase domain by protein–protein interaction with GADD45 may represent just one of many mechanisms resulting in p38 and JNK MAPKs activation by stress signals. In MCF-7 cells, we find that JNK activation by TRO preceded its induction of GADD45 expression. Activation of JNK by TRO had almost plateaued after 4 h of exposure to the TRO, whereas increases in GADD45 mRNA levels became apparent only at later times. More importantly, blockade of JNK signaling with the pharmacological inhibitor SP600125 significantly suppressed both TRO’s effect to increase GADD45 mRNA and protein expression levels and abrogated TROinduced apoptosis. Based on these data, it is likely that JNK functions as an upstream regulator of, rather than simply a downstream target for, GADD45. In accordance with this conclusion, induction of GADD45 by ultraviolet light or arsenite has been shown to be partially JNK-dependent (Chen et al., 2001; Tong et al., 2001). Recently, it has been found that in HepG2 hepatoma cells TRO activated JNK, which correlated with an induction of apoptosis. Blockade of JNK signaling with SP600125 partially attenuated TROinduced apoptosis (Bae and Song, 2003). Thus, activation of JNK and regulation of downstream targets such as GADD45 may constitute a major pro-apoptotic signaling pathway triggered by TRO in MCF-7 cells. Similar to its effect on JNK, TRO also activated ERK and p38 MAPKs. Blockade of those signaling pathways, however, further enhanced TRO-stimulated GADD45 transcription and mRNA expression and apoptosis of MCF-7 cells. In mouse kidney cells, hyperosmotic stress activates ERK MAPK, induces GADD45 expression Oncogene

Figure 8 Impact of GADD45 siRNA on GADD45 expression and TRO-induced apoptosis in MCF-7 cells. MCF-7 cells were transfected with either 15 mg of luciferase siRNA(Lu), or GADD45 siRNA(Ga). At 10 h after transfection, cells were treated with 40 mM TRO or with vehicle. (a) GADD45 mRNA levels of MCF-7 cells transfected with luciferase siRNA(Lu) or GADD45 siRNA(Ga) were determined by Northern blot analysis at indicated times (h) after transfection. (b) GADD45 protein levels of MCF-7 cells transfected with luciferase siRNA(Lu) or GADD45 siRNA(Ga) were determined by Western blot at the indicated times. (c) After transfection, cells were treated with 40 mM TRO or with vehicle for another 48 h, harvested and subjected to Annexin V staining and flow cytometric analysis. Data are representative of at least two separate experiments run in duplicate

and causes growth arrest (Kultz et al., 1998). ERK MAPK also functioned as a negative regulator among the various osmosignaling pathways regulating GADD45 expression. In marked contrast, induction of GADD45 by ultraviolet light has been shown to be ERK MAPK-dependent (Tong et al., 2001), while signaling through p38 MAPK delivered neither a positive nor negative input to the GADD45 gene. From these studies, it is apparent that each MAPK signaling branch can exert a positive, negative, or neutral effect to regulate GADD45 depending on the precise stress stimulus experienced by a specific cell type. In aggregate, our data reveal that changes in GADD45 mRNA levels closely mirror TRO’s effect to induce apoptosis in MCF-7 cells. Using siRNA to knockdown GADD45 expression, we show that this


4621

Figure 9 Schema of proposed signaling pathways involved in TRO induced GADD45 upregulation and apoptosis in MCF-7 cells. As indicated, TRO activated JNK, p38 and ERK MAPK pathways, which lead to induction of GADD45. Positive regulation through the JNK pathway and negative regulation by p38 and ERK pathways are likely involved in the TRO-induced GADD45 upregulation and apoptosis in MCF-7 cells

et al. (2001) have shown that the induction of the GADD45 promoter following genotoxic agents and UV light treatments is primarily regulated through both OCT-1 and CAAT motifs located between -107 and -62 of the GADD45 promoter. Therefore, we assume that TRO activates the GADD45 promoter more likely mediated through OCT-1 and CAAT motifs rather than a peroxisome proliferator-activated receptor response element (PPRE). In vascular smooth muscle cells, our group has shown that induction of GADD45 transcription during apoptosis was OCT-1 dependent (Bruemmer et al., 2003). In conclusion, this study, in combination with our previous finding (Yin et al., 2001), suggests that TRO induces apoptosis in MCF-7 cells through a GADD45dependent pathway. TRO-induced GADD45 expression and cell apoptosis are positively regulated via the JNK pathway and negatively regulated by the ERK1/2 and p38 MAPK pathways.

