Site-Specific Mutations in Vectors That Express ... - Journal of Virology

JOURNAL OF VIROLOGY, OCt. 1988, p. 3729-3737

Vol. 62, No. 10

0022-538X/88/103729-09$02.00/0 Copyright ©) 1988, American Society for Microbiology

Site-Specific Mutations in Vectors That Express Antigenic and Temperature-Sensitive Phenotypes of the M Gene of Vesicular Stomatitis Virus YAN LI, LIZHONG LUO, RUTH M. SNYDER, AND ROBERT R. WAGNER* Department of Microbiology and Cancer Center, University of Virginia School of Medicine, Charlottesville, Virginia 22908 Received 25 April 1988/Accepted 1 July 1988

Full-length cDNA copies of mRNAs coding for the matrix (M) proteins of vesicular stomatitis virus and its were cloned in pBSM13- (BlueScribe). The authenticity of these clones was demonstrated by restriction enzyme mapping, DNA sequencing, and in vitro transcription and translation to identify the two M proteins by Western immunoblotting with epitope-specific monoclonal antibodies. Site-directed mutants were constructed by primer extension of synthetic oligodeoxynucleotides with one or two nucleotide changes to alter the glycine at amino acid 21 of the wild-type (wt) M gene to glutamic acid, alanine, or proline. Similarly, a revertant was created in the M gene of mutant ts023 by a Glu-21->Gly substitution. A series of wt- and mutant-M-gene chimeras was also constructed to create mutant and revertant clones with Leu-*Phe and His--Tyr alterations at amino acids 111 and 227, respectively. We then moved the wt and ts023 M genes and their site-specific mutants and chimeras cloned in pBSM13- into the eucaryotic expression vector pTF7 directed by the T7 bacteriophage RNA polymerase of the vaccinia virus recombinant vTF1-6,2. Western blot analysis of the M proteins transiently expressed in CV-1 cells by plasmids carrying M genes altered at amino acid 21 revealed that the critical antigenic determinant (epitope 1) is expressed only by the Gly-21 M protein and not by Glu-21, Ala-21, or Pro-21 M proteins. Of particular interest is an apparent conformational change, evidenced by slightly but significantly retarded electrophoretic migration, in plasmid-expressed M proteins with amino acids substituted for glycine at position 21. The glutamic acid at position 21 of tsO23 is not responsible for its temperature-sensitive phenotype, because a tsO23 revertant plasmid with glycine substituted at position 21 fails to rescue tsO23 virus in cells infected at the restrictive temperature; conversely, plasmids expressing wt M protein with substitutions of glutamic acid, alanine, or proline at position 21 are just as effective in marker rescue of tsO23 as is the Gly-21 wt M protein. Marker rescue experiments with wt- and mutant-M-gene chimeras support the hypothesis of K. Morita, R. Vanderoef, and J. Lenard (J. Virol. 61:256263, 1987) that the temperature-sensitive phenotype of tsO23 is due to a phenylalanine substituted for leucine at amino acid 111, rather than the His-227-*Tyr substitution or the Gly-21--*Glu substitution, which independently accounts for the loss of epitope 1 in the mutant M protein of tsO23. Vectors expressing greater amounts of M protein are necessary to locate the region of the tsO23 M gene responsible for loss of the transcription inhibition phenotype. mutant ts023(III)

to amino acid substitutions widely distributed throughout 60% of the M gene. Of particular interest to us is the group III mutant ts023, the M protein of which completely loses both epitope 1 and its transcription inhibition activity (17). The M gene of mutant ts023 has been found to differ from that of the wild type (wt) (Orsay strain) by three nucleotide changes leading to three amino acid substitutions, as follows: Gly-*Glu at position 21, Leu->Phe at position 111, and His--Tyr at position 227 (14). We have confirmed the Gly-21-->Glu substitution by direct amino acid sequencing of wt and ts023 M proteins (J. B. Shipley and R. R. Wagner,

The matrix (M) protein of vesicular stomatitis virus (VSV) plays important roles in virus assembly (22, 27, 28) and down regulation of viral transcription (2, 4, 29). Monoclonal antibody (MAb) directed to one of four antigenic determinants (epitope 1) specifically reverses transcription inhibition by M protein (17). Enzymatic and chemical cleavages of M protein localized much of the transcription inhibition activity within the first 43 N-terminal amino acids and epitope 1 in a region between amino acids 18 and 43 (15). Studies with synthetic oligopeptides corresponding to M-protein amino acid sequences indicate that epitope 1 is located between amino acids 17 through 31, whereas the transcription-inhibitory activity is located, at least partially, within the first 20 N-terminal amino acids (24). Of considerable interest are early studies which indicate that various temperature-sensitive mutants of VSV in complementation group III contain M protein which exhibits a nonconditional loss in the phenotype for inhibition of VSV transcription (2, 29). Morita et al. (14) have sequenced some of these mutants and many revertants by primer cDNA extension and found spontaneous nucleotide changes leading *

unpublished data). Moreover, substitution of glutamic acid for glycine at position 21 in a synthetic pentadecapeptide corresponding to M-protein amino acids 17 through 31 was found to have lost its antigenic specificity and its unique ,B-bend structure (24). The current experiments represent an attempt to identify the specific nucleotide changes in the M gene and amino acid substitutions in the M protein of wt VSV (Orsay strain) that result in conversion to the temperature-sensitive phenotype or the loss of an antigenic determinant in the mutant tsO23. These experiments were performed by molecular cloning of full-length cDNA copies of the entire coding region for the M

Corresponding author. 3729

3730

J. VIROL.

LI ET AL.

