NEUROREPORT
REGENERATION AND TRANSPLANTATION
Skeletal muscle-derived progenitor cells exhibit neural competence Takako Kondoa, Jamie Caseb, Edward F. Srourb,c,d and Eri Hashinoa a
Department of Otolaryngology, Stark Neurosciences Research Institute, bDepartments of Medicine, cMicrobiology-Immunology and dPediatrics and Herman B. Research, Indiana University School of Medicine, Indianapolis, Indiana, USA Correspondence and requests for reprints to Dr Eri Hashino, PhD, Stark Neurosciences Research Institute, Indiana University School of Medicine, 950 West Walnut Street, R2- 419, Indianapolis, IN 46202, USA Tel: + 1317 278 9621; fax: + 1317 278 9620; e-mail:
[email protected] Sponsorship: National Institutes of Health grants DC007390 (E.H.) and HL069156 (E.F.S.). Received 9 October 2005; revised18 October 2005; accepted19 October 2005
Skeletal muscle contains heterogenous progenitor cells that give rise to muscle, hematopoietic cells and bone. The exact phenotypic de¢nition of skeletal muscle progenitor cells has not been fully elucidated nor the potential of these cells to di¡erentiate into neurons. Here, we demonstrate that phenotypically homogenous skeletal muscle progenitor cells de¢ned as LinCD45CD117CD90 + cells express neural stem cell markers and are responsive to neural induction signals. When exposed to
neural induction medium containing basic ¢broblast growth factor and brain-derived neurotrophic factor, skeletal muscle progenitor cells dramatically changed their cell morphology, became postmitotic and began expressing neuronal markers. These results reveal unexpected potentials of muscle progenitor cells and suggest that these cells may potentially be used in cell-based therapies c 2006 to replace damaged neurons. NeuroReport 17:1^ 4 Lippincott Williams & Wilkins.
Keywords: cell-based therapy, neural di¡erentiation, progenitor cells, skeletal muscle
Introduction Adult skeletal muscle tissue, such as bone marrow, contains pluripotent progenitor cells that give rise to multinucleated muscle fibers, and hematopoietic and mesenchymal cell types [1]. Methods for extracting and expanding these pluripotent progenitor cell populations have been established. These skeletal muscle-derived progenitor cells (SMPCs) were originally thought to have the capacity to differentiate into only muscle cells or different types of mesodermal cells, such as hematopoietic cells and bone [2,3]. Recent reports, however, have suggested that they have a much greater differentiation capacity, including the ability to differentiate into astrocytes and neuron-like cells [4–7]. To validate these results, we cultured SMPCs in neural induction medium containing basic fibroblast growth factor (FGF2) and observed that only a small fraction (1–2%) of these cells became positive for pan-neuronal markers [8]. In this study, we modified our neural induction method to test whether a greater percentage of defined cell populations in SMPCs can acquire morphologic, molecular and biochemical characteristics of neurons.