Materials and methods

correlation is functionally significant. Targeting GADD45 with siRNA attenuated TRO-induced apoptosis, demonstrating that TRO triggers MCF-7 apoptotic cell death through a GADD45-dependent mechanism. TRO was the first TZD oral insulin sensitizer used clinically to treat type II diabetes (Chen, 1998; Fujiwara et al., 1988). Although TRO was removed from the market because of hepatotoxity, two other TZDs, rosiglitazone and pioglitazone are currently in widespread clinical usage (Kostrubsky et al., 2000; Chitturi and George, 2002; Otto et al., 2002). Pharmacological and genetic studies provide strong evidence that TZDs exert their insulin-sensitizing activity as ligands for PPARg (Spiegelman, 1998). TZDs have also been shown to inhibit prostate and breast tumor growth in mice, but it remains controversial whether their anticancer effects are mediated through PPARg (Mueller et al., 1998; Palakurthi et al., 2001). Our finding that TRO, but not rosiglitazone or pioglitazone, induced GADD45 in MCF-7 cells may reflect a PPARg-independent mechanism of the action. Palakurthi et al. (2001) have recently shown that TRO inhibits both in vitro proliferation and in vivo tumor growth of PPARg null embryonic stem cells underscoring the potential involvement of an alternate molecular mechanism for its anticancer properties. Those authors found that TRO and a related TZD, ciglitazone, inhibited cellular translation initiation in PPARg null cells by depleting intracellular calcium stores, which activated protein kinase R to phosphorylate and inactivate the alpha subunit of eukaryotic initiation factor-2. Similarly, we found that TRO increased phosphorylation of eIF2a (data not shown), suggesting that inhibition of protein synthesis by TRO in MCF-7 cells may provide the stress signal activating MAPKs, leading to GADD45 induction. Although TRO regulates GADD45 expression through a PPARg-independent mechanism, several other transcription factors may be involved. Takahashi

Materials MCF-7 human breast cancer cells were obtained from the American Type Culture Collection (Rockville, MD, USA). Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were from Invitrogen (Rockville, MD, USA). Troglitazone was the kind gift of Warner Lambert, Parke-Davis and was dissolved in DMSO. The final concentration of DMSO in the culture medium during TRO treatment did not exceed 0.5% (v/v). The kinase inhibitors PD098059 and SB203580 were obtained from Sigma (St. Louis, MO, USA), SP600125 was purchased from Calbiochem (San Diego, CA, USA). Antibodies specific for Phospho-JNK (Thr183/Tyr185), phospho-p38 (Thr180/Tyr182), and phospho-ERK 1/2 (Thr202/Tyr204) were purchased from Cell Signaling (Beverly, MA, USA). GADD45 antibody was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Secondary antibodies conjugated to horseradish peroxidase were purchased from Cell Signaling (Beverly, MA) and Upstate (Lake Placid, NY, USA), respectively. The mutated p38, MKK3 and MKK6 plasmids were kindly provided by Dr Han Jiahuai (The Scripps Research Institute, La Jolla, CA, USA). GADD45 luciferase-promoter plasmid was a kind gift from Dr Rishi AK (Wayne State University, Detroit, MI, USA). Cell lines and treatments MCF-7 cell line was maintained and grown in DMEM medium containing 100 units/ml penicillin, 0.2% gentamicin and supplemented with 10%(v/v) FBS at 371C, in a 5% CO2humidified atmosphere. Treatments were performed on cells at 80% confluence, and the culture media were changed 24 h before each experiment. MCF-7 cell line was incubated with TRO for 24 h or indicated time. RNA isolation and cDNA array assay Total RNA was isolated using RNA-Bee-TEST, Inc. Friendswood, TX, USA). For analysing cell cycle and apoptosis gene regulation in MCF-7 cells, the Superarray Human Cell Cycle-1 Gene Array membranes (SuperArray, Inc., Bethesda, MD, Oncogene