proteins of wt Orsay VSV and mutant ts023 in pBSM13and by introducing site-directed mutations and wt-mutant chimeras into these clones. The wt, ts mutant, chimeras, and site-specific mutant clones were transferred to the vaccinia virus T7-polymerase vector of Fuerst et al. (6) and transiently expressed in CV-1 cells by previously described methods (11). MATERIALS AND METHODS Cells, viruses, and plasmids. wt VSV (Orsay strain, Indiana serotype) and the temperature-sensitive Orsay group III mutant tsO23 were kindly provided by A. Flamand, Faculte des Sciences, Universite de Paris-Sud, Orsay, France. All stocks were plaque purified. Viruses were grown in BHK-21 cells and isolated and purified as described previously (17, 18). Purified virions were stored at -70°C until further use. Recombinant vaccinia virus vTF1-6,2 that expresses T7 RNA polymerase and vaccinia expression vector pTF7IHB1 were both designed by Fuerst et al. (6) and kindly provided by B. Moss. Plasmid pBSM13- (BlueScribe M13-) was obtained from Stratagene Cloning Systems, San Diego, Calif.). Preparation of VSV Orsay wt and tsO23 mutant mRNA. VSV mRNAs were synthesized by in vitro transcription in a 20-ml reaction mixture exactly as described by Rose and Gallione (20). After virion transcription for 3 h, the reaction was stopped by addition of sodium dodecyl sulfate (SDS) and sodium acetate to final concentrations of 1% and 0.5 M, respectively. The entire mixture was then passed through a column containing 0.25 g of oligo(dT)-cellulose (type 3; Collaborative Research, Inc., Waltham, Mass.); the column was then washed with 15 ml of 0.4 M sodium acetate. The bound polyadenylated mRNA was eluted with distilled water, precipitated with ethanol, dissolved in H20, and stored at -80°C. Approximately 250,ug of mRNA was obtained for each reaction. Synthesis and cloning of cDNA. Reverse transcription of cDNAs from wt VSV Orsay and tsO23 mutant RNA was performed by using a cDNA synthesis kit (Amersham Corp., Arlington Heights, Ill.), exactly following the manufacturer's protocol, except that 10 pLg of mRNA was heated at 70°C for 1 min and rapidly chilled on ice prior to cDNA synthesis. After transcribing the first and second strand, the doublestranded cDNA was purified by phenol-chloroform (1:1), ethanol precipitated, and then subjected to 1.5% agarose gel electrophoresis. A cDNA band which is similar in size to that expected for M and NS mRNA was isolated by electroblotting onto NA-45 DEAE membranes (Schleicher & Schuell, Inc., Keene, N.H.). Plasmid vector pBSM13- was digested to completion with SmaI and dephosphorylated with calf intestinal alkaline phosphatase. The purified M and NS cDNAs (which have blunt ends) were ligated to the SmaI site of pBSM13- at 26°C for 4 h and used to transform competent Escherichia coli JM109 cells (9). The transformed cells were plated on LB medium containing 100 ,ug of ampicillin per ml, 40 ,g of X-Gal (5-bromo-4-chloro-3-indolyl-3-D-galactopyranoside) per ml, and 1 mM IPTG (isopropyl-p-D-thiogalactopyranoside). The colonies containing the desired recombinant plasmid were identified by the method of Grunstein and Hogness (7). The plasmids were prepared from the isolated colonies by a rapid isolation procedure and analyzed for their size, partial restriction maps, and orientation of inserted DNA (13). Site-directed mutagenesis. The procedure described in the Stratagene kit was used to prepare single-stranded DNA

isolated from E. coli JM101 cells containing pBSM13plasmids with wt M or ts023 M cDNA inserts after infection with helper bacteriophage R408. Site-specific mutations were produced by in vitro primer extension of complementary synthetic oligodeoxynucleotides with single-base substitutions by using the protocol described in the Amersham kit with the following modifications. (i) Primer oligodeoxynucleotide (6 pmol) was hybridized to5,ug of single-stranded template DNA in a total volume of 34,ul. (ii) Digestion with exonuclease III was performed at 37°C for 5 min, instead of 30 min. (iii) After ligation of DNA gaps, 3,ul of each reaction mixture was used to transform competent JM109 cells. Screening mutant M-gene clones. Certain mutant plasmid clones (created by primer extension) were directly identified by PvuI restriction mapping of DNA isolated from JM109 mini-preps; these two oligonucleotide primers were designed to create the new PvuI restriction site. For screening other mutant clones, colonies of each were picked and then grown overnight at 37°C in 5 ml of LB medium containing 50 p.g of ampicillin per ml without IPTG. Cells from overnight cultures were lysed in a buffer containing 2% SDS, 62.5 mM Tris hydrochloride (pH 6.8), 10% glycerol, 5% mercaptoethanol, and 0.01% bromphenol blue and heated at 100°C for 3 min. The contents were then applied to 12.5% polyacrylamide-SDS gels (10). After separation, the proteins were transferred by electroblotting to nitrocellulose sheets (26) and visualized by binding the indicated monoclonal antibody and then 125I-labeled staphylococcal protein A, followed by autoradiography (18). All single-base mutants had the expected mutations verified by DNA sequencing. Subcloning into vaccinia virus transient-expression system and immunoblot analysis. cDNA inserts of wt, ts023, and their corresponding mutated M genes were excised from pBSM13- clones with BamHI and KpnI, blunt-ended with Klenow polymerase and T4 DNA polymerase, and recloned into the BamHI site of the vaccinia virus expression vector pTF7 blunt-ended with Klenow polymerase, as described previously (11). The resulting recombinant plasmids, with the appropriate M cDNA insert in the correct orientation, were selected by XbaI and BglII digestions. Transientexpression assays and immunoblot analyses of the synthesized M proteins were performed exactly as described by Li et al. (11). Marker rescue. These experiments were performed as described by Li et al. (11). Briefly, CV-1 cells were grown to 80% confluence in 35-mm-diameter plates and infected with the VSV tsO23 mutant at a multiplicity of 1 PFU per cell for 30 min at room temperature. The inoculum was then removed, and 2 ml of minimal essential medium containing 5% fetal bovine serum was added to each plate. The infected cells were incubated at 39°C for 2 h. At 2.5 h after infection, the cells were reinfected with vaccinia virus vTF1-6,2 at a multiplicity of 30 PFU per cell at 39°C for 1 h and then transfected with 15 ,ug of calcium phosphate-precipitated plasmid DNA. The plates were further incubated at 39°C for 14 h, the medium was harvested, and virus yield was titrated by plaque assay on L-cell monolayers at both 31 and 39°C. RESULTS

Cloning M genes in pBSM13-. In order to compare the genotypes and phenotypes of wt and mutant VSV M genes, it was necessary to clone them in a vector suitable for their sequencing, expression, and induction of site-specific base changes. For these purposes, we chose pBSM13- (BlueScribe), similar to the plasmid designed by Dente et al. (5),

VOL. 62, 1988

SITE-SPECIFIC MUTANTS OF VSV M GENE 42

10

pYL-OM79 pYL-tsM23

48

103

3731

374

5'-CACAATCTAAGTGTTATCCCAATCCATTCATCATG---CCC---GGG-----TTG--Gly Leu Pro 5'-GTTATCCCAATCCATTCATCATG---TCC---GAG-----TTT--Ser 720

731

Glu

Phe 778

pYL-OM79

--CAC---TGAGCTAGTCTAACTTCTAGCTTCTGAACAATCCCCGGTTTACTCAGTCT

pYL-tsM23

--TAC---TGAGCTAGTCTAACTTCTAGCTTCTGAACAATCCCCGGTTTACTCAGTCT Tyr

His

779

839

pYL-OM79

CTCCTAATTCCAGCCTCTCGAACAACTAATATCCTGTCTTTTCTATCCCTATGAAAAAAAA-3

pYL-tsM23

CTCCTAATTCCAGCCTCTCGAACAACTAATATCCTGTCTTTTCTATCCCTATGAAAAAA-3

FIG. 1. Comparative nucleotide sequences of VSV Orsay wt and tsO23 M genes cloned in pYL-OM79 and pYL-tsM23. Only the noncoding sequences are shown for both the wt M gene and for homologous noncoding regions of the tsO23 M gene. The coding sequences of the wt and tsO23 M genes are not shown but were found to be identical to the corresponding consensus sequences for the M-gene region of Orsay wt and ts023 virion RNAs reported by Morita et al. (14), except for a C rather than a T at nucleotide 48. Also shown here are nucleotides in the coding region that differ for the cDNAs of the wt and tsO23 M-gene inserts. The nucleotide numbers correspond to the numerical system used by Rose and Gallione (20).

which possesses all these properties. In order to obtain full-length cDNA copies of the mRNA that translates complete M protein, we produced in vitro VSV transcripts as described in Materials and Methods. These intact viral mRNAs provided templates for reverse transcriptase synthesis of cDNA, representing the M gene and other VSV genes, as described by Gubler and Hoffman (8) and further developed by Amersham. After second-strand DNA synthesis and treatment with T4 polymerase to remove any small remaining 3' overhangs, the blunt-ended, double-stranded DNAs were subjected to electrophoresis on 1.5% agarose gels to determine their sizes. The M and NS DNAs were isolated by electroblotting onto NA-45 DEAE membranes and inserted into the SmaI site of pBSM13 -. E. coli JM109 cells were then transformed with these pBSM13- recombinants, and ampicillin-resistant white colonies were selected for analysis by colony hybridization. The plasmid DNAs from these hybridization-positive E. coli colonies were analyzed for size and orientation by BamHI and KpnI excision and then by XbaI and BglII partial restriction mapping. By comparing these restriction maps with previous data (14, 20), we were able to assign each recombinant clone unambiguously to either the Orsay wt M gene or the mutant tsO23 M gene (data not shown). Subsequent research was performed with one clone each from the wt M-gene or tsO23 M-gene pBSM13- recombinants designated, respectively, pYL-OM79 and pYL-tsM23. Nucleotide sequence and expression of M genes in E. coli. The nucleotide sequences of wt and tsO23 M genes inserted in plasmids pYL-OM79 and pYL-tsM23, respectively, were determined by primer extension and the dideoxy-chain termination method (3, 21). Synthetic oligodeoxynucleotides homologous to the T7 and T3 regions of pBSM13- were obtained from Stratagene and were used as primers for sequencing the nucleotides corresponding to the 5'- and 3'-noncoding regions of each M gene. In addition, four synthetic oligodeoxynucleotides homologous to M-gene nucleotide sequences 36 through 50, 195 through 208, 392 through 406, and 545 through 559, as numbered by Rose and

Gallione (20), were used to sequence the coding regions of the two M genes. Figure 1 shows the entire noncoding sequences flanking the M-gene coding regions of the wt plasmid pYL-OM79 and the mutant plasmid pYL-tsM23, as well as those nucleotides in the coding region which are different for the wt and tsO23 M genes. The wt M-gene DNA inserted in pYL-OM79 consists of 830 nucleotides extending from positions 10 through 839, whereas the tsO23 M-gene DNA inserted in pYL-tsM23 consists of 816 nucleotides extending from nucleotides 22 through 837, according to the numbering system of Rose and Gallione (20). Comparison of the pYL-OM79 and pYL-tsM23 M-gene sequences reveals three nucleotide changes in the ts023 M gene compared with the wt M gene, as follows: G--A at nucleotide 103, leading to a Gly--Glu substitution at amino acid 21; G-T at nucleotide 374, leading to a Leu--Phe substitution at amino acid 111; and a C-*T at nucleotide 720, leading to a His--Tyr substitution at amino acid 227. These M-gene sequences in pYL-OM79 and pYL-tsM23 are identical to the corresponding consensus sequences reported by Morita et al. (14) for the respective M genes of wt VSV Orsay and tsO23 with only one exception. Our wt M gene has a C, rather than a T, at nucleotide 48, as reported by Morita et al. (14), resulting in a Ser-*Pro change in amino acid 3; our tsO23 M gene has a T at nucleotide 48 as did the tsO23 M gene sequenced by Morita et al. (14). Five separate clones of our wt Orsay strain all revealed a C at position 48. This difference in the two Orsay wt strains in our laboratory and that of John Lenard is attributable to the high degree of spontaneous mutability of the VSV genome (23, 25). To verify this C--T difference at nucleotide 48 between our sequence and that of Morita et al. (14), we sequenced the entire M-gene region of VSV Orsay wt genomic RNA by primer extension as previously described for the G gene (12). These genomic sequence results confirmed location of a C at nucleotide 48, rather than the T found by Morita et al. (14) for their Orsay wt strain. In addition, the sequences in the noncoding regions of our Orsay wt and tsO23 M cDNAs are

3732

*

LI ET AL.

11 b_

FIG. 2. Western blot analysis of wt and ts023 fusion M proteins in E. coli cells on reaction with three epitope-specific MAbs. E. coli JM109 cells transformed with plasmids pYL-OM79 or pYL-tsM23 were grown in the presence of ampicillin (50 jig/ml), pelleted, solubilized, and subjected to electrophoresis on a 12.5% polyacrylamide-SDS slab gel along with marker M protein (150 ng) extracted from VSV virions. The proteins were transferred to a nitrocellulose sheet by electroblotting and exposed to individual MAbs, MAb2 (specific for epitope 1), MAb3 (specific for epitope 2), and MAb25 (specific for epitope 3). Autoradiographs were prepared after exposure to 251I-labeled staphylococcal protein A. Lanes: 1, purified VSV virion M protein; 2, extract of cells transformed with pYL-OM79; 3, extract of cells transformed with pYL-tsM23.

expressed

the same as those reported by Rose and Gallione (20) for the San Juan strain M gene cloned in pM309, except for the eight and six extra adenylic acids at the respective 3' ends; also, there is an A, rather than a G, at nucleotide 13. The sequence data for pYL-OM79 and pYL-tsM23 also revealed that the wt and tsO23 M-gene inserts are positioned in the same reading frame as that of the lacZ gene. Therefore, it was possible to express both the wt and tsO23 M genes in pYL-OM79 and pYL-tsM23 plasmid-transformed E. coli and to detect the respective M proteins by their reactivity with MAbs. Figure 2 shows Western blot (immunoblot) autoradiograms of the M proteins of the VSV virion and of M

proteins expressed in E. coli by pYL-OM79 and pYL-tsM23 following reaction with three epitope-specific MAbs. The wt M protein expressed by pYL-OM79 was readily recognized by MAbs to all three epitopes, but epitope 1-specific MAb2 failed to react with tsO23 M protein expressed by pYLtsM23. This loss of epitope 1 in the M protein of tsO23 was originally described by Pal et al. (17) and was attributed to a Gly-+Glu substitution in amino acid 21 of the mutant M protein. MAb2 (but not MAb3 or MAb25) also reacted nonspecifically with a higher-molecular-weight protein in the pYL-OM79 and pYL-tsM23 expression systems (Fig. 2), which was also present in extracts of E. coli cells transformed with control pBSM13- not containing any M gene (data not shown). The slower migration of the fusion M protein is clearly attributable to its 40 additional amino acids, which adds -4.8 kilodaltons to its estimated molecular mass. As noted, the M protein expressed by pYL-tsM23 differed slightly in its mobility from that of pYL-OM79 M protein. By far the strongest affinity for both pYL-OM79and pYL-tsM23-expressed M proteins was exhibited by epitope 2-specific MAb3, which also reacted with lowermolecular-weight proteins, presumably cleavage products. For unknown reasons, the binding of epitope 3-specific MAb25 to M proteins expressed by plasmids pYL-OM79 and

J. VIROL.

pYL-tsM23 was weak in a manner not unlike that of M protein expressed by vaccinia virus vectors in mammalian CV-1 cells (11). Despite these unexplained aberrations, these findings provide a convenient means for screening the antigenic determinants of M protein expressed in E. coli by cloned genes with site-directed mutations as recounted below. Construction of M-gene vectors and wt-tsO23 chimeras coding for amino acid substitutions at positions 21, 111, and 227. It was of interest to determine whether amino acids other than glycine at position 21 of the pBSM13- M-gene recombinant would affect the antigenic and other properties of the expressed M protein. Predictions made by BrandtRauf et al. (1) on the basis of energy minimization computer modeling of the dodecapeptide from Lys-15 to Pro-26 of the M protein revealed marked conformational changes when glutamic acid, alanine, or proline was substituted for glycine at position 21 of the wt M protein; these amino acid substitutions, leading to altered conformations, could explain the loss of epitope 1 and transcription-inhibitory activity resulting from the Gly-21-*Glu substitution (17). In order to test some of these predictions, we set out to construct altered pYL-OM79 and pYL-tsM23 expression vectors by making site-directed mutations in inserted wt and tsO23 M genes by oligodeoxynucleotide primer extension at the Nterminal regions. Four synthetic oligonucleotide primers were used to create one revertant and three site-directed mutants at nucleotides 103 and 102 (Fig. 1). The revertant pYL-tsM23(R1) was created by using primer 5'-GAAATTAGGGATCGCAC CAC-3', which is complementary to the tsO23 M-gene nucleotides 95 through 114 of pYL-tsM23 except for a mismatch (G for A) at nucleotide 103, resulting in a Gly, rather than a Glu, at residue 21. The primer 5'-GAAATTA GAGATCGCACCAC-3', complementary to nucleotides 95 through 114 of the pYL-OM79 M gene except for a mismatch (A for G) at nucleotide 103, was used to create mutant pYL-OM79(Glu2l). The primer 5'-GAAATTAGCGATCG CACCAC-3', complementary to pYL-OM79 M gene nucdeotides 95 through 114 except for a C at position 103, was used to create mutant pYL-OM79(Ala2l). Lastly, mutant pYL-OM79(Pro2l) was created by use of primer 5'AGAAATTACCGATCGCACCACCCC-3', complementary to pYL-OM79 M-gene nucleotides 94 through 117 except for two mismatched bases at nucleotides 102 and 103, giving rise to a proline at residue 21. These site-directed mutant plasmids constructed by primer extension were screened by Western blotting and/or by restriction mapping as described in Materials and Methods. One clone from each Glu-21, Ala-21, and Pro-21 sitedirected mutant plasmid and the Glu-21->Gly revertant plasmid were used for transient expression in the vaccinia virus vectors. The question arises whether antigenic and temperaturesensitive phenotypes of the mutant ts023 M protein are affected by its other amino acid substitutions: Leu-*Phe at position 111 and His->Tyr at position 227, as well as the Gly--Glu substitution at position 21. For this purpose, we constructed four chimeras of the M genes of wt and tsO23 viruses, by using a strategy outlined in Fig. 3. The DNAs of the four wt-mutant chimeras and the aforementioned four site-directed mutants were sequenced and were found to have the expected nucleotide changes in the correct reading frame. Transient expression of wt and mutant M genes cloned in a vaccinia virus vector. We previously reported (11) ample

SITE-SPECIFIC MUTANTS OF VSV M GENE

VOL. 62, 1988

3733

A. pYL-OM79

pYL-OM79(Phe1 11)

Gly 21

Leu A

Gly

His 227

111

21

Phe

His 227

Leu 11l

Tyr 227

Leu

Tyr

Phe 111

227 %_I

1.-i

A

Bgg Bg

258 358

pYL-tsM23 Glu 21

stut

\

652

Construct Chknresi M Phe

Tyr 227

1

pYL-tsM23(R2) GkI 21

_

I

Bgg BgU 258 358

Stul

652

B. pYL-OM79

pYL-OM79(Tyr227) Gly

21_111

227

pYL-tsM23(R3) -

-

-

Glu 21

His

_

I

Stul

KprI

652

FIG. 3. Construction of wt-ts023 M-gene chimeras pYL-OM79(Phelll), pYL-tsM23(R2), pYL-OM79(Tyr227), and pYL-tsM23(R3). (A) Restriction fragments, generated by exposure separately of pYL-OM79 and pYL-tsM23 to BglIl and StuI, were separated by electrophoresis on 1.5% agarose gels, electroblotted onto DEAE membranes, and purified by phenol-chloroform extraction, followed by ethanol precipitation. The two small pYL-tsM23 restriction fragments containing the Phe-111 site were ligated by T4 ligase to the large pYL-OM79 restriction fragment missing the Leu-111 site to form pYL-OM79(Phelll). Conversely, the two small pYL-OM79 restriction fragments were religated with T4 ligase to the large BglII-StuI fragment to form plasmid pYL-tsM23(R2) with a Leu-111 revertant site. (B) Plasmids pYL-OM79 and pYL-tsM23 were also separately restricted by StuI and KpnI, and each was fractionated and purified by the same techniques before ligating the small pYL-tsM23 restriction fragment to the large pYL-OM79 restriction fragment to form pYL-OM79(Tyr227). Conversely, the small StuI-KpnI restriction fragment of pYL-OM79 containing the His-227 site was religated with T4 ligase to the large pYL-tsM23 restriction fragment to form the revertant pYL-tsM23(R3). The DNAs of all resulting chimeric plasmids were sequenced to confirm the validity of each of the four constructs that were selected for experimentation. The multicloning sites of pBSM13- (- ) are shown.

expression of authentic, unfused M proteins by M genes cloned in the pTF7 plasmid in cells coinfected with the vaccinia virus recombinant vTF1-6,2 described by Fuerst et al. (6). By methods previously described (11), the M-gene sequences in pYL-OM79 (wt), pYL-tsM23 (tsO23 mutant), and the four site-directed revertants or mutants pYLtsM23(R1), pYL-OM79(Glu21), pYL-OM79(Ala2l), and pYL-OM79(Pro2l), as well as the chimeric plasmids pYLOM79(Phelll), pYL-OM79(Tyr227), pYL-tsM23(R2), and pYL-tsM23(R3), were recloned into the BamHI site of pTF7IHB1 flanked by the 410 promoter and T4X terminator. These M-gene plasmids are designated pTF7-OM79(wt), pTF7-tsM23(tsO23), pTF7-tsM23(R1), pTF7-OM79(Glu21), pTF7-OM79(Ala21), pTF7-OM79(Pro21), pTF7-OM79(Phe111), pTF7-OM79(Tyr227), pTF7-tsM23(R2), and pTF7tsM23(R3), corresponding to the pYL plasmids. Under conditions previously established (11), wt and mutant M proteins were synthesized in vTF1-6,2-infected and plasmidcotransfected CV-1 cells and detected by Western blotting with M-protein epitope-specific MAbs. Figure 4 illustrates the Western blot autoradiograms of pTF7 plasmid-expressed wt, mutant, revertant, and chimeric M proteins after exposure to MAbs specific for epitope 1 (Fig. 4A and C) or epitope 2 (Fig. 4B and D). The cloned wt

protein expressed by pTF7-OM79 (Fig. 4A and B, lanes 5) exhibited exactly the same electrophoretic mobility as did the authentic virion 26-kilodalton M protein used as the marker (lanes 1). wt Gly-21 M protein expressed by pTF7OM79 (Fig. 4A, lane 5) reacted with epitope 1-specific MAb2 but the tsO23 Glu-21 M protein expressed by pTF7-tsM23 did not (lane 2), in just the same manner as the M proteins present in wt and tsO23 virions (17). Similarly, the M protein expressed by pTF7-OM79(Glu2l), with its Gly-21--Glu amino acid substitution, failed to react with MAb2 but strongly reacted with MAb3 (Fig. 4A and B, lanes 4). These Glu-21-*Gly and Gly-21---Glu substitutions clearly reaffirm the evidence that glycine 21 determines the antigenic specificity of epitope 1, rather than leucine 111 or histidine 227 of wt M protein, which also undergo amino acid substitutions in the M protein of tsO23 (14). We also tested pTF7-OM79(Ala2l) and pTF7-OM79 (Pro2l) for the capacity of their expressed M proteins to react with MAb2 (epitope 1) and MAb3 (epitope 2). These site-directed mutations in the wt M gene (Gly-21->Ala and Gly-21--Pro) were prompted by the studies of Brandt-Rauf et al. (1), who predicted, on the basis of computerized minimal energy conformation, that alanine at position 21 should provide a conformation similar to that of the tsO23 M