Materials and methods Isolation and culture of skeletal muscle progenitor cells Cells were isolated from skeletal muscle tissues (i.e. sartorius, quadriceps, thigh adductor, gastrocnemius and soleus muscles) of neonatal C57BL/6 wild-type mice (7 to 14-day-old) (Jackson Lab, Bar Harbor, Maine, USA). Animal experiments were performed in accordance with guidelines
approved by the Institutional Animal Care and Use Committee at Indiana University School of Medicine. Skeletal muscle tissue was digested in 220 U/ml collagenase I (Worthington Biochemical Corporation, Lakewood, New Jersey, USA) and 33 U/ml dispase (BD Biosciences, Bedford, Massachusetts, USA) in modified Eagle’s medium (Invitrogen, Carlsbad, California, USA) for 30–45 min at 371C with gentle agitation. Digested tissues were filtered through a 40 mm filter and washed prior to staining. Isolated cells were incubated with allophycocyanin-conjugated monoclonal anti-mouse CD45 and CD117 (c-kit, 30-F11 and 2B8, respectively, BD Pharmingen, San Diego, California, USA) and biotin-conjugated anti-mouse CD90 (Thy-1, 53-2.1, BD Pharmingen). Secondary staining was performed using PECy7-conjugated streptavidin (Caltag Laboratories, Burlingame, California, USA). All staining was performed at 41C for 20 min and cells were washed with Dulbecco’s phosphate-buffered saline plus 1% fetal bovine serum (FBS) after staining. Flow cytometry and cell sorting were performed on a FACS Vantage SE (Becton-Dickinson Immunocytometry Systems, San Jose, California, USA). Cells were sorted into multipotent adult progenitor cell media supplemented with 10 ng/ml platelet-derived growth factor (R&D Systems, Minneapolis, Minnesota, USA), leukemia inhibitory factor (Chemicon International, Temecula, California, USA) and epidermal growth factor (EGF; Sigma, St Louis, Missouri, USA) [8,9]. Viability and purity of sorted cells always exceeded 90% and 95%, respectively. Sorted cells were maintained in high-glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% FBS, 1%
c Lippincott Williams & Wilkins 0959- 4965 Vol 17 No 1 23 January 2006 1 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
KONDO ETAL.
NEUROREPORT Gluta-Max (Invitrogen), 100 U/ml penicillin (Sigma), 1% insulin–transferrin–selenium supplements (Invitrogen) and 10 ng/ml EGF at 371C with 5% CO2. Neural induction was performed as previously described [10] with modifications. Cells were plated at 2–5 104 cells/cm2 on plastic culture dishes or 8-well chamber slides coated with poly-D-lysine and mouse laminin, and incubated for 1 day. At preconfluence, the culture medium was replaced with preinduction medium comprising DMEM, 10% FBS, 10 ng/ml FGF2 (Peprotec, Rocky Hill, New Jersey, USA), 1% N2 (Invitrogen), 10 mM b-mercaptoethanol (b-ME), 2% B27 (Invitrogen), 50 mM Forskolin (Sigma), 250 mM 3-isobutyl-1-methylxanthine (IBMX; Sigma) and incubation continued for an additional 24 h. To initiate neuronal differentiation, the preinduction medium was replaced with a neural induction medium containing DMEM, 10 ng/ml FGF2, 1% N2, 10 mM b-ME, 2% B27, 5 mM Forskolin, 125 mM IBMX and 50 ng/ml brain-derived neurotrophic factor (BDNF; Peprotec). The cells were incubated for an additional 7 days. Reverse transcriptase polymerase chain reaction The expression of neuronal marker genes was assayed by conventional reverse transcriptase polymerase chain reaction (RT-PCR) as previously described with minor modifications [10]. At the end of the cell culture, total RNA was isolated from SMPCs using the RNeasy Mini-kit (QIAGEN, Valencia, California, USA) and the total RNA was subsequently treated with TURBO DNase (Ambion, Austin, Texas, USA). Single-stranded cDNA was synthesized using Omniscript reverse transcriptase (QIAGEN) and Oligo-dT primers. The resultant cDNA (1.5 ng) was amplified with Platinum Taq DNA polymerase (Invitrogen) according to the following program: 1 941C, 2 min; 30 941C, 15 s, 601C, 30 s, 721C, 20 s, and 1 721C, 5 min. After amplification, the PCR products were electrophoresed on 2% agarose gels containing ethidium bromide. To check for DNA contamination, PCR was run with cDNA samples using an L27 (ribosomal house-keeping gene) primer pair, whose PCR product crosses an intron. The primer sequences are listed in Table 1. Cell proliferation assay and immunocytochemistry Three days after plating the cells, 5-bromo-20 -deoxyuridine (BrdU; 10 mM, BD Biosciences) was added to the culture and incubation continued for another 24 h. Thereafter, cells were fixed with 4% paraformaldehyde for 30 min and denatured with 2 N HCl for 30 min. After blocking of non-specific binding, cells were incubated with a monoclonal anti-BrdU antibody (BD Biosciences) and a polyclonal anti-MAP2 (Chemicon) or anti-Tau antibody (Sigma). Immunoreactivity was visualized using Alexa 488-conjugated anti-mouse IgG1 and Alexa 568-conjugated anti-rabbit IgG. For visualizing cell nuclei, the cells were counterstained with DAPI.
