Fuller-Pace, F. V., Bullas, L. R., Delius, H. & Murray, N. t. ( I 984). Gann, A. A. F., Campbell. A. J. R. .... TIMOTHY BESTOR. Department of Anatomy arid Cellitlar ...
043
626th MEETING, S H E F F I E L D E c o R l 2 4/3
GAA( N-] ) RTCG
heThrAlaLeuThrAlaGluLeuThrAlaGluLeuThrAlaGluLe~snMe~rgLysLysGlnTyrAs
2451
TTACTGCACTTACCGCTGAGCTTACCGCTGAGCTTACCGCTTACCGCT~GCTT~CATGCGT~CAGTAC~2 5 2 0
>
----------->-----------)--------------
EcoR124 2451
GAA(N6)RTCG
heThrAlaLeuThrAlaGluLeuThrAlaGluLeuAsnMergLysLysGlnTyrAsnTyrTyrArgAs TTACTGCACTTACCGCTGAGCTTACCGCTGAGCTTAACATCTATCGCGA
----------->-----------
>
2520
Fig. 2. The diflererice hrtweeri the EcoK124 arid EcopKI24/3 hsdSgeries T h e 12 b p sequence that is repeated twice in one gene and three times in the other is indicated by the underlining arrow. T h e D N A sequences recognized by these enzymes are also shown. ~
e l h (Hedges & Datta, 1972). Occasionally, cells expressing one of these specificities will switch to expressing the other and this phenomenon is reversible. We have determined the D N A sequences recognized by these systems (Price et u/., 1987) and have sequenced the hsd genes (C. Price, J. Lingner, T. A . Bickel, K. Firman & S. W. Glover, unpublished work). T h e results are summarized in Fig. 2. T h e two recognition sequences differ from each other only in the length of the non-specific spacer, which is 6 b p long for EcoR12.l and 7 bp long for EcoR124/3, a difference that places the specific domains of the EcoR 124/3 recognition sequence 0.34 nm further apart than those of EcoR124 and rotates them by 36".T h e only difference that we have found betwcen the two hsdS genes is that, towards the middle of the genes, EcoR124 has two repeats of a 12 b p sequence, while EcoR124/3 has three repeats of the same sequence. T h e extra four amino acids in EcoR124/3, if they are in a sequence separating two D N A sequence-recognizing domains (which we have not yet proved) and are in a strongly predicted a-helical conformation, would extend the length of the spacer by 0.6 nm. This is easily enough to allow the enzyme to accommodate the increased distance between the two specific domains in the recognition site o f EcoRl24/3. We have described two examples of spontaneous changes in sequence specificity of type I restriction and modification systems, both probably mediated by genetic recombination. Both cases were noticed because they occurred in laboratories working with type I restriction. In Nature, such changes in specificity should not b e rare. It is advantageous for a cell to change its restriction specificity from time to time. Populations of bacteriophages that have become modified by the old specificity will be susceptible to the new one.
-
Other possible advantages o f type I systems have been discussed elsewhere (Price & Bickle, 1086). Work in Hasel was supported by the Swiss National Science
Foundation. Bickle, T. A. ( 1 982) in 7%~.Niic~lectsrs(Linn. S. M. Kr Koherts, R. J.. eds.), pp, 75- 1 OH. Cold Spring Harbor Prew, Cold Spring Harbor, N Y Bullas, L. R., Colwn, C. Kr Van Pel, A. ( 1976) J . ( & , t i . Mic,rohio/.9 5 , 166-172
Fuller-Pace, F. V. & Murray, N. E. ( 1986)
I'roc. No//. Ac.crr/. .+i. U.S.A.83.9368-0372 Fuller-Pace, F. V., Bullas, L. R., Delius, H. & Murray, N . t.( I 984) /'roc. Not/. Actid. Sci. U.S.A.81. 6095-6090 Gann, A. A. F., Campbell. A. J. R., Collins, J . F.. C'oulson. A. F. W. Kr Murray. N. E. ( 1 987) hfol. hrlicwhiol. 1, 13-22 Glover, S. W. & Colson, C. (1969) (;etwr. Hes. 13, 227-240 Cough, J. A. & Murray, N. E. ( I 983) J . Mol. Biol. 166. I - I 9 Hedges, R. W. & Datta. N. ( I 972) J .