3734

LI ET AL.

j

,

AN

* /

J. VIROL.

'~

/i

0

2

1

3

4

5

6

7

8

9

1

2

t

MM

2

3

4

5

6

7

4

5

6

7

8

d

Am-

C. MAb2 ( Epitope 1 )

A. MAb2 ( Epitope 1 ) 1

3

8

9

1

2

almoks-

3

4

6

6

7

8

..am

400

D. MAb3 ( Epitope 2 ) B. MAb3 ( Epitope 2 ) FIG. 4. Western blot analysis of M proteins transiently expressed in CV-1 cells transfected with T7 polymerase-directed plasmid recombinants of M genes from wt, tsO23, site-directed mutants, and chimeric plasmids. CV-1 cells were infected with 30 PFU of vTF1-6,2 (recombinant vaccinia virus expressing T7 RNA polymerase) per cell and transfected with 15 ,ug of each plasmid, as indicated. Cells incubated at 37°C were lysed 24 h after infection; the lysates were subjected to electrophoresis on 12.5% polyacrylamide-SDS slab gels and transferred to nitrocellulose sheets by electroblotting. In panels A and C, M proteins were reacted with MAb2 (specific for epitope 1), and in panels B and D, M proteins were reacted with MAb3 (specific for epitope 2) before exposure to 125I-labeled staphylococcal protein A and autoradiography. Lanes 1 contain purified VSV (San Juan strain) virion M protein (arrow). (A and B) Lanes 2 through 8 were loaded with extracts of cells transfected with wt or tsO23 plasmids with or without site-directed mutations, as indicated. (C and D) Lanes 2 through 8 were loaded with extracts of cells transfected with wt or ts023 plasmids, or wt-mutant chimeras, as indicated. The plasmid pTF7-M3 shown in lane 8 (A and B) refers to the VSV Indiana wt M-gene construct as previously described (11).

protein with glutamic acid at position 21. On the other hand, it was also predicted that proline at position 21 should provide a global minimum conformation not at all like that for the Glu-21 or Ala-21 peptides but somewhat more like that of the wt Gly-21 peptide, at least to some degree (1). Figure 4A reveals that neither alanine (lane 6) nor proline (lane 7) substituted for glycine at position 21 was capable of restoring epitope 1 to wt M protein expressed by pTF7OM79(Ala2l) or pTF7-OM79(Pro2l), both of which reacted strongly with MAb3 (Fig. 4B), assuring the presence of epitope 2 in the M protein. It appears, therefore, that the presence of glycine at position 21 is essential for conferring on M protein the conformation required for expressing epitope 1. Of considerable interest in Fig. 4B was the consistent and reproducible finding that expressed mutant M proteins with glutamic acid at position 21 always migrated slightly slower than Gly-21 wt M protein (compare lanes 2 and 4 with lanes 1, 3, and 5 in Fig. 4B). Not only the ts023 M protein expressed by pTF7-tsM23 but also the Gly-21--Glu substitution in wt M protein expressed by pTF7-OM79(Glu2l) exhibited the slower mobility, indicating that the hindered migration was not due to amino acid substitutions Leu111->Phe or His-227-*Tyr in the tsO23 M protein. Moreover, the site-directed Glu-21-*Gly revertant pTF7-

tsM23(R1) resulted in expression of an M protein that migrated identically to that of wt Orsay or San Juan M protein (compare lanes 3, 5, and 8 in Fig. 4B). It should also be noted that these plasmid-expressed M proteins contain the identical number of amino acids and, hence, should have the same molecular weight. Of further interest is the evidence that the site-directed mutant plasmids pTF7OM79(Ala2l) and pTF7-OM79(Pro2l), identical in molecular size to pTF7-OM79(Glu2l), expressed M proteins that migrated to a position somewhat intermediate to that of the wt M protein of pTF7-OM79 and mutant Glu-21 M protein (compare lanes 4, 5, 6, and 7 in Fig. 4B). These data strongly suggest that the presence of glutamic acid in position 21, rather than glycine, alanine, or proline, results in retardation of M-protein electrophoretic migration. This retarded migration of the Glu-21 M protein could be due to the negative charge of glutamic acid. An alternative explanation for the retarded migration of the Glu-21 M protein is altered conformation, predicted by Brandt-Rauf et al. (1) to be an ot-helix in the region of the Glu-21 peptide, a 3-bend in the region of the Gly-21 peptide, and an a-helix disruption in the region of a Pro-21 peptide. However, they also predict an Ala-21 peptide structure similar to that of the Glu-21 peptide, which is not consistent with the migration of the Ala-21 M protein faster than that of the Glu-21 mutant M protein. Completely

VOL. 62, 1988

SITE-SPECIFIC MUTANTS OF VSV M GENE

3735

TABLE 1. Comparative rescue of M-protein mutant ts023 by transfecting plasmids expressing site-mutated M genes or wt-mutant chimeric M genes with different amino acid substitutionsa Expressed M gene and transfecting plasmid

Site-mutated M genes None pTF7-tsM23 pTF7-tsM23(Rl) pTF7-OM79 pTF7-OM79(Glu2l) pTF7-0M79(Ala2l) pTF7-OM79(Pro2l) wt-mutant chimeras None pTF7-tsM23

pTF7-tsM23(R2) pTF7-tsM23(R3) pTF7-OM79 pTF7-OM79(Phelll) pTF7-OM79(Tyr227)

Yield of virus (PFU/ml) 310C

5.0 3.2 2.0 3.5 3.2 6.7 8.0 6.5 4.6 7.8 7.9 8.5 5.9 7.9

102

39°C

x

104

His substitution at position 227 of ts023. DISCUSSION By means of site-directed mutations leading to expression of M protein with amino acid substitutions at position 21, we were able to test some of the predictions made by BrandtRauf et al. (1) concerning conformational changes in this region that could alter MAb2 recognition of epitope 1. A Gly-21--Glu substitution in M protein cloned in and expressed by pTF7-OM79(Glu2l) led to disappearance of epitope 1, as did expressed M proteins with alanine or proline substituted for glycine at position 21. Glu-21-*Gly substitution in mutant M protein expressed by the revertant plasmid pTF7-tsM23(R1) restored epitope 1, as evidenced by binding of MAb2. These data support the hypothesis, based on computerized minimal energy conformations of the M-protein peptides from Lys-15 to Pro-26, that predicts that glycine at position 21 results in a p-bend, possibly critical for expressing epitope 1, whereas glutamic acid or alanine at position 21 would be expected to lose epitope 1 because the global minimal energy of such a peptide should assume the shape of an ox-helix (1). The prediction that proline at position 21 might result in a peptide much like that of the Gly-21 peptide and would perhaps recognize MAb2 was not borne out by our experiments. Somewhat unexpectedly, amino acid substitutions at position 21 of plasmid-expressed M proteins resulted in their altered mobility on electrophoresis in polyacrylamide-SDS gels (Fig. 4B), a difference that had been noted previously between the virion M proteins of VSV wt and ts023 (14). All plasmid-expressed M proteins with glutamic acid at position 21 migrated slower than M proteins expressed by pTF7tsM23(R1) or pTF7-OM79 with glycine at position 21. This could be due to difference in charge of the two amino acids

J. VIROL.

but is also likely to result from the more compact P-bend conformation of the Gly-21 M protein than the extended a-helix of the Glu-21 M protein, whose gel migration would be expected to be retarded. Recent studies by Ono et al. (16) have shown that M proteins produced in cells infected with two other group III mutants, tsG31 or tsG33, aggregate at the perinuclear region at nonpermissive temperatures but diffuse throughout the cytoplasm at permissive temperatures. Although we have no direct evidence for these temperature-dependent phenomena for mutant ts023 M protein, it may well be that this observation explains the failure of group III mutant M proteins to promote VSV maturation at restrictive temperatures. We were able to demonstrate in the experiments presented here that wt M protein expressed in CV-1 cells by pTF7-OM79 was able to rescue ts023 at the restrictive temperature but that mutant M protein expressed by pTF7tsM23 could not. These experiments indicate that the plasmid-expressed wt and mutant M proteins are phenotypically similar to their respective virion wt and ts023 M proteins. Our studies also support the conclusion advanced by Ono et al. (16) that the normal functions of M protein in VSV maturation do not appear to be dependent on the activities of other VSV proteins. Our studies clearly indicate that the Gly-21-*Glu substitution in the M protein of ts023 is not responsible for the temperature-sensitive phenotype that results in abortive maturation of VSV mutant virions at the restrictive temperature. Clearly, plasmids expressing M genes that are genotypically wt, except for glutamic acid, alanine, or proline substituted for glycine at position 21, all complement ts023 at the restrictive temperature. Also, the revertant plasmid pTF7-tsM23(R1), in which the Glu-21---Gly substitution restores epitope 1, fails to rescue coinfecting ts023 at the nonpermissive temperature. Further marker rescue experiments with wt-mutant chimeric plasmids clearly show that a Leu-*Phe substitution at amino acid 111, rather than the Gly-*Glu substitution at amino acid 21 or the His--Tyr substitution at amino acid 227, confers the temperaturesensitive phenotype on mutant ts023. These data lend credence to the hypothesis advanced by Morita et al. (14) that the temperature-sensitive phenotype of ts023, and perhaps other group III mutants, is due to the Leu-*Phe substitution at amino acid 111. The common denominator in all of our marker rescue experiments was successful complementation of tsO23 when the plasmid-expressed M protein contained a leucine and not a phenylalanine at amino acid position 111. At this stage of our studies, we have not been able to identify conclusively the genotype of M protein which endows it with the phenotype for down regulation of VSV transcription (2, 4, 29). Morita et al. (14) have identified three mutations in the M gene of tsO23 and at different sites in other group III mutant M proteins restricted in transcription inhibition; quite a few revertants, with amino acid substitutions at sites far distant from the original mutational sites, partially restore transcription-inhibitory activity to mutant M proteins. However, in no case is transcription inhibition or its loss by mutation a temperature-dependent event. In fact, there is no good correlation between reversion of temperature-sensitive phenotype and restoration of M-protein transcription-inhibitory activity. Our earlier studies, in which M-protein transcription inhibition is reversed by a MAb specific for epitope 1, suggest that the transcription inhibition site of M protein is located at its amino-terminal end (15). Studies by Shipley et al. (24) indicate that a

VOL. 62, 1988

synthetic oligopeptide corresponding to the first 20 amino acids of wt M protein inhibits VSV transcription in vitro, whereas a synthetic oligopeptide representing epitope 1 and corresponding to M-protein amino acids 17 through 31 does not inhibit transcription. These preliminary data provide reasonable sites on the M-protein gene for site-directed mutagenesis and expressing products that can be tested for defects in transcription inhibition activity. However, further refinements in our techniques are required to construct vectors that express wt and mutant M proteins in sufficient quantities and purity to assay reliably their transcriptioninhibitory activity. ACKNOWLEDGMENTS This research was supported by Public Health Service grants AI-11112 and AI-21652 from the National Institute of Allergy and Infectious Diseases and by grant MV-9 from the American Cancer Society. We again express our gratitude to Bernard Moss and Thomas Fuerst for graciously supplying the vaccinia virus vectors. LITERATURE CITED 1. Brandt-Rauf, P. W., M. R. Pincus, J. Maizel, R. P. Carty, J. Lubowsky, M. Avitable, J. B. Shipley, and R. R. Wagner. 1987. Structural effects of amino acid substitutions on the matrix protein of vesicular stomatitis virus. J. Protein Chem. 6:463472. 2. Carroll, A. R., and R. R. Wagner. 1979. Role of the membrane (M) protein in endogenous inhibition of in vitro transcription by vesicular stomatitis virus. J. Virol. 29:134-142. 3. Chen, E. Y., and P. H. Seeburg. 1985. Supercoil sequencing: a fast and simple method for sequencing plasmid DNA. DNA 4: 165-170. 4. Clinton, G. M., S. P. Little, F. S. Hagen, and A. S. Huang. 1978. The matrix (M) protein of vesicular stomatitis virus regulates transcription. Cell 15:1455-1462. 5. Dente, L., G. Cesaren, and R. Cortese. 1983. pEMBL: a new family of single-stranded plasmids. Nucleic Acids Res. 11:16451655. 6. Fuerst, T. R., E. G. Niles, F. W. Studier, and B. Moss. 1986. Eukaryotic transient expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. USA 83:8122-8126. 7. Grunstein, M., and D. S. Hogness. 1975. Colony hybridization: a method for the isolation of cloned DNA's that contain a specific gene. Proc. Natl. Acad. Sci. USA 72:3961-3965. 8. Gubler, U., and B. J. Hoffman. 1983. A simple and very efficient method for generating cDNA libraries. Gene 25:263-269. 9. King, P. V., and R. W. Blakesley. 1986. Optimizing DNA ligations for transformation. Focus (BRL) 8:1-3. 10. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London)

227:680-685. 11. Li, Y., L. Luo, R. M. Snyder, and R. R. Wagner. 1988. Expression of the M gene of vesicular stomatitis virus cloned in various vaccinia virus vectors. J. Virol. 62:776-782. 12. Luo, L., Y. Li, R. M. Snyder, and R. R. Wagner. 1988. Point mutations in glycoprotein gene of vesicular stomatitis virus

(New Jersey serotype) selected by resistance to neutralization by epitope-specific monoclonal antibodies. Virology 163:341348.

SITE-SPECIFIC MUTANTS OF VSV M GENE

3737

13. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 14. Morita, K., R. Vanderoef, and J. Lenard. 1987. Phenotypic revertants of temperature-sensitive M protein mutants of vesicular stomatitis virus: sequence analysis and functional characterization. J. Virol. 61:256-263. 15. Ogden, J. R., R. Pal, and R. R. Wagner. 1986. Mapping regions of the matrix protein of vesicular stomatitis virus which bind to ribonucleocapsids, liposomes, and monoclonal antibodies. J. Virol. 58:860-868. 16. Ono, K., M. E. Dubois-Dalcq, M. Schubert, and R. A. Lazzarini. 1987. A mutated membrane protein of vesicular stomatitis virus has an abnormal distribution within the infected cell and causes defective budding. J. Virol. 61:1332-1341. 17. Pal, R., B. W. Grinnell, R. M. Snyder, and R. R. Wagner. 1985. Regulation of viral transcription by the matrix protein of vesicular stomatitis virus probed by monoclonal antibodies and temperature-sensitive mutants. J. Virol. 56:386-394. 18. Pal, R., B. W. Grinnell, R. M. Snyder, J. R. Wiener, W. A. Volk, and R. R. Wagner. 1985. Monoclonal antibodies to the M protein of vesicular stomatitis virus (Indiana serotype) and to a cDNA M gene expression product. J. Virol. 55:298-306. 19. Pringle, C. R. 1987. Rhabdovirus genetics, p. 167-243. In R. R. Wagner (ed.), The rhabdoviruses. Plenum Publishing Corp., New York. 20. Rose, J. K., and C. J. Gallione. 1981. Nucleotide sequences of the mRNA's encoding the vesicular stomatitis virus G and M proteins determined from cDNA clones containing the complete coding regions. J. Virol. 39:519-528. 21. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 22. Schnitzer, T. J., and H. F. Lodish. 1979. Noninfectious vesicular stomatitis virus particles deficient in the viral nucleocapsid. J. Virol. 29:443-447. 23. Schubert, M., G. Harmison, and E. Meier. 1984. Primary structure of the vesicular stomatitis virus polymerase (L) gene: evidence for a high frequency of mutations. J. Virol. 51:505514. 24. Shipley, J. B., R. Pal, and R. R. Wagner. 1988. Antigenicity, function, and conformation of synthetic oligopeptides corresponding to amino-terminal sequences of wild-type and mutant matrix proteins of vesicular stomatitis virus. J. Virol. 62:25692577. 25. Steinhauer, D. A., and J. J. Holland. 1986. Direct method for quantitation of extreme polymerase error frequencies at selected single base sites in viral RNA. J. Virol. 57:219-228. 26. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of protein from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76:4350-4354. 27. Wagner, R. R. 1987. Rhabdovirus biology and infection: an overview, p. 9-74. In R. R. Wagner (ed.), The rhabdoviruses. Plenum Publishing Corp., New York. 28. Weiss, R. A., and R. L. R. Bennett. 1980. Assembly of membrane glycoprotein studied by phenotypic mixing between mutants of vesicular stomatitis virus and retrovirus. Virology 100: 252-274. 29. Wilson, T., and J. Lenard. 1981. Interaction of wild-type and mutant M protein of vesicular stomatitis virus with nucleocapsids in vitro. Biochemistry 20:1349-1354.