Results
CD45 CD117 CD90 + cells used in this study comprised approximately 1.5% of the total number of cells isolated from skeletal muscle tissues (Fig. 1a and b). We previously demonstrated that CD45 CD117 CD90 + cells are virtually devoid of hematopoietic lineage positive cells [11,12] and therefore are referred to here as Lin CD45 CD117 CD90 + cells. As expected, none of the hematopoietic cell marker genes examined, including CD45, SCL, and PU.1, were expressed in Lin CD45 CD117 CD90 + cells (Fig. 1c). In
Table 1 Primer sequences Gene Fig.1 CD45 SCL PU.1 Nestin Sox2 EgtR Notch1 FgfRl L27 Fig. 2 nse Tau Islet 1 Musashi 1 BMP4 Calretinin Ngn1 NeuroD Syn 1
Sequence (forward^reverse)
bp
CCTCCCCTCGTGAGGCTGAA^ GTGGCCCCTGAGCAGCAATC CAGCCGCTCGCCTCACTAGG^ CTTCATGGCAAGGCGGAGGA GCTATACCAACGTCCAATGC^ GTTGTTGTGGACATGGTGTG AGTGCCTGGAAGTGGAAGAG^ ATCCTCCCACCTCTGTTGAC TTCGGTGATGCCGACTAGA^ TGCGAAGCGCCTAACGTA AAGTGGTCCTTGGGAACTTG^ TTGAGGGCAATGAGGACATA CTCCAACTGTGACACCAACC^ GCACCCAGATCACACTCATC GAAAGAGACGGACAACACCA^ CTTGAACTTCACCGTCTTGG ACAACCACCTCATGCCCACA^ CTGGCCTTGCGCTTCAAA
294
AACGTCGGCATCCAGATAGT^ GATTGACCTTGAGCAGCAAA TAGCAACGTCCAGTCCAAGT^ GTCACTTTGCTCAGGTCCAC TCAGGTTGTACGGGATCAAA^ GCTACACAGCGGAAACACTC CGTCACTTTCATGGACCAG^ CTTAGGCTGTGCTCTTCGAG GAGGAGGAGGAAGAGCAGAG^ TGGGATGTTCTCCAGATGTT GGAGATGAACATCCAACAGC^ TCACTGCAGAGCACAATCTC TCGGCTTCAGAAGACTTCAC^ GTGGTATGGGATGAAACAGG CCTGATCTGGTCTCCTTCGT^AAGAAAGTCCGAGGGTTGAG GACGAGGTGAAAGCTGAGAC^ CAGAGAGGGCTGTCTAGGG
109
279 106 116 100 106 108 118 103
105 105 115 114 105 105 101 110
contrast, nestin, Sox2, EgfR, FgfR1 and Notch1 [13], all of which are highly expressed in neural stem cells, were constitutively expressed in these cells (Fig. 1d). To increase the efficacy of neural induction, we modified our previous method and incubated SMPCs in the neural induction medium containing a cocktail of FGF2, BDNF, Forskolin and IBMX, reagents known to promote neural differentiation from bone marrow stromal cells [10,14]. After 7 days of incubation with the neural induction medium, the majority of progenitor cells exhibited clear changes in cell morphology, from a flat mesenchymal-like cell shape to a round cell body with neurite-like processes (Fig. 1e). To compare changes in gene expression before and after neural induction, RT-PCR analysis was performed to evaluate expression of early neuronal markers and neuronal subtype markers. All of the neuronal markers examined were undetectable or present at low levels in SMPCs before neural induction (Fig. 2). After neural induction, early neuronal markers, such as Tau, Islet1 and Musashi1, became detectable, while BMP4, a known inhibitor of neurogenesis [15], was down-regulated in SMPCs. These results were consistent with results previously obtained in similar experiments with bone marrow stromal cells [10]. Some of the neuronal subtype markers, including calretinin, Neurogenin1 (Ngn1) and NeuroD, undetectable in bone marrow stromal cells after neural induction [10], however, became
2 Vol 17 No 1 23 January 2006 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