4622 USA) that contain 23 genes involved in regulating either the cell cycle and/or apoptosis: cdk1, cdk2, cdk4, cdk6, c-myc, cyclinA, cyclinB, cyclinC, cyclinD2, cyclinD3, cyclinE, E2F, egr-1, gadd45, mdm2, p19INK4d, p21Cip1, p53, p57Kip2, PCNA, Rb, skp1 and skp2 were employed as described in the user’s manual. Briefly, 10 mg of total RNA was converted into Biotin16-dUTP-labeled first-strand cDNA probe by means of MMLV reverse transcriptase. After prehybridization, the membranes were hybridized with probes and washed, the membranes were exposed to X-ray film from 1 to 20 min. The films were scanned and the relative intensity of signals was determined by Scion Image software. Only signals which were at least 1.5-fold different from the control were taken into consideration. Transient transfections and luciferase assays The GADD45 luciferase reporter constructs have been previously described (Rishi et al., 1999). Briefly, a 1.8 kb fragment containing the promoter and exon 1 of the GADD45 gene was excised from plasmid pHG45 (using the restriction endonuclease EcoRI). The excised EcoRI fragment was then subcloned in the sense orientation into the EcoRI site of the vector Phagemid pBluescript SK- (clone 5.1). Clone 5.1 was then digested with XmaI to obtain a 1.6 kb fragment of the GADD45 promoter and exon I. The 1.6 kb XmaI fragment was then subcloned in sense orientation into the XmaI site of pGL-2 Basic (Promega), which is a promoterless luciferase reporter vector, to obtain the GADD45 promoter-luc construct (clone 6.3). MCF-7 cells were seeded into six-well plates, 20 h after seeding the cells, the medium was aspirated, 2 mg of human GADD45 promoter-LUC construct (clone6.3) and 0.05 mg of pRL-null (Promega, Madison, WI, USA) were transfected into MCF-7 cells/well by using LipofectamineTM 2000 transfection reagent according to manufacturer’s instruction( Invitrogen, Rockville, MD, USA). In brief, 2 mg of the GADD45-LUC and 0.05 mg of pRL-null highly purified plasmid DNA were diluted with 100 ml of Opti-MEM I reduced serum medium (Invitrogen, Rockville, MD, USA). A volume of 2 ml of LipofectamineTM 2000 reagent was diluted in 100 ml of Opti-MEM I reduced serum medium. The two solutions were combined at room temperature for 15 min, followed by the addition of 1.2 ml of DMEM medium containing 5%(v/v) FBS. The mixture was then overlaid onto the cells. The cells were incubated for 6 h before the DNAcontaining medium was replaced with 1.5 ml of normal growth medium in the absence or presence of TRO. The cells were harvested 24 h later. Cells were lysed with passive lysis buffer, and a luciferase activity assay was performed using a Dual Luciferase Reporter Assay Kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. The firefly luciferase activity was normalized on the basis of Renilla luciferase activity. Northern blotting Human MCF-7 cells were treated with troglitazone. Total RNA was isolated using RNA-Bee reagent (TEL-TEST, Inc. Friendswood, TX, USA) according to the manufacturer’s instructions. Northern blotting was conducted as standard Northern blot and hybridization technique. RNA (15 mg) were used loaded per lane and resolved by electrophoresis on 1% agarose gels and transferred to positively charged nylon transfer membrane. Blots were hybridized overnight at 651C with cDNA probe for human GADD45 which was labeled with [a-32P]dCTP (3000 Ci/ml; NEN Life Science Products Inc., Boston, MA, USA). DNA probes were radiolabeled Oncogene

using the Rediprime II random prime labeling system (Amersham, Arlington Heights, IL, USA) and purified with Micro Bio-Spin 30 Columns (Bio-Rad Laboratories). The membranes were stripped and reprobed with GAPDH as RNA loading normalization. The autoradiographs were subjected to densitometry analysis using Scion Image software. Western immunoblotting Cells were rinsed with cold PBS and lysed with 0.5 ml of lysis buffer (20 mM Tris-HCL, pH 7.5; 150 mM NaCl; 1 mM EDTA; 1% Triton X-100; 2.5 mM sodium pyrophosphate; 1 mM sodium orthovanadate; 10 mg/ml each aprotinin and leupeptin; 2 mM phenylmethylsulfonyl fluoride). Protein concentrations were determined by the Bradford method using commercially prepared reagents (Bio-Rad Laboratories). In all, 40–60 mg of protein lysate were denatured with SDS-reducing buffer by boiling for 5 min; samples were electrophoresed on a 10% polyacrylamide SDS gel. The separated proteins were transferred to nitrocellulose membranes and probed with the specific primary antibodies followed by incubation with peroxide-conjugated appropriate second antibodies. Reactive proteins were detected using an enhanced chemiluminescence detection system (Amersham, Arlington Heights, IL, USA) according to the manufacturer’s procedures. SiRNA transfection SiRNA duplexes targeting GADD45 was computer designed and synthesized by GenScript Inc. (Piscataway, NJ, USA). For design of siRNA targeting GADD45, a DNA sequence of the type AA (N19) was selected (AAAGTCGCTACATGGATCAAT) according to the manufacturer’s protocol. The sequence was submitted to a BLAST search against the human genome sequence to ensure that the sequence was not present in any other known mRNA. As a nonspecific siRNA control, the luciferase siRNA duplex was used. For each 60-mm cell culture dish, 15 mg of siGADD45 or control siRNA were diluted with 250 ml of Opti-MEM medium (Invitrogen). In all, 5 ml of LipofectamineTM 2000 (Invitrogen) were diluted in 250 ml of Opti-MEM. The two solutions was combined at room temperature for 20 min, followed by the addition of 2.0 ml of DMEM medium containing 5%(v/v) FBS. The mixture was then overlaid onto the 90% confluent MCF-7 cells. After 10 h, cells were treated in the absence or presence of 40 mM TRO and harvested after another 24 and 48 h incubation for Northern blot analysis, and after 48 h for Annexin V staining as a quantitative measure of apoptosis. Apoptosis assay Apoptosis was analysed by Annexin V/Fluorescein Isothiocyanate staining using a kit obtained from Oncogene Research Product (La Jolla, CA, USA). Briefly, cells were harvested and resuspended in binding buffer at a concentration of 4 105 cells/200 ml. For each test, 4 105 cells were incubated with 5 ml of both propidium iodide and Annexin V/Fluorescein Isothiocyanate in the dark for 15 min at room temperature, and then the tubes were placed on ice. Samples were analysed within an hour by a BD Biosciences FACScan (Flow Cytometry Facility, UCLA). Acknowledgements This work was supported in part by the contributions of CALVIN DAKS DDS and Emily Chang. Florian Blaschke was supported by a research fellowship from Philipp Morris Incorporated.


