Research
Methods Blackwell Oxford, New NPH © 1469-8137 0028-646X June 10.1111/j.1469-8137.2008.02541.x 2541 2 0 Methods Methods 257??? 48??? The2008 Phytologist Authors UK Publishing (2008).Ltd Journal compilation © New Phytologist (2008)
Methods
Simultaneous detection and quantification of the unculturable microbe Candidatus Glomeribacter gigasporarum inside its fungal host Gigaspora margarita Alessandra Salvioli1*, Erica Lumini1*, Iulia A. Anca1, Valeria Bianciotto2 and Paola Bonfante1,2 1
Dipartimento di Biologia Vegetale dell’Università degli Studi di Torino, Viale Mattioli 25, I–10125 Italy; 2Istituto per la Protezione delle Piante, Sez. di Torino,
CNR, Viale Mattioli 25, I–10125 Italy
Summary Author for correspondence: Paola Bonfante Tel: +39 011 670 5965 Fax: +39 011 670 5962 Email:
[email protected] Received: 2 April 2008 Accepted: 9 May 2008
• A combined approach based on quantitative and nested polymerase chain reaction (qPCR and nPCR, respectively) has been set up to detect and quantify the unculturable endobacterium Candidatus Glomeribacter gigasporarum inside the spores of its fungal host Gigaspora margarita. • Four genes were targeted, two of bacterial origin (23S rRNA gene and rpoB) and two from the fungus (18S rRNA gene and EF1-α). • The sensitivity of the qPCR protocol has proved to be comparable to that of nPCR, both for the fungal and the bacterial detection. It has been demonstrated that the last detected dilution in qPCR corresponded, in each case, to 10 copies of the target sequences, suggesting that the method is equally sensitive for the detection of both fungal and bacterial targets. As the two targeted bacterial genes are predicted to be in single copy, it can be concluded that the detection limit is of 10 bacterial genomes for each mixture. The protocol was then successfully applied to amplify fungal and bacterial DNA from auxiliary cells and extraradical and intraradical mycelium. • For the first time qPCR has been applied to a complex biological system to detect and quantify fungal and bacterial components using single-copy genes, and to monitor the bacterial presence throughout the fungal life cycle. Key words: arbuscular mycorrhizal (AM) fungi, Candidatus Glomeribacter gigasporarum, endobacteria, Gigaspora margarita, microbial detection and quantification, real-time quantitative polymerase chain reaction (qPCR), single-copy genes. New Phytologist (2008) 180: 248–257 © The Authors (2008). Journal compilation © New Phytologist (2008) doi: 10.1111/j.1469-8137.2008.02541.x
Introduction Nucleic acid-targeted analyses, and especially polymerase chain reaction (PCR)-based techniques, are widely used for microbial detection and quantification, mainly because of
*These authors contributed equally to the work.
248
their ability to detect DNA at low concentrations. Quantitative real-time PCR (qPCR) has recently emerged for the detection and quantification of microorganisms. Because it is a very powerful, cultivation-independent, rapid and sensitive method, qPCR has been used for the detection of various organisms in a wide range of research fields. For example, qPCR has so far been applied to detect infectious pathogens in plant or animal tissues and clinical specimens (Rantakokko-Jalava & Jalava,
www.newphytologist.org
Methods
2001; Kuoppa et al., 2002; Wang et al., 2003; Watzinger et al., 2006; Ratcliff et al., 2007; Gil-Salas et al., 2007). More recently, this technique has also been used for the detection and quantification of noncultivable microbes (Li et al., 2006; Angelini et al., 2007), for the quantification of microorganisms in environmental samples such as in water (Gilbride et al., 2006) and soil (Sharma et al., 2007), and to characterize microbial communities (Kolb et al., 2003; Tsushima et al., 2006; Zhang & Fang, 2006; Cassler et al., 2007). From the works described in these past few years, it has become increasingly clear that this technique represents a powerful tool to analyse complex biological systems, where different organisms share their lives in such close contact that it is not possible to separate them and/or cultivate them separately. An example of such complexity is given by some arbuscular mycorrhizal fungi (AM) species, which are known to host bacterial populations inside their structures (Bonfante, 2003). Arbuscular mycorrhizal fungi are obligate multinucleated biotrophic organisms, whose growth and hyphal development depend on their symbiotic association with plants, which provide them with mineral nutrients in exchange for carbon compounds (Smith & Read, 1997). Owing to their widespread presence in agricultural and natural soils, they represent an important microbial community of the rhizosphere. Despite the obvious significance of AM fungi in ecosystem functioning, so far little is known about their genetics and the organization of their genomes. The AM fungi are coenocytic, where many nuclei coexist in a common cytoplasm, and this leads to the question of whether they are heterokaryotic (Hijri & Sanders, 2005) or homokaryotic polyploid organisms (Pawlowska & Taylor, 2004). Many Gigasporaceae represent a specialized niche for endocellular bacteria, which are consistently found throughout all the steps of the fungal life cycle. The most extensively studied AM fungus because of its endobacteria, is Gigaspora margarita isolate BEG 34, which was also the first fungus in which these prokaryotic cells were investigated and recognized as a homogeneous population (Bianciotto et al., 1996). On the basis of their ribosomal sequences, the endobacteria have been identified as a new bacterial taxon, Candidatus Glomeribacter gigasporarum (Bianciotto et al., 2003). The status of uncultivable microbe and its small genome (estimated as 1.4 Mb) (Jargeat et al., 2004) strongly suggests that Ca. Glomeribacter gigasporarum is an obligate endocellular bacterium, which is vertically transmitted from one fungal generation to the next (Bianciotto et al., 2004). In a recent study (Lumini et al., 2007), it has been reported how a protocol based on successive in vitro single-spore inocula of G. margarita caused a dilution of the microbial population, leading to bacteria-cured spores. The endobacteria were detected inside the fungus using both microscopy and PCR-based assays. The two methods resulted in a discrepancy in the number of spores detected as positive for the bacterial presence, suggesting a different level of sensitivity. Since only a few protocols are available for microbes living in strict association with their hosts (Wang et al., 2003; Li
Research
et al., 2006; Angelini et al., 2007; Cassler et al., 2007), the aim of this investigation was to establish a quantitative method for the detection of Ca. Glomeribacter gigasporarum inside G. margarita by comparing nested PCR with qPCR. To do this, two genes from the endobacterium (23S rRNA gene and rpoB) and two from the fungus (18S rRNA gene and EF1-α) were chosen as amplification targets. The presumed single-copy status of the rpoB gene used in this analysis allowed us to define the minimum number of bacteria detectable in the fungal spores by qPCR as 10 bacterial genomes, and to indirectly confirm the single-copy status of the 23S rRNA gene. The qPCR method was then applied to other AM fungal structures (i.e. auxiliary cells, intraradical and extraradical mycelium), demonstrating its ability to detect and quantify both fungal and bacterial targets along the fungal life cycle.