NEUROREPORT
MUSCLE PROGENITOR CELLS AND NEURAL COMPETENCE
CT
(b)
1000
0 100 101 102 103 104 SSC-H (c) 1
2
1: CD45 2: SCL
3 4 3: PU.1 4: L27
CD45/VCD117 APC
104 R1
FSC-H
(a)
NI
(a1)
(b1)
BrdU
(a2)
(b2)
MAP2/DAPI
103 102 101
R2
100
100 101 102 103 10 CD90 PE/Cy7
(d)
1
2
1: Nestin 2: Sox2
3
4
5
6
3: EgfR 5: FgfR1 4: Notch1 6: L27
(e) NI
(c)
Fig. 1 (a and b) Flow cytometric sorting of skeletal muscle-derived Lin CD45 CD117 CD90 + cells. Region 1 [R1 in dot-plot (a)] was used to exclude debris in skeletal muscle-derived cells and the £uorescence distribution of cells in R1 was analyzed in dot-plot (b). Lin CD45 CD117 CD90 + cells were selected as those within R2. In this particular example, Lin CD45 CD117 CD90 + cells constituted1.5% of gated cells shown in R1. (c and d) Reverse transcriptase polymerase chain reaction analysis for hematopoietic markers and neural stem cell markers in unstimulated skeletal muscle progenitor cells (SMPCs). (e) SMPCs morphology before (CT) and after 7 days in the presence of neural induction medium (NI). Scale bar: 50 mm.
CT NI PC NC
% Positive cells
CT
90
(d)
BrdU/Tau/DAPI
60 30 0
CT
NI
Fig. 3 (a and b) 5-Bromo-20 -deoxyuridine (BrdU) incorporation assay and immunocytochemical characterization of skeletal muscle progenitor cells before and after neural induction. BrdU immuno£uorescence (a1, b1) merge with phase contrast and MAP2/DAPI coimmunostaining (a2, b2). (c) The quanti¢cation of BrdU-positive cells before (CT) and 3 days after neural induction (NI). (d) A few cells coexpressing BrdU and Tau after neural induction. Scale bar: 50 mm.
CT NI PC NC
nse
Calretinin
Tau
Ngn1
Islet1
NeuroD
Musashi1
Syn1
BMP4
L27
Fig. 2 Reverse transcriptase polymerase chain reaction analysis for neuronal marker genes in skeletal muscle progenitor cells (SMPCs) before and after neural induction. Neuronal marker genes are upregulated (nse, Syn1) or induced (Tau, Islet1, Musashi1, Calretinin, NeuroD and Ngn1) and BMP4 is downregulated in SMPCs after neuron induction. L27 is used as internal control gene. CT: unstimulated SMPCs; NI: SMPCs after neural induction; PC: positive control, E10 brain cDNA; NC: no cDNA.
detectable in SMPCs. The postsynaptic marker Syn1 was also present in unstimulated cells, but its expression level clearly increased after neural induction. To evaluate the rate of cell proliferation, BrdU incorporation assays were performed with SMPCs before and after neural induction. Approximately 75% of unstimulated progenitor cells showed BrdU-positive cellular nuclei (Fig. 3a1), while only 22% of cells that had been in neural induction medium were positive for BrdU staining (Fig. 3b1 and c). After, but not before, neural induction, the majority of stimulated SMPCs were positive for neuronal markers including MAP2 and Tau (Fig. 3a2, b2 and d). These results suggest that most of the stimulated SMPCs become postmitotic once they are committed to a neural lineage.
Interestingly, we also observed a small number of BrdUpositive cells that were also positive for neural markers (Fig. 3, arrow).
