In Vitro Cell.Dev.Biol.—Plant DOI 10.1007/s11627-015-9729-2
PLANT TISSUE CULTURE
Somatic embryogenesis, cell suspension, and genetic stability of banana cultivars Lucymeire Souza Morais-Lino 1 & Janay Almeida Santos-Serejo 1 & Edson Perito Amorim 1 & José Raniere Ferreira de Santana 2 & Moacir Pasqual 3 & Sebastião de Oliveira e Silva 4
Received: 11 March 2015 / Accepted: 8 October 2015 / Editor: David Duncan # The Society for In Vitro Biology 2015
Abstract The induction of somatic embryogenesis in banana is extremely difficult because of endogenous problems of the species and genotype dependency. Establishing a suitable protocol for somatic embryogenesis is necessary for applying biotechnological approaches to assist the genetic improvement, by facilitating the access to individual cells or groups of cells for use in genetic transformation, and the induction of polyploidy and mutagenesis. Embryogenic cultures were induced from immature male flowers of two important cultivars of banana, ‘Grand Naine’ (AAA) and ‘Tropical’ (AAAB), using immature male flowers. Cell suspensions were established, and regenerated plants were evaluated for their genetic stability using 11 simple sequence repeat markers. For induction of embryogenesis, different doses of autoclaved glutamine in the induction medium were used, and somatic embryos were converted into plants in medium supplemented with benzylaminopurine and naphthalene-1-acetic acid. ‘Grand Naine’ formed somatic embryos in glutamine-free media, while ‘Tropical’ somatic embryos grew in the presence of autoclaved glutamine. During regeneration, ‘Grand Naine’ showed better results for formation of embryos in culture medium without growth regulators, but these embryos were not
* Lucymeire Souza Morais-Lino
[email protected] 1
Embrapa Cassava and Fruits, Rua Embrapa, s/n, Caixa Postal 007, Cruz das Almas, BA 44380-000, Brazil
2
Department of Biological Sciences, Estadual University of Feira de Santana, Feira de Santana, BA 44036-900, Brazil
3
Department of Agriculture, Federal University of Lavras, Lavras, MG 37200-000, Brazil
4
Department of Agricultural Sciences, Federal University of Recôncavo of Bahia, Cruz das Almas, BA 44380-000, Brazil
converted into plants when kept in the same medium, while ‘Tropical’ produced a large number of plants regenerated when kept in the same medium. The simple sequence repeat markers used did not detect any genetic variation. These results suggest that the establishment of embryogenic cell suspension cultures of banana may be effective for production of genetically stable plants on a large scale as well as being a biotechnological tool to support banana genetic improvement. Keywords SSR markers . Growth regulators . Somatic embryos . Musa spp.
Introduction Bananas (Musa spp.) play an important economic and social role worldwide. They are cultivated in more than 107 countries, mainly by small growers, on an area estimated to be 4.1 million ha, and production is estimated to be 95 million mt. Banana plants bear fruit all yearlong and are considered an important source of revenue, especially for developing countries (Food and Agriculture Organization 2014). In bananas, genetic improvement is hindered by the sterility of some triploid cultivars, such as those of the Cavendish subgroup. One way to overcome this problem is to develop new cultivars through unconventional breeding methods. However, the incorporation of biotechnological techniques in breeding programs relies on efficient regeneration of plants from cell suspensions via somatic embryogenesis. Cell suspensions with high regeneration capacity have applications in mass clonal propagation (Morais-Lino et al. 2008; Kulkarni and Bapat 2013). Because regenerated plants can have singlecell origins, thus avoiding the creation of chimeric plants, and because they can be genetically transformed with relative ease, cell suspensions have been used for unconventional
MORAIS-LINO ET AL.
breeding (Assani et al. 2005; Houllou-Kido et al. 2005; Xiao et al. 2009; Rustagi et al. 2015). Alterations in morphological, biochemical, genetic, and/or epigenetic characteristics have been observed during in vitro plant propagation. These variations can be evaluated based on phenotype, isozyme and protein patterns, the structure and number of chromosomes, and genetic and epigenetic characteristics (Fourré 2000). Microsatellites, or simple sequence repeats (SSRs), are markers made up of repeats of short motifs, typically two to six nucleotides. Variation in microsatellites usually corresponds to an alteration in the number or size of the repeats (Leroy et al. 2000). SSR markers have been used for the detection of somaclonal variation in micropropagated banana plants (Guimarães et al. 2009). Considering the frequency of variation in tissue-cultured bananas, information on the genetic stability of banana plants regenerated from cell suspension via somatic embryogenesis is very important. A protocol was developed to induce somatic embryogenesis from immature male flowers of ‘Grand Naine’ (AAA- Cavendish subgroup) and ‘Tropical’ (AAABSilk subgroup), established cell suspension cultures, and evaluated the genetic stability of plants regenerated using SSR markers.