Materials and Methods DNA purification Total DNA was extracted from the AM fungus G. margarita Becker and Hall (BEG 34; deposited at the European Bank of Glomeromycota). Spores with and without bacteria (wild type and cured spores) were produced and collected from clover pot cultures, as described in Lumini et al. (2007). The symbiotic fungal structures (i.e. intraradical and extraradical mycelium, and auxiliary cells) were obtained from mycorrhizal roots of Lotus japonicus inoculated using the sandwich method described in Novero et al. (2002) and sampled as described in Lanfranco et al. (2005). Miniprep DNA extraction was performed for fungal spores and auxiliary cells, by crushing pools of 10 units in a volume of 50 µl of 1:1 H2O:10× RedTaq PCR buffer (100 mm TrisHCl, pH 8.3, 500 mm KCl, 11 mm MgCl2 and 0.1% gelatine). After incubation at 95°C for 15 min, the crude extract was centrifuged at 10 000 g for 5 min, and the supernatant was used for 10-fold serial dilutions. Extreme care was taken to avoid external and cross-bacterial contamination, and all steps were carried out under a laminar flow hood. For intraradical and extraradical mycelium the harvested fungal material was immediately frozen in liquid nitrogen (N) and homogenized using a Tissue Lyser mixer mill (Qiagen Inc., Valencia, CA, USA). DNA extraction was then carried out with a DNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s recommendations and with a final elution volume of 50 µl. Primer design In order to detect and quantify the nucleic acid of both the fungus and its bacterial endosymbiont, a ribosomal sequence and a translated specific gene were chosen for each organism as targets in the nested and qPCR assays. All the primers used in this study are listed in Table 1.
© The Authors (2008). Journal compilation © New Phytologist (2008) www.newphytologist.org
New Phytologist (2008) 180: 248–257
249
250 Research
Methods
Table 1 Polymerase chain reaction (PCR) primers used in this study (primers in bold were used in the nested and quantitative PCR, while the others were used in direct PCR)
Bacterial target
Target gene
PCR primer pair (5′–3′)
Expected amplicon size
23S rRNA gene
GlomGIGf: GGGTCCATTGCGGATTACTTC GlomGIGr: GGGACCAGGACTTCCATCCCCC GlomGIGf: GGGTCCATTGCGGATTACTTC GIGrA: GTTGTTGCCCTCTTGACACC rpoBf-TCGCAGCTGTCGCAGTTCAT rpoBr-CGCTGCATGTTCGAGCCCAT RpoBRTf: CGCGGCAAAGTCACGGATAC RpoBRTr: ATCGGTGAGTGCGCCATCCTC NS31: TTGGAGGGCAAGTCTGGTGCC AM1: GTTTCCCGTAAGGCGCCGAA 283f: GAATTTCTACCTTCTGGGGAACT 388r: TCAGACGTAAGCCTGCTTTG Efgigf: CGTTCCAATATCTGGTTGGCATGGTG Efgig2r: GGTAAGACCAACTGGGGCGAATG Efgig2f: TGAACCTCCAACCAGACCAACTG Efgigr: CGGTTTCAACACGACCTACAGGGAC
587 bp
23S rRNA gene rpoB rpoB Fungal target
18S rRNA gene 18S rRNA gene EF1-α EF1-α
One set of primers consisted of the universal eukaryotic primer NS31 (Simon et al., 1992) and the primer AM1, which were designed to amplify AM fungal SSU sequences (Helgason et al., 1998). Primers 283f and 388r (Lanfranco et al., 2005), which amplify a more internal fragment of such a gene, were also used. Three primers designed on the bacterial 23S ribosomal subunit of Ca. Glomeribacter gigasporarum (Acc. No. AJ561042) were used: GlomGIGf/GlomGIGr (Bianciotto et al., 2004) and the internal reverse primer GIGrA (Lumini et al., 2007). Primers Efgigf and Efgig2r were designed on the basis of the gene for the translation elongation factor (EF1-α) that is available in the GenBank for the G. margarita isolate UY278.9 (Acc. No. AJ566400). These primers were used to amplify a 289 bp fragment on G. margarita BEG34 which was sequenced. Two nested primers Efgig2f and Efgigr were then designed. The DNA-direct RNA polymerase β-subunit (rpoB) gene, which codes the RNA polymerase β-subunit, was used to design primers for the endobacterium detection. The rpoB sequences, which are available in the GenBank database, were aligned using the multiple sequence alignment programme clustalw (Thompson et al., 1994). The primers rpoBf and rpoBr were designed to detect a central fragment of 536 bp in the conserved region. On the basis of the sequence obtained, two specific internal primers, rpoBRTf and rpoBRTr, were derived for the nested and qPCR assays. Sample preparation Template DNA samples from both wild type and cured spores were quantified by spectrometry using the Thermo Scientific NanoDropTM ND-1000 instrument (NanoDrop Products, Wilmington, DE, USA), and then serially diluted in molecular
New Phytologist (2008) 180: 248–257
106 bp 536 bp 109 bp 550 bp 106 bp 289 bp 103 bp
grade water until the 10–6 dilution, to evaluate the sensitivity of the primer combinations in nested and real-time PCR assays. Both the nested and qPCR assays were conducted in triplicate, on DNA extracted from three individual pools of 10 spores. DNA samples from auxiliary cells, intraradical and extraradical mycelium were serially diluted until the 10–5 dilution and exclusively applied as template for Real-time qPCR assays. Nested PCR assay For direct PCR, the reactions were carried out both for the fungal and for the bacterial targets as described in Bianciotto et al. (2004), except for the annealing temperature, which was increased to 58°C. For nested PCR, 1 µl of the PCR products obtained in the first round was added as a DNA template to 24 µl of PCR mix. The reaction mixture contained 10 mm Tris-HCl, 50 mm KCl, 1.5 mm MgCl2, 0.1% gelatine, 0.2 mm of each dNTP, 0.5 µm of each primer and 1 U of Taq polymerase. Amplifications were carried out in 0.2 ml PCR tubes using a Biometra TGradient thermocycler (Biometra biomedizinische Analytik GmbH, Goettingen, Germany). The programme consisted of 25 cycles of 45 s at 94°C, 45 s at 60°C, 45 s at 72°C and a final extension of 5 min at 72°C. The resulting PCR products were visualized in a 2.5% high resolution agarose gel using ethidium bromide for visualization with a Versadoc instrument (Biorad). The negative control of the direct PCR was included in the nested reaction to check for contamination or aspecific amplification. Real-time PCR assay Individual real-time qPCR reactions were assembled in a 20 µl reaction volume with 0.15 µm of each oligonucleotide primer,
www.newphytologist.org © The Authors (2008). Journal compilation © New Phytologist (2008)
Methods
10 µl of 2× iQTM SYBR Green Supermix (Bio-Rad, Hercules, CA, USA; containing 100 mm KCl, 40 mm Tris–HCl, pH 8.4, 0.4 mm dNTPs, 50 U µl−1 iTaq DNA polymerase, 6 mm MgCl2, 20 nm SYBR Green I and 20 nm fluorescein) plus 1 µl of appropriate DNA dilution. The PCR cycling programme consisted of 15 s at 95°C followed by 40 s at 60°C repeated for 40 cycles and included a heating step (3 min at 95°C) at the beginning of each run. Real time qPCR was carried out with ICycler apparatus (Bio-Rad). A melting curve (55– 95°C) with a heating rate of 0.5°C per 10 s and a continuous fluorescence measurement was recorded at the end of each run to assess the amplification product specificity (Ririe et al., 1997). All reactions were performed with three technical replicates. Template plasmids containing the target DNA sequences were used to generate a standard curve as an external standard. Plasmids were quantified by spectrometry with the ND-1000 instrument (Nanodrop) and copy numbers were estimated based upon the molecular weight of the template. From 106 to 101 copies of the serially diluted cloned target DNA were included in each run. The number of target DNA sequences present in each PCR mixture was calculated by comparing the crossing points of the samples with those of the standards using the ICycler software (Bio-Rad, Hercules, CA, USA). Nucleotide sequence accession number The partial rpoB and EF1-α sequences have been deposited in the EMBL data library under accession nos. AM886448 and AM889024, respectively.
Results The nucleic acid extracted from the spores and symbiotic structures of Gigaspora margarita, which was the template for the experiments described here, consists of a mixture of fungal and bacterial DNAs. Consequently, the specificity and sensitivity of the primer combinations were tested before the real-time quantification. Furthermore, since Ca. Glomeribacter gigasporarum is, to date considered an unculturable microbe, like its fungal host, plasmids with target DNA inserts were used for the construction of the standard curve for each target gene. After these first steps, serial dilutions of the mixed DNA were used to assess the technical limit of qPCR and nPCR in detecting the endobacterium inside its fungal host, and to quantify the minimum number of bacteria that can be revealed by qPCR. Specificity and sensitivity of real-time assays The specificity of the assays with the primer combinations was evaluated in real-time PCR on the basis of the melting curve obtained for each amplification product. The observation of a unique fluorescence fall at the fusion temperature that was specific for the PCR product showed that only a target-specific
Research
amplification occurred, and that no primer–dimer formation took place. Each primer set reacted well with its intended target (Ct values > 0) and no amplification was observed (Ct values = 0) for the negative controls (not shown). The results demonstrated that the primer combinations were specific for their respective target sequences, and did not show any cross-reactivity with other sequences of either fungal or bacterial origin. Figure 1 shows the fluorescence intensity plots throughout the amplification cycles, using a series of ten-fold dilutions of the total (fungal and bacterial) DNA from G. margarita spores, ranging from 10–1 to 10–5 for all the primer combinations. The linearity of the target quantity with the threshold cycles (Ct) testifies to the absence of an inhibition effect and the sensitivity of the amplification within such a DNA dilution range (Zhang & Fang, 2006). The amplification of the fungal 18S rRNA gene yielded a positive result until the 10–4 dilution of the DNA sample, while the last detectable dilution was 10–3 for the EF1-α gene and the bacterial genes rpoB and 23S. Generation of standard curves from plasmid DNA Starting quantity standard curves (plasmid copy number) vs Ct were used to estimate the target quantities in the DNA samples (Fig. 2a,b for the fungal targets, c and d for the bacterial targets). The PCR fragments obtained for each primer combination used in this study were cloned inside plasmids and the inserts were verified by sequencing. Purified plasmid preparations were quantified using a spectrophotometer and the copy numbers were calculated. Serial plasmid dilutions were applied to each run to define the sensitivity of the method. Since the precision of microbial quantification using qPCR relies on the assumption that the unknown sample and the standard solutions share the same PCR efficiency, we verified whether the PCR efficiency in the analysis of both the standard solutions and samples were the same. As few as 10 copies per reaction were detected for each target sequence, and quantification of the initial copy numbers was linear over a range of 106 to 10 copies of plasmid standard DNA. Detection limit and quantification studies On the basis of the previously described system setup, qPCR was used to detect and quantify fungal and bacterial target sequences. The reactions were conducted on DNA extracted from three individual pools of 10 spores. These three dilution series (from 10–1 to 10–5), which originated from independent extractions, gave similar results, suggesting that the yield of the DNA extractions was similar (data not shown). Three dilution series (from undiluted to 10–5) of DNA extracted from cured spores were also included in the analysis. No signal was detected when the bacterial primers were used, thus confirming the absence of the endobacteria. The Cts obtained
© The Authors (2008). Journal compilation © New Phytologist (2008) www.newphytologist.org
New Phytologist (2008) 180: 248–257
251
252 Research
Methods
Fig. 1 Amplification profiles obtained with the primer combinations for the fungal 18S rRNA gene (a) and EF1-α (b), and the bacterial 23S rRNA gene (c) and rpoB (d). The templates were serial dilutions of total DNA extracted from Gigaspora margarita spores (1, 10–1; 2, 10–2; 3, 10–3; 4, 10–4; 5, 10–5).
when the fungal targets were tested on cured spores were comparable to that from the wild-type spore condition (Table 3). The bacterial detection was performed targeting the 23S rRNA gene and the rpoB genes, which have both recently been predicted to be present in single copy in the Ca. Glomeribacter genome through a sequencing approach which is in progress (S. Ghignone, pers. comm.). Two fungal genes, 18S ribosomal DNA (18S rRNA gene) and elongation factor alpha (EF1-α) were amplified as positive internal controls. The amplification of the 18S rRNA gene yielded a positive result until the 10–4 dilution of the DNA sample, while the last detected dilution was 10–3 for the EF1-α gene. Ribosomal genes are often present in repeated copies in eukaryotes (Perry, 1976; Alkan et al., 2004), and it is still unclear whether G. margarita contains multiple ribosomal sequences in its genome. The EF1-α gene has instead already been used as a single-copy gene in AM fungi phylogenetic studies (Helgason et al., 2003). As shown in Table 2, primers targeting single-copy genes (bacterial rpoB and fungal EF1-α) gave a positive result (Ct > 0) until the same 10–3 DNA dilution, as well as 23S rRNA gene which was therefore predicted to be a single copy gene. On the basis of the resulting standard curve amplification, it was estimated that this 10–3 dilution contains at least 10
New Phytologist (2008) 180: 248–257
target sequence copies. Therefore, as can be inferred for the single-copy genes, it is possible to conclude that the technical limit of qPCR is of 10 genomes for both bacterial and fungal detection in each PCR mixture. This corresponds to the detection of 10 bacterial cells, and, owing to the multinucleate status of G. margarita, to 10 fungal nuclei. For the 18S ribosomal sequence, the last signal in a 10-fold more diluted DNA solution than for the EF1-α gene, that is, in the 10–4 dilution, was always detected. As can be noted in Table 2, the last detected dilution for all the considered primer combinations corresponds to 10 sequence copies per PCR mixture, suggesting that the method is equally sensitive for the detection of both fungal and bacterial targets. Comparison of nested and qPCR Nested PCR assays (nPCR) were performed on the same DNA serial dilutions that were used for the qPCR experiments. As has previously been demonstrated (Lumini et al., 2007), nPCR increased the sensitivity of the conventional PCR to detect Ca. Glomeribacter gigasporarum inside the fungal spores, with an at least 10-fold improvement. The nPCR assay, which was used in this study to detect the endobacterium, showed both high sensitivity and high specificity.
www.newphytologist.org © The Authors (2008). Journal compilation © New Phytologist (2008)
Methods
Research
Fig. 2 Serial dilutions of plasmids with the target DNA insert were used in individual quantitative polymerase chain reaction (PCR) assays to generate standard curves for the 23S rRNA gene (a), rpoB (b), 18S rRNA gene (c) and EF1-α (d). The R2 values and slopes are shown for each reaction.
Table 2 Quantification of the minimum number of target sequences detected with quantitative polymerase chain reaction (PCR) on the basis of the comparison between the threshold cycles (Cts) obtained for the DNA samples and that of the recombinant plasmids used to construct each gene-specific standard curve
Bacterial Fungal
Target gene
Last dilution detected
Ct
Estimated copy number
PCR efficiency (%)
rpoB 23S rRNA gene EF1-α 18S rRNA gene
10–3 10–3 10–3 10–4
34.62 32.66 34.1 32.51
10 10 10 10
107.3 99.2 99.3 102.4
Table 3 Sensitivity of quantitative and nested polymerase chain reaction (qPCR and nPCR, respectively) for the detection of both fungal and bacterial targets
Bacterial targets
Fungal targets
23S rRNA gene
rpoB
DNA serial dilution
qPCR
nPCR
qPCR
10–1 10–2 10–3 10–4 10–5 10–6 Water Cured 10–1
25.84 29.1 32.66 0 0 0 0 0
+ + + − − − − −
28.67 31.91 34.62 0 0 0 0 0
18S rRNA gene
EF1-α
nPCR
qPCR
nPCR
qPCR
nPCR
+ + + − − − − −
23.62 26.79 29.75 32.51 0 0 0 22.91
+ + + + − − − +
28.22 31.56 34.1 0 0 0 0 28.89
+ + + − − − − +
The threshold cycles (Cts) for all the dilutions tested are listed for qPCR; when Ct = 0 no amplification signal was detected. The presence (+) or the absence (−) of a band on an analytical agarose gel is reported for nested PCR. The amplification results of the 10–1 dilution are reported for the cured condition.
© The Authors (2008). Journal compilation © New Phytologist (2008) www.newphytologist.org
New Phytologist (2008) 180: 248–257
253
254 Research
Methods
Fig. 3 Agarose gel electrophoresis patterns of the nested polymerase chain reaction (nPCR) amplification targeting (from left to right) 18S rRNA gene, EF1-α, 23S rRNA gene and rpoB genes. Samples: 0, water; 1–5, DNA dilutions 10–1, 10–2, 10–3, 10–4, 10–5, respectively; L, ladder.
Table 4 Relative quantification of bacterial/fungal single copy targets obtained by quantitative and nested polymerase chain reaction
IM EM AUX
rpoB copy number
EF1-α copy number
rpoB/EF1-α
43 430 35
26 65 19
1.65 6.62 1.84
The gene copy number was calculated by interpolation of the samples’ threshold cycles (Cts) in the standard curve constructed on the plasmid dilutions. The copy number was estimated on the same template dilution for both the bacterial and the fungal target. IM, intraradical mycelium; EM, extraradical mycelium; AUX, auxiliary cells.
All the samples for which nPCR gave positive results were confirmed by qPCR for both fungal and bacterial detection. Even for the lowest target concentration (corresponding to dilutions 10–3/10–4), nPCR amplification products were clearly visible on agarose gel stained with ethidium bromide (Fig. 3). For the 23S rRNA gene, rpoB and EF1-α genes, an amplification signal was obtained until the 10–3 dilution of sporal DNA with both nested and qPCR, while the 18S rRNA gene sequence was also detected in the 10–4 dilution with both techniques. The samples that were found to be negative with nPCR, were also negative with qPCR. Similar sensitivity and specificity were found for qPCR and nPCR, as can be seen in Table 3. This agreement of results indicates that the sensitivity of the nPCR protocol, followed by agarose gel resolution, was comparable to that of qPCR in detecting small amounts of target DNA. Thus, it can be concluded that the detection limit of qPCR is of the order of 10 bacterial genomes for each PCR mixture and, consequently, it is the same as that found with for nPCR. Detection and quantification of bacteria from symbiotic mycelia and auxiliary cells As an additional step, the qPCR method was applied to other AM fungal structures, namely, auxiliary cells (AUX) and extraradical and intraradical mycelium (EM and IM, respectively), in order to assess whether the technique was suitable to detect and quantify both fungal and bacterial targets throughout the fungal life cycle. In accordance with the data obtained from the assays performed on sporal DNA, all the primers succeeded in detecting
New Phytologist (2008) 180: 248–257
as few as 10 target copies in all conditions. All the primer pairs (fungal and bacterial) showed the same behaviour, which had previously been observed for the sporal condition (data not shown). The qPCR methodology, which enables the estimation of the starting target quantities based on the amplification Cts, allows organisms in samples (or nuclei for multinucleate organisms) to be quantified when single-copy genes are considered. This allowed determination of a bacterial–fungal ratio (number of bacteria vs number of fungal nuclei detected) for each sample, by taking the fungal EF1-α and bacterial rpoB quantification into consideration. This ratio can be compared for different samples, so any problem caused by inhomogeneity of the starting material can be overcome. Following this analysis, this ratio was found to be consistently higher in the EM samples than in the IM and AUX samples (Table 4). This interesting difference may suggest that the bacteria/fungal nuclei ratio is higher in the EM sample than in the IM, and AUX samples, suggesting that extraradical mycelium may be a preferential site for bacterial division. The ratio detected in the previous experiment on spores was also consistent with the data obtained from the IM and AUX samples (not shown).
Discussion The assessment of the detection limit is a technical problem of great importance, especially in the diagnostics of infectious agents. Papers have already been published which calculate the detection limit of free-living microbes (Wellinghausen et al., 2001; Nadkarni et al., 2002; Rao et al., 2006): such experiments are usually based on the ‘weight’ of a single bacterial cell with a known genome. In these cases, it is possible to use a quantitative real-time based method for microbe detection, conducting a quantification that is based on the minimum number of detected genome copies. Because of their high sensitivity and discriminatory power, PCR-based techniques represent one of the most frequently used methodologies to study complex biological systems. Here, we demonstrated how a combined approach based on nPCR and qPCR was successful in detecting and quantifying the Ca. Glomeribacter gigasporarum population that lives inside the AM fungus G. margarita. Since Ca. Glomeribacter gigasporarum is to date considered an unculturable microbe, like its fungal host, a plasmid carrying
www.newphytologist.org © The Authors (2008). Journal compilation © New Phytologist (2008)
Methods
the target cloned sequence was used to construct the standard curve for quantification studies. In qPCR, we demonstrated that the last detectable dilution corresponded, in each case, to 10 copies of the target sequences in the plasmid, suggesting that the sensitivity of the method was the same for the detection of both fungal and bacterial targets. Comparisons of nPCR and qPCR have often revealed a different degree of sensitivity, depending on the biological system to which the two techniques were applied (Fang et al., 2002; Anderson et al., 2003; Amos et al., 2007; Angelini et al., 2007). In addition to the level of sensitivity, some practical aspects should be considered: nested PCR assays require up to 5 h 30 min for the first- and second-round PCR amplifications, agarose gel electrophoresis, ethidium bromide staining, and resulting analysis. Real-time PCR can instead be performed in < 1 h in a single capillary tube without opening the reaction tube, thereby significantly reducing the PCR running time and the probability of cross-contamination. Furthermore, the specificity of the qPCR product can be verified simply by analysing the melting temperature after the PCR run. Thus, real-time qPCR provides a rapid and reliable tool for qualitative and quantitative analyses. Here, the results obtained both for the fungal and bacterial detection showed that the sensitivity of the SYBR Green-based qPCR protocol was comparable to that of a nPCR protocol which includes the use of ethidium bromide-stained agarose gel for product visualization in our laboratory conditions (Lumini et al., 2007). The selected genes represent a second original aspect of this study. The rpoB gene was used for the first time, in addition to ribosomal sequence 23S, for the detection of the endobacterium. While the ribosomal operon may be present in multiple copies in prokaryotes, the rpoB gene is considered a single-copy gene. The DNA-direct RNA polymerase β-subunit (rpoB) gene, which encodes the RNA polymerase β-subunit, is a highly conserved housekeeping gene, and is present in all bacteria because of its essential role in cellular metabolism (Qi et al., 2001). It has been used as a signature for bacterial identification and, because of its discriminatory power, as a locus for phylogenetic analysis (Mollet et al., 1997). Both the selected bacterial genes (23S rRNA gene and rpoB) are predicted to be present in Ca. Glomeribacter gigasporarum as single-copy genes, on the basis of the currently ongoing sequencing project (S. Ghignone, pers. comm.). In both cases, a positive amplification signal (Ct > 0) was obtained until the 10–3 sporal DNA dilution, which corresponds to the detection of 10 target copies. This finding suggests that they are present in the bacterial genome in a 1 : 1 ratio, strengthening the belief that they are present in single copy. The detection and amplification of bacterial sequences in diluted templates from symbiotic mycelia and auxiliary cells offer novel information on the bacterial life cycle: the comparable fungal/bacterial ratios detected in spores, intraradical mycelium and auxiliary cells suggest that the bacteria keep their dealings with the fungal component more or less constant, regardless of whether they are contained inside spores, auxiliary cells or
Research
mycorrhizal roots. The fungal/bacterial ratio detected in the extraradical mycelium instead suggests that these structures may be the preferential site for bacterial division, according to unpublished results (I. A. Anca et al., unpublished). Even though the primary aim of this investigation was bacterial detection and its quantification inside the fungal host, the simultaneous amplification of two fungal targets (18S rRNA gene and EF1-α) offered some additional information on the fungal side. A number of studies have used 18S rRNA to study and detect AM fungi with molecular biology techniques (Simon et al., 1993; Trouvelot et al., 1999; Kuhn et al., 2001; Alkan et al., 2004; Alkan et al., 2006). Since it has not yet been stated how many copies of ribosomal sequences are present in G. margarita, and given that ribosomal genes are often present in repeated copies in eukaryotes (Perry, 1976; Alkan et al., 2004), a protein coding gene that is usually present in single copy was also chosen for our analysis. The EF1-α gene encodes the translation elongation factor that controls the rate and fidelity of protein synthesis (Baldauf et al., 1996) and it has already been used as a single-copy gene to study AM fungal phylogeny (Helgason et al., 2003). We always detected the last amplification signal from the 18S rRNA gene in a 10-fold more diluted DNA solution than for the EF1-α gene; this could mean that the two genes are represented in the G. margarita genome with a ratio of c. 10 : 1. This fact suggests that multiple copies of ribosomal sequences could be present in AM fungi, confirming the results obtained by other authors with the fluorescence in situ hybridization (FISH) technique (Trouvelot et al., 1999; Kuhn et al., 2001). Interestingly, the detection limit of both the fungal genes was unchanged in the cured spores compared to the wild type, confirming that the repeated monosporal fungal generations, required to originate the cured line, did not have a dramatic impact on the fungal genome organization (Lumini et al., 2007). In conclusion, our results offer a first attempt to reply to a clear need for the establishment of methods that allow quantification of the bacteria interacting with eukaryotic hosts in the fields of medical and environmental microbiology. Leveau & Preston (2008) recently reviewed many complex biological systems where bacteria develop specific strategies to obtain nutrients from fungi, with important ecological consequences in many environments. Since one of the priorities in this context is to demonstrate the impact of the bacteria on the structure and activity of fungal communities, the development of methodologies to quantify the bacterial presence is a priority. The method we have developed opens new perspectives to face such problems, since the experimental set-up described can be used to follow not only bacteria, but also the eukaryotic partner throughout all the life cycle stages. Owing to the high sensitivity of the method (as few as 10 fungal nuclei can be potentially detected), this study represents a step forward concerning the use of PCR based-techniques for AM fungi traceability, as it allows the detection of short hyphal fragments in environmental samples.
© The Authors (2008). Journal compilation © New Phytologist (2008) www.newphytologist.org
New Phytologist (2008) 180: 248–257
255
256 Research
Methods
Acknowledgements This work was supported by IPP-CNR (AG-P02-006 Biodiversity Project-Torino), Compagnia di San Paolo, SOILSINK Project (FISR), ENDURE NoE EU project and TRACEAM EU project (MEST-CT-2005-021016). E.L. was funded by SOILSINK.
References Alkan N, Gadkar V, Coburn J, Yarden O, Kapulnik Y. 2004. Quantification of the arbuscular mycorrhizal fungus Glomus intraradices in host tissue using real-time polymerase chain reaction. New Phytologist 161: 877–885. Alkan N, Gadkar V, Yarden O, Kapulnik Y. 2006. Analysis of quantitative interactions between two species of arbuscular mycorrhizal fungi, Glomus mosseae and G. intraradices, by real-time PCR. Applied and Environmental Microbiology 72: 4192–4199. Amos BK, Sung Y, Fletcher KE, Gentry TJ, Wu WM, Criddle CS, Zhou J, Loffler FE. 2007. Detection and quantification of Geobacter lovleyi strain SZ: implications for bioremediation at tetrachloroethene- (PCE-) and uranium-impacted sites. Applied and Environmental Microbiology AEM 55: 384–394. Anderson TP, Beynon KA, Murdoch DR. 2003. Comparison of real-time PCR and conventional hemi-nested PCR for the detection of Bordetella pertussis in nasopharyngeal samples. Clinical Microbiology and Infection 9: 746–749. Angelini E, Luca Bianchi G, Filippin L, Morassutti C, Borgo M. 2007. A new TaqMan method for the identification of phytoplasmas associated with grapevine yellows by real-time PCR assay. Journal of Microbiological Methods 68: 613–622. Baldauf SL, Palmer JD, Doolittle WF. 1996. The root of the universal tree and the origin of eukaryotes based on elongation factoráphylogeny. Proceedings of the National Academy of Sciences, USA 93: 7749–7754. Bianciotto V, Bandi C, Minerdi D, Sironi M, Tichy HV, Bonfante P. 1996. An obligately endosymbiotic mycorrhizal fungus itself harbors obligately intracellular bacteria. Applied and Environmental Microbiology 62: 3005–3010. Bianciotto V, Genre A, Jargeat P, Lumini E, Becard G, Bonfante P. 2004. Vertical transmission of endobacteria in the arbuscular mycorrhizal fungus Gigaspora margarita through generation of vegetative spores. Applied and Environmental Microbiology 70: 3600–3608. Bianciotto V, Lumini E, Bonfante P, Vandamme P. 2003. ‘Candidatus Glomeribacter gigasporarum’ gen. nov., sp. nov., an endosymbiont of arbuscular mycorrhizal fungi. International Journal of Systematic and Evolutionary Microbiology 53: 121–124. Bonfante P. 2003. Plants, mycorrhizal fungi and endobacteria: a dialog among cells and genomes. Biological Bulletin 204: 215–220. Cassler M, Peterson C, Ledger A, Pomponi S, Wright A, Winegar R, McCarthy P, Lopez J. 2007. Use of real-time qPCR to quantify members of the unculturable heterotrophic bacterial community in a deep sea marine sponge, Vetulina sp. Microbial Ecology 73: 6898–6904. Fang Y, Wu WH, Pepper JL, Larsen JL, Marras SAE, Nelson EA, Epperson WB, Christopher-Hennings J. 2002. Comparison of real-time, quantitative PCR with molecular beacons to nested PCR and culture methods for detection of Mycobacterium avium subsp. paratuberculosis in bovine fecal samples. Journal of Clinical Microbiology 40: 287–291. Gilbride KA, Lee DY, Beaudette LA. 2006. Molecular techniques in wastewater: understanding microbial communities, detecting pathogens, and real-time process control. Journal of Microbiological Methods 66: 1–20. Gil-Salas FM, Morris J, Colyer A, Budge G, Boonham N, Cuadrado IM, Janssen D. 2007. Development of real-time RT-PCR assays for the detection of Cucumber vein yellowing virus (CVYV) and Cucurbit yellow stunting disorder virus (CYSDV) in the whitefly vector Bemisia tabaci. Journal of Virological Methods 146: 45–51.
New Phytologist (2008) 180: 248–257
Helgason T, Daniell TJ, Husband R, Fitter AH, Young JPW. 1998. Ploughing up the wood-wide web? Nature 394: 431. Helgason T, Watson IJ, Young JPW. 2003. Phylogeny of the Glomerales and Diversisporales (Fungi: Glomeromycota) from actin and elongation factor 1-alpha sequences. Fems Microbiology Letters 229: 127–132. Hijri M, Sanders IR. 2005. Low gene copy number shows that arbuscular mycorrhizal fungi inherit genetically different nuclei. Nature 433: 160–163. Jargeat P, Cosseau C, Ola’h B, Jauneau A, Bonfante P, Batut J, Becard G. 2004. Isolation, free-living capacities, and genome structure of ‘Candidatus Glomeribacter gigasporarum,’ the endocellular bacterium of the mycorrhizal fungus Gigaspora margarita. Journal of Bacteriology 186: 6876–6884. Kolb S, Knief C, Stubner S, Conrad R. 2003. Quantitative detection of methanotrophs in soil by novel pmoA-targeted real-time PCR assays. Applied and Environmental Microbiology 69: 2423–2429. Kuhn G, Hijri M, Sanders IR. 2001. Evidence for the evolution of multiple genomes in arbuscular mycorrhizal fungi. Nature 414: 745–748. Kuoppa Y, Boman J, Scott L, Kumlin U, Eriksson I, Allard A. 2002. Quantitative detection of respiratory Chlamydia pneumoniae infection by real-time PCR. Journal of Clinical Microbiology 40: 2273–2274. Lanfranco L, Novero M, Bonfante P. 2005. The mycorrhizal fungus Gigaspora margarita possesses a CuZn superoxide dismutase that is up-regulated during symbiosis with legume hosts. Plant Physiology 137: 1319–1330. Leveau JHJ, Preston GM. 2008. Bacterial mycophagy: definition and diagnosis of a unique bacterial–fungal interaction. New Phytologist 177: 859–876. Li WB, Hartung JS, Levy L. 2006. Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. Journal of Microbiological Methods 66: 104–115. Lumini E, Bianciotto V, Jargeat P, Novero M, Salvioli A, Faccio A, Becard G, Bonfante P. 2007. Presymbiotic growth and sporal morphology are affected in the arbuscular mycorrhizal fungus Gigaspora margarita cured of its endobacteria. Cellular Microbiology 9: 1716–1729. Mollet C, Drancourt M, Raoult D. 1997. rpoB sequence analysis as a novel basis for bacterial identification. Molecular Microbiology 26: 1005–1011. Nadkarni MA, Martin FE, Jacques NA, Hunter N. 2002. Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology-Sgm 148: 257–266. Novero M, Faccio A, Genre A, Stougaard J, Webb KJ, Mulder L, Parniske M, Bonfante P. 2002. Dual requirement of the LjSym4 gene for mycorrhizal development in epidermal and cortical cells of Lotus japonicus roots. New Phytologist 154: 741–749. Pawlowska TE, Taylor JW. 2004. Organization of genetic variation in individuals of arbuscular mycorrhizal fungi. Nature 427: 733–737. Perry RP. 1976. Processing of RNA. Annual Review of Biochemistry 45: 605–630. Qi Y, Patra G, Liang X, Williams LE, Rose S, Redkar RJ, DelVecchio VG. 2001. Utilization of the rpoB gene as a specific chromosomal marker for real-time PCR detection of Bacillus anthracis. Applied and Environmental Microbiology 67: 3720–3727. Rantakokko-Jalava K, Jalava J. 2001. Development of conventional and real-time PCR assays for detection of Legionella DNA in respiratory specimens. Journal of Clinical Microbiology 39: 2904–2910. Rao RU, Atkinson LJ, Ramzy RMR, Helmy H, Farid HA, Bockarie MJ, Susapu M, Laney SJ, Williams SA, Weil GJ. 2006. A real-time PCR-based assay for detection of Wuchereria bancrofti DNA in blood and mosquitoes. American Journal of Tropical Medicine and Hygiene 74: 826–832. Ratcliff R, Chang G, Kok T, Sloots T. 2007. Molecular diagnosis of medical viruses. Current Issues in Molecular Biology 9: 87–102. Ririe KM, Rasmussen RP, Wittwer CT. 1997. Product differentiation
www.newphytologist.org © The Authors (2008). Journal compilation © New Phytologist (2008)
Methods by analysis of DNA melting curves during the polymerase chain reaction. Analytical Biochemistry 245: 154–160. Sharma S, Radl V, Hai B, Kloos K, Mrkonjic Fuka M, Engel M, Schauss K, Schloter M. 2007. Quantification of functional genes from procaryotes in soil by PCR. Journal of Microbiological Methods 68: 445–452. Simon L, Bousquet J, Le’vesque RC, Lalonde M. 1993. Origin and diversification of endomycorrhizal fungi and coincidence with vascular land plants. Nature 363: 67–69. Simon L, Lalonde M, Bruns TD. 1992. Specific amplification of 18S fungal ribosomal genes from vesicular–arbuscular endomycorrhizal fungi colonizing roots. Applied and Environmental Microbiology 58: 291–295. Smith SE, Read DJ. 1997. Mycorrhizal symbiosis, 2nd edn. London: Academic Press. Thompson JD, Higgins DG, Gibson TJ. 1994. clustal w: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673–4680. Trouvelot S, van Tuinen D, Hijri M, Gianinazzi-Pearson V. 1999.
Research
Visualization of ribosomal DNA loci in spore interphasic nuclei of glomalean fungi by fluorescence in situ hybridization. Mycorrhiza 8: 203–206. Tsushima S, Shinohara H, Nakazato T, Ando S, Sugisawa T, Tabei Y. 2006. Phylogenetic analysis of Xanthomonas albilineans strains from Okinawa, Japan, through a comparison of the gyrB and rpoD genes in geographically distinct strains. Journal of Phytopathology 154: 683–687. Wang GQ, Liveris D, Brei B, Wu HY, Falco RC, Fish D, Schwartz I. 2003. Real-time PCR for simultaneous detection and quantification of Borrelia burgdorferi in field-collected Ixodes scapularis ticks from the northeastern United States. Applied and Environmental Microbiology 69: 4561–4565. Watzinger F, Ebner K, Lion T. 2006. Detection and monitoring of virus infections by real-time PCR. Molecular Aspects of Medicine 27: 254–298. Wellinghausen N, Frost C, Marre R. 2001. Detection of legionellae in hospital water samples by quantitative real-time lightcycler PCR. Applied and Environmental Microbiology 67: 3985–3993. Zhang T, Fang HHP. 2006. Applications of real-time polymerase chain reaction for quantification of microorganisms in environmental samples. Applied Microbiology and Biotechnology 70: 281–289.
About New Phytologist • New Phytologist is owned by a non-profit-making charitable trust dedicated to the promotion of plant science, facilitating projects from symposia to open access for our Tansley reviews. Complete information is available at www.newphytologist.org. • Regular papers, Letters, Research reviews, Rapid reports and both Modelling/Theory and Methods papers are encouraged. We are committed to rapid processing, from online submission through to publication ‘as-ready’ via Early View – our average submission to decision time is just 29 days. Online-only colour is free, and essential print colour costs will be met if necessary. We also provide 25 offprints as well as a PDF for each article. • For online summaries and ToC alerts, go to the website and click on ‘Journal online’. You can take out a personal subscription to the journal for a fraction of the institutional price. Rates start at £135 in Europe/$251 in the USA & Canada for the online edition (click on ‘Subscribe’ at the website). • If you have any questions, do get in touch with Central Office (
[email protected]; tel +44 1524 594691) or, for a local contact in North America, the US Office (
[email protected]; tel +1 865 576 5261).
© The Authors (2008). Journal compilation © New Phytologist (2008) www.newphytologist.org
New Phytologist (2008) 180: 248–257
257