4623 References Asou H, Verbeek W, Williamson E, Elstner E, Kubota T, Kamada N and Koeffler HP. (1999). Int. J. Oncol., 15, 1027–1031. Bae MA and Song BJ. (2003). Mol. Pharmacol., 63, 401–408. Begum NM, Nakashiro K, Kawamata H, Uchida D, Shintani S, Ikawa Y, Sato M and Hamakawa H. (2002). Int. J. Oncol., 20, 599–605. Bruemmer D, Yin F, Liu J, Berger JP, Sakai T, Blaschke F, Fleck E, Van Herle AJ, Forman BM and Law RE. (2003). Circ. Res., 93, 38–47. Carrier F, Georgel PT, Pourquier P, Blake M, Kontny HU, Antinore MJ, Gariboldi M, Myers TG, Weinstein JN, Pommier Y and Fornace Jr. AJ. (1999). Mol Cell Biol, 19, 1673–1685. Chang TH and Szabo E. (2000). Cancer Res., 60, 1129–1138. Chen C. (1998). Am. J. Health Syst. Pharm., 55, 905–925. Chen F, Zhang Z, Leonard SS and Shi X. (2001). Oncogene, 20, 3585–3589. Chen IT, Smith ML, O’Connor PM and Fornace Jr. AJ. (1995). Oncogene, 11, 1931–1937. Chitturi S and George J. (2002). Semin. Liver Dis., 22, 169–183. Clay CE, Namen AM, Atsumi G, Willingham MC, High KP, Kute TE, Trimboli AJ, Fonteh AN, Dawson PA and Chilton FH. (1999). Carcinogenesis, 20, 1905–1911. Demetri GD, Fletcher CD, Mueller E, Sarraf P, Naujoks R, Campbell N, Spiegelman BM and Singer S. (1999). Proc. Natl. Acad. Sci. USA, 96, 3951–3956. Elstner E, Muller C, Koshizuka K, Williamson EA, Park D, Asou H, Shintaku P, Said JW, Heber D and Koeffler HP. (1998). Proc. Natl. Acad. Sci. USA, 95, 8806–8811. Finkel T and Holbrook NJ. (2000). Nature, 408, 239–247. Fujiwara T, Yoshioka S, Yoshioka T, Ushiyama I and Horikoshi H. (1988). Diabetes, 37, 1549–1558. Haydon RC, Zhou L, Feng T, Breyer B, Cheng H, Jiang W, Ishikawa A, Peabody T, Montag A, Simon MA and He TC. (2002). Clin. Cancer Res., 8, 1288–1294. Hisatake JI, Ikezoe T, Carey M, Holden S, Tomoyasu S and Koeffler HP. (2000). Cancer Res., 60, 5494–5498. Huin C, Schohn H, Hatier R, Bentejac M, Antunes L, Plenat F, Bugaut M and Dauca M. (2002). Biol. Cell, 94, 15–27. Kearsey JM, Coates PJ, Prescott AR, Warbrick E and Hall PA. (1995). Oncogene, 11, 1675–1683. Kostrubsky VE, Sinclair JF, Ramachandran V, Venkataramanan R, Wen YH, Kindt E, Galchev V, Rose K, Sinz M and Strom SC. (2000). Drug Metab. Dispos., 28, 1192–1197. Kubota T, Koshizuka K, Williamson EA, Asou H, Said JW, Holden S, Miyoshi I and Koeffler HP. (1998). Cancer Res., 58, 3344–3352. Kultz D, Madhany S and Burg MB. (1998). J. Biol. Chem., 273, 13645–13651. Lowell BB. (1999). Cell, 99, 239–242. Mita H, Tsutsui J, Takekawa M, Witten EA and Saito H. (2002). Mol. Cell Biol., 22, 4544–4555. Mossner R, Schulz U, Kruger U, Middel P, Schinner S, Fuzesi L, Neumann C and Reich K. (2002). J. Invest. Dermatol., 119, 576–582.

Mueller E, Sarraf P, Tontonoz P, Evans RM, Martin KJ, Zhang M, Fletcher C, Singer S and Spiegelman BM. (1998). Mol. Cell, 1, 465–470. Osawa E, Nakajima A, Wada K, Ishimine S, Fujisawa N, Kawamori T, Matsuhashi N, Kadowaki T, Ochiai M, Sekihara H and Nakagama H. (2003). Gastroenterology, 124, 361–367. Otto C, Lehrke M and Goke B. (2002). Pharmacogenomics, 3, 99–116. Palakurthi SS, Aktas H, Grubissich LM, Mortensen RM and Halperin JA. (2001). Cancer Res., 61, 6213–6218. Raingeaud J, Gupta S, Rogers JS, Dickens M, Han J, Ulevitch RJ and Davis RJ. (1995). J. Biol. Chem., 270, 7420–7426. Rishi AK, Sun RJ, Gao Y, Hsu CK, Gerald TM, Saeed Sheikh M, Dawson MI, Reichert U, Shroot B, Fornace Jr. AJ, Brewer G and Fontana JA. (1999). Nucleic Acids Res., 27, 3111–3119. Rouse J, Cohen P, Trigon S, Morange M, Alonso-Llamazares A, Zamanillo D, Hunt T and Nebreda AR. (1994). Cell, 78, 1027–1037. Rumi MA, Sato H, Ishihara S, Kawashima K, Hamamoto S, Kazumori H, Okuyama T, Fukuda R, Nagasue N and Kinoshita Y. (2001). Br. J. Cancer, 84, 1640–1647. Sakaue M, Adachi H and Jetten AM. (1999). Mol. Pharmacol, 55, 668–676. Sarkar D, Su ZZ, Lebedeva IV, Sauane M, Gopalkrishnan RV, Valerie K, Dent P and Fisher PB. (2002). Proc. Natl. Acad. Sci. USA, 99, 10054–10059. Sarraf P, Mueller E, Jones D, King FJ, DeAngelo DJ, Partridge JB, Holden SA, Chen LB, Singer S, Fletcher C and Spiegelman BM. (1998). Nat. Med., 4, 1046–1052. Smith ML, Chen IT, Zhan Q, Bae I, Chen CY, Gilmer TM, Kastan MB, O’Connor PM and Fornace Jr. AJ. (1994). Science, 266, 1376–1380. Spiegelman BM. (1998). Diabetes, 47, 507–514. Sugimura A, Kiriyama Y, Nochi H, Tsuchiya H, Tamoto K, Sakurada Y, Ui M and Tokumitsu Y. (1999). Biochem. Biophys. Res. Commun., 261, 833–837. Takahashi S, Saito S, Ohtani N and Sakai T. (2001). Cancer Res., 61, 1187–1195. Takashima T, Fujiwara Y, Higuchi K, Arakawa T, Yano Y, Hasuma T and Otani S. (2001). Int. J. Oncol., 19, 465–471. Takekawa M and Saito H. (1998). Cell, 95, 521–530. Tong T, Fan W, Zhao H, Jin S, Fan F, Blanck P, Alomo I, Rajasekaran B, Liu Y, Holbrook NJ and Zhan Q. (2001). Exp. Cell Res., 269, 64–72. Wang X, Gorospe M and Holbrook NJ. (1999). J. Biol. Chem., 274, 29599–29602. Yang WL and Frucht H. (2001). Carcinogenesis, 22, 1379–1383. Yin F, Wakino S, Liu Z, Kim S, Hsueh WA, Collins AR, Van Herle AJ and Law RE. (2001). Biochem. Biophys. Res. Commun., 286, 916–922. Yoshizawa K, Cioca DP, Kawa S, Tanaka E and Kiyosawa K. (2002). Cancer, 95, 2243–2251.

Oncogene