Discussion
In this study, we demonstrated that Lin CD45 CD117 CD90 + muscle progenitor cells, devoid of hematopoietic markers, constitutively express neural stem cell markers nestin, Sox2, EgfR, FgfR1 and Notch1. It is interesting to note that Sox2, known to be expressed in all neural stem and progenitor cells [16], was not detectable in bone marrow stromal cells [10]. The difference in Sox2 expression in SMPCs versus bone marrow stromal cells suggests that SMPCs may possess a higher propensity to differentiate into neural lineages than bone marrow stromal cells. Much like marrow stromal cells, however, the majority of SMPCs became postmitotic and changed their cell morphology in response to neural induction signals. The percentage of SMPCs positive for MAP2 or Tau by our present procedure was much higher than that obtained in our original protocol [8], indicating that a higher percentage of SMPCs have neural competence than originally thought. As both muscle and bone marrow cells are derived from embryonic mesoderm and as each can give rise to cells of different lineages [17,18], the similarities between these cell types in their responses to neural induction signals are not surprising. Clear differences, however, were also found in their molecular properties after neural induction. First, expression
Vol 17 No 1 23 January 2006 3 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
KONDO ETAL.
NEUROREPORT of some of the neuronal subtype marker genes, such as Ngn1, NeuroD and calretinin, was induced in SMPCs by the neural induction medium in the absence of specific differentiation factors. In bone marrow stromal cells, Sonic hedgehog and retinoic acid were required to induce calretinin and unidentified factors in the embryonic conditioned medium to induce Ngn1 and NeuroD [10]. Second, a higher percentage of SMPCs (20%) remained BrdU-positive after neural induction than marrow stromal cells (10%). Moreover, we occasionally detected BrdU-positive SMPCs that also expressed neuronal markers. Although further investigation is required to fully understand the nature of muscle progenitor cells that are responsive to neural induction and those that are nonresponsive, one possibility is that early-responding progenitor cells might inhibit others from transdifferentiating, thereby forcing them to function as feeder cells. Alternatively, but not exclusively, there might be another as yet unidentified marker that can distinguish between neural competent and non-competent SMPCs. One candidate for such a marker is Sca-1, which has been shown to distinguish pluripotent stem cells from satellite cells in muscle tissue [19]. It would be interesting to examine whether Sca-1 positive and negative SMPCs respond differently to neural induction signals. During embryonic development, differentiation of neural progenitors into various neuronal subtypes is controlled by a combination of proteins and/or hormones secreted from their surrounding microenvironment. Some of these signaling molecules also have effects on stem cell differentiation. For example, Sonic hedgehog and retinoic acid synergistically promote glutamatergic specification from marrow-derived pluripotent stem cells [10]; FGF8 and FGF20 promote dopaminergic differentiation from embryonic stem cells [14]; and neurotrophin-3 induces GABAergic differentiation from forebrain stem cells [20]. Future studies should address whether some of the signaling molecules can further promote neuronal subtype specification from muscle progenitor cells.
Conclusions We showed in this study that non-hematopoietic muscle progenitor cells constitutively express a set of neural stem cell markers. When exposed to defined neural induction signals, approximately 70% of mitotic progenitor cells withdrew from the cell cycle, dramatically changed their cell shapes and began expressing neuronal marker genes and proteins. The percentage of progenitor cells exhibiting neural competence was much higher in this study than previously reported. Major differences between muscle progenitor cells and bone marrow stromal cells were observed in their genetic properties and responses to neural induction signals.
Acknowledgement We thank Heather L. Aloor for her valuable comments on the manuscript.
References 1. Goodell MA, Jackson KA, Majka SM, Mi T, Wang H, Pocius J, et al. Stem cell plasticity in muscle and bone marrow. Ann NY Acad Sci 2001; 938:208–218; discussion 218–220. 2. Wada MR, Inagawa-Ogashiwa M, Shimizu S, Yasumoto S, Hashimoto N. Generation of different fates from multipotent muscle stem cells. Development 2002; 129:2987–2995. 3. Mastrogiacomo M, Derubeis AR, Cancedda R. Bone and cartilage formation by skeletal muscle derived cells. J Cell Physiol 2005; 204: 594–603. 4. Alessandri G, Pagano S, Bez A, Benetti A, Pozzi S, Iannolo G, et al. Isolation and culture of human muscle-derived stem cells able to differentiate into myogenic and neurogenic cell lineages. Lancet 2004; 364:1872–1883. 5. Romero-Ramos M, Vourc’h P, Young HE, Lucas PA, Wu Y, Chivatakarn O, et al. Neuronal differentiation of stem cells isolated from adult muscle. J Neurosci Res 2002; 69:894–907. 6. Sherwood RI, Christensen JL, Conboy IM, Conby MJ, Rando TA, Weissman IL, et al. Isolation of adult mouse myogenic progenitors: functional heterogeneity of cells within and engrafting skeletal muscle. Cell 2004; 119:543–554. 7. Ehrhardt J, Morgan J. Regenerative capacity of skeletal muscle. Curr Opin Neurol 2005; 18:548–553. 8. Case J, Horvath TL, Howell JC, Yoder MC, March KL, Srour EF. Clonal multilineage differentiation of murine common pluripotent stem cells isolated from skeletal muscle and adipose stromal cells. Ann NY Acad Sci 2005; 1044:183–200. 9. Jiang Y, Vaessen B, Lenvik T, Blackstad M, Reyes M, Verfaille CM. Multipotent progenitor cells can be isolated from postnatal murine bone marrow, muscle and brain. Exp Hematol 2002; 30:896–904. 10. Kondo T, Johnson SA, Yoder MC, Romand R, Hashino E. Sonic hedgehog and retinoic acid synergistically promote sensory fate specification from bone marrow-derived pluripotent stem cells. Proc Natl Acad Sci USA 2005; 102:4789–4794. 11. Howell JC, Yoder MC, Srour EF. Hematopoietic potential of murine skeletal muscle-derived CD45(–)Sca-1( + )c-kit(–) cells. Exp Hematol 2002; 30:915–924. 12. Howell JC, Lee WH, Morrison P, Zhong J, Yoder MC, Srour EF. Pluripotent stem cells identified in multiple murine tissues. Ann NY Acad Sci 2003; 996:158–173. 13. Ramalho-Santos M, Yoon S, Matsuzaki Y, Mulligan RC, Melton DA. ‘Stemness’: Transcriptional profiling of embryonic and adult stem cells. Science 2002; 298:597–600. 14. Dezawa M, Kanno H, Hoshino M, Cho H, Matsumoto N, Itokazu Y, et al. Specific induction of neuronal cells from bone marrow stromal cells and application for autologous transplantation. J Clin Invest 2004; 113:1701–1710. 15. Yanagisawa M, Takizawa T, Ochiai W, Uemura A, Nakashima K, Taga T. Fate alteration of neuroepithelial cells from neurogenesis to astrocytogenesis by bone morphogenetic proteins. Neurosci Res 2001; 41:391–396. 16. Graham V, Khudyakov J, Ellis P, Pevny L. SOX2 functions to maintain neural progenitor identity. Neuron 2003; 39:749–765. 17. LaBarge MA, Blau HM. Biological progression from adult bone marrow to mononucleate muscle stem cell to multinucleate muscle fiber in response to injury. Cell 2002; 111:589–601. 18. Ferrari G, Cusella-De Angelis G, Coletta M, Paolucci E, Stornaiuolo A, Cossu G, et al. Muscle regeneration by bone marrow-derived myogenic progenitors. Science 1998; 279:1528–1530. 19. Seale P, Asakura A, Rudnicki MA. The potential of muscle stem cells. Dev Cell 2001; 1:333–342. 20. Laeng P, Pitts RL, Lemire AL, Drabik CE, Weiner A, Tang H, et al. The mood stabilizer valproic acid stimulates GABA neurogenesis from rat forebrain stem cells. J Neurochem 2004; 91:238–251.
4 Vol 17 No 1 23 January 2006 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