Materials and Methods Induction of embryogenesis. Male banana buds of ‘Grand Naine’ (AAA—Cavendish subgroup) and ‘Tropical’ (AAAB—Silk subgroup) were obtained from the Banana Germplasm Bank of the Embrapa Cassava and Fruit Research Unit, Cruz das Almas, Bahia, Brazil. ‘Tropical’ is a hybrid from Embrapa that was generated by crossing ‘Yangambi’ no. 2 (AAB) and ‘M53’ (AA). Male buds collected 10 d after the opening of the last female flower were shortened to 10 cm in length removing the enveloping bracts under non-sterile conditions. For second dissection, the male bud was then transferred to a laminar air and surface disinfected twice by spraying them each time with 70% ethanol and burning off the ethanol. Immature male flowers were isolated from the buds with the use of a stereoscopic microscope and placed in Petri dishes containing a culture medium composed of Murashige and Skoog (MS) salts and vitamins (Murashige and Skoog 1962) with 3% sucrose. The medium was supplemented with 1 mg L−1 indole3-acetic acid (IAA), 4 mg L−1 2,4-dichlorophenoxyacetic acid (2,4-D), and 1 mg L−1 naphthalene-1-acetic acid (NAA) and various concentrations of glutamine (0, 50, 100, 150, and 200 mg L−1). All reagents used were from Sigma-Aldrich®, St. Louis, USA. The pH was adjusted to 5.8, and the medium was solidified with 0.7% type III agarose and autoclaved for 20 min at 121°C. The cultures were kept in total darkness at
27±1°C, until the formation of embryogenic calluses and/or somatic embryos. The experimental design was completely randomized, 2×5 factorial scheme (banana cultivars × glutamine concentrations), with 12 replicates per treatment. The material was observed weekly for 120 d, and the presence or absence of somatic embryos and embryogenic callus was recorded. Establishment of cell suspensions. Embryogenic masses containing somatic embryos (approximately 60 mg) were transferred to 125-mL Erlenmeyer flasks containing 15 mL of liquid MS medium supplemented with 1 mg L −1 2,4-D, 100 mg L−1 glutamine, 1 mg L−1 biotin, 10 mg L −1 ascorbic acid, and 44.5 g L−1 sucrose (Morais-Lino et al. 2008). Cultures were kept in darkness at 27±2°C on orbital shaker at 120 rpm and subcultured every 10 d. Two months after initiation, the cultures were sieved through a mesh with 500-μm pore size and cultured in fresh medium and subcultured every 10 d for maintenance. Plant regeneration from cell suspensions. The densities of cells in suspension for both varieties were adjusted before transfer to semisolid medium. For ‘Tropical’, the density was adjusted to 5% of the settled cell volume (SCV) by inoculating 1 mL of settled cells into 19 mL of liquid culture medium. The cell suspensions of ‘Grand Naine’, since they were made up of small embryogenic cell aggregates, were diluted to 3.3% SCV by inoculating 1 mL of settled cells into 29 mL of liquid culture medium. Aliquots (1 mL) of the new suspensions from each cultivar were placed on a filter paper in Petri dishes containing semisolid culture medium with MS basal salts and vitamins, 30 g L−1 sucrose, 7 g L−1 agar, and five different concentrations of 6-benzylaminopurine (BAP) and IAA, respectively (0.0 and 0.0 mg L−1 [control], 0.2 and 0.1 mg L−1, 0.4 and 0.3 mg L−1, 0.6 and 0.5 mg L−1, and 0.8 and 0.7 mg L−1). The pH was adjusted to 5.8 prior to autoclaving. Cultures were transferred to fresh medium every mo. During early stages of differentiation, the cultures were kept in a dark growth chamber at 27±2°C for 30 d and then exposed to white fluorescent light with 16-h photoperiod at 30 μmol m−2 s−1. Germinated embryos were cultured individually in Magenta™ vessels (Sigma-Aldrich®) containing MS culture medium without growth regulators. Regenerated plants were acclimatized and then taken to the field for phenotyping and molecular analysis. The experimental design used for field tests was a completely randomized factorial with five treatments (combined concentrations of BAP and IAA) and five replicates. The average numbers of total embryos per milliliter SCV, germinated somatic embryos, and plants converted per treatment were evaluated. Statistical analyses were performed using the SAS program (SAS Institute, Cary, NC). Data were
EMBRYOGENