Conservation Genet Resour DOI 10.1007/s12686-009-9004-0
TECHNICAL NOTE
Single copy nuclear DNA markers for the onychophoran Phallocephale tallagandensis Chester J. Sands Æ Melanie L. Lancaster Æ Jeremy J. Austin Æ Paul Sunnucks
Received: 7 April 2009 / Accepted: 13 April 2009 ! Springer Science+Business Media B.V. 2009
Abstract For some species, particularly invertebrates, developing single copy nuclear markers is an expensive and time-consuming task that may result in few or no usable markers. This has proven true for Onychophora (velvet worms). Here we describe our PCR-based method of generating single copy nuclear markers in Onychophora—a phylum comprised of species generally regarded as rare and of high conservation value—for which suitable microsatellites have been difficult to obtain. We list 6 primer pairs, some of which amplify across genera, and demonstrate their utility in identifying strong population structure in the species Phallocephale tallagandensis. Keywords Marker development ! Anonymous single copy nuclear markers ! Population genetics ! Microsatellite ! Onychophora
Genetic markers inherited in a Mendelian fashion are used to infer population structure, inbreeding, effective C. J. Sands Department of Genetics, La Trobe University, Bundoora, VIC 3086, Australia M. L. Lancaster ! J. J. Austin School of Earth and Environmental Sciences, University of Adelaide, Adelaide, SA 5005, Australia P. Sunnucks School of Biological Sciences and Australian Centre for Biodiversity, Monash University, Clayton, VIC 3800, Australia C. J. Sands (&) British Antarctic Survey, High Cross, Madingley Road, Cambridge CB3 0ET, UK e-mail:
[email protected]
population sizes, migration rates, sex-biased dispersal and relatedness (Garrick and Sunnucks 2006; Luikart and England 1999). Currently the most frequently used codominant markers are microsatellites, which are typically numerous and highly variable. However, they often have to be isolated de novo for new species, particularly invertebrate species, which tend to have large divergences even among congenerics. For some taxa, microsatellite development remains problematic (Megle´cz et al. 2007). Sunnucks and Wilson (1999) isolated five microsatellite loci from the Onychophoran Euperipatoides rowelli. Despite a great deal of optimization, one of these loci remains difficult to score, two failed to amplify on reordering primers (multiple times), and two have high frequency null alleles. Further attempts to develop successful onychophoran microsatellite loci have failed, despite cloning of apparently suitable sequences and development of many tens of primer pairs. Attempts to clone microsatellites from diverse Onychophora, including Phallocephale tallagandensis, have met with similar outcomes. These poor outcomes are unusual in our laboratory, and we consider these difficulties to be related to the taxon. Brief investigation into the failure of microsatellite development identified considerable variation, often insertion/deletion (indel) events, in flanking regions when allele sequences were aligned. As an alternative approach to microsatellite development we used failed microsatellite primers at low stringency annealing conditions to screen a range of individual templates with visualization via autoradiography in order to identify putative alleles behaving in a Mendelian like fashion. Here we demonstrate the utility of actively pursuing such loci in the Onychophoran Phallocephale tallagandensis, and via additional means provide two other primer pairs that amplify across all tested Australian Peripatopsidae.
123
123
Phallocephale, Ruhbergia, Euperipatoides, Ooperipatus 0.40 0.17 0.06 From Brower and DeSalle (1998) a
Na Number of alleles, HO observed heterozygosity, HE expected heterozygosity
3 45 AGCTTCCCGAGTGTTAGTGG Wingless
ACTICGCRCACCARTGGAATGTRCAa
No
Phallocephale, Ruhbergia, Euperipatoides, Ooperipatus 0.55
0.46 0.27
0.24 0.17
0.17 2
11 56
48
GTGAGGCTGCTGGAAAAATTC FTz intron
CAAATCCGTTGTCTGTAAATATG
ACACTGCCTAGAAACTTGCCTTCC P36iiPt
AATTTATCATGGTGCAGTACAGC
Ruhbergia brevicorna, R. rostroides Ruhbergia bifalcata, R. brevicorna, R. rostroides 0.53 0.70 0.26 0.17 0.12 0.13 7 6 45 62 GCTTTTGCTCACAAATTATTTGTAAGC CCAAGGCATGGACAATGT P18L2 P31L2
ATCCATGCYAATCTCCCACCTCC GCCGGTAGTCGCAATAAC
Ruhbergia bifalcata, R. brevicorna, R. rostroides 0.38 0.37 0.26 5 50 AATTTGAATCTCTTTTCTACTTCTTCC EPt17
TTCATATCGGCATTGTTTTCC
FST HE HO Na Anneal temperature Reverse (50 –30 ) Forward (50 –30 ) Locus
Primers
Table 1 New onychophoran primer sets designed on alignments of multiple alleles screened on 276 Phallocephale tallagandensis
DNA was extracted from 8 geographically dispersed P. tallagandensis individuals. PCRs were undertaken with microsatellite primers developed for E. rowelli (Sunnucks and Wilson 1999) that amplified a single product in the clone they were designed from, but were unscorable or gave no product from genomic DNA. Primers were tailed with M13 motifs to increase yield (Regier and Shi 2005), read length and quality of sequence in later steps. Low stringency radio-labelled PCR reactions were conducted to maximise primer annealing. Ten ll reactions contained:*20 ng genomic DNA, 16 lM ammonium sulphate, 68 mM Tris-HCl (pH 8), 10 mM b-mercaptoethanol, 5% bovine serum albumin (10 mg/ml), 2-4 mM magnesium chloride, 200 lM of each of dGTP, dTTP and dCTP, 30 lM dATP, 0.05 ll [a33P]-dATP, 0.5 lM each primer and 0.5 units of Taq DNA Polymerase. Thermocycling conditions were 94"C for 2 min followed by 35 cycles of 94"C for 20 s, 40–45"C for 20 s and 72"C for 30 s followed by a final 2 min extension at 72"C. Products were run on denaturing 6% polyacrylamide gels, and revealed by autoradiography during which the dried gel and X-ray film were stapled together to facilitate accurate re-alignment. Where putative size-variable alleles with recognisable heterozygotes were identified from the developed film, allele bands were excised and DNA eluted into 20 ll of 0.19 TE and reamplified using the same primers under similar conditions as above but with 50"C annealing temperature, 200 lM each dNTP and no radioisotope. Products were sequenced directly using the M13 tail. Sequences were aligned and primers designed in conserved regions around indels thus reducing the chance of null alleles. By applying this technique to the onychophoran Phallocephale tallagandensis we have developed primers for four anonymous, co-dominant, single-copy nuclear markers (Table 1) with some cross amplification in Ruhbergia species. By using an alignment of sequences from multiple onychophoran species, we have designed specific primers to amplify an intron in the Fushi Tarazu (FTz) gene (Rockman et al. 2001) that are likely to work across the Peripatopsidae. We have identified 11 alleles in Phallocephale tallagandensis and expect that it will make a good marker in further onychophoran population genetic studies. Similarly we have designed an Onychophora-specific primer for the Wingless gene based on products amplified across genera using degenerate primers of Brower and DeSalle (1998). Performance was evaluated in 276 Phallocephale tallagandensis sampled from the entire range of the species (Tallaganda and Badja forests of the Gourock Range, southeast New South Wales, Australia). Some caution must be used when evaluating loci for onychophorans due
Cross species application
Conservation Genet Resour
Conservation Genet Resour
only locus to not display LD. Departures from HWE were still significant in for P18L2 in northern and central populations, and P36ii and Wg in the Central population once again likely to be due to further population sub-structuring. Given the very fine scale of endemism in Phallocephale tallagandensis, crypsis has serious implications regarding conservation status.
Fig. 1 Bayesian genotype clustering of 6 single copy nuclear loci screened from 276 individual Phallocephale tallagandensis taken from the entire known range of its distribution. Individuals are columns arranged in geographic order from north to south. Y-axis scale provides membership coefficient. The analysis indicated that most individuals were strongly associated with one of three genetic groups
to the violation of assumptions generally implied in the relevant tests. Phallocephale, as with other onychophorans, are reliant on the moist conditions of decaying log habitat from which they rarely (if ever) disperse from, likely to result in population structure at very fine spatial scales. Indeed, Bayesian clustering of the six loci (STRUCTURE v2, Pritchard et al. 2000) indicates very strong geographic population structure in this species, possibly cryptic speciation (Fig. 1). In our dataset the sex ratio was substantially skewed in favour of females (3:1). We are also detecting sex biased dispersal (unpublished data). Heterozygosity and fixation indices were obtained using GenAlEx v6 (Peakall and Smouse 2006). No locus shows evidence of hemizygosity in either sex (heterozygotes in both sexes for all loci), implying no sex-linkage. An excess of homozygotes for each locus was identified leading to significant departures from Hardy Weinberg equilibrium (HWE). Linkage disequilibrium (LD) was also detected in all loci. Re-evaluating the data for each population separately reduced LD to the central population only, with FTz the
Acknowledgments We thank Ryan Garrick, Christina Schmuki and David Runciman for laboratory discussions. The work in this manuscript was supported by a Holsworth Wildlife Trust grant to CJS and ARC Discovery grant DP0211156 to PS and DM Rowell.
References Brower AVZ, DeSalle R (1998) Patterns of mitochondrial versus nuclear DNA sequence divergence among nymphalid butterflies: the utility of wingless as a source of characters for phylogenetic inference. Insect Mol Biol 7:73–82 Garrick RC, Sunnucks P (2006) Development and application of three-tiered nuclear genetic markers for basal Hexapods using single-stranded conformation polymorphism coupled with targeted DNA sequencing. BMC Genet 7:15 Luikart G, England PE (1999) Statistical analysis of microsatellite data. Trends Ecol Evol 14:253–256 Megle´cz E et al (2007) Microsatellite flanking region similarities among different loci within insect species. Insect Mol Biol 16:175–185 Peakall R, Smouse PE (2006) GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes 6:288–295 Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155:945–959 Regier JC, Shi D (2005) Increased yield of PCR product from degenerate primers with nondegenerate, nonhomologous 50 tails. BioTechniques 38:34–38 Rockman MV, Rowell DM, Tait NN (2001) Phylogenetics of Planipapillus, lawn-headed onychophorans of the Australian Alps, based on nuclear and mitochondrial gene sequences. Mol Phylogenet Evol 21:103–116 Sunnucks P, Wilson ACC (1999) Microsatellite markers for the onychophoran Euperipatoides rowelli. Mol Ecol 8:899–900
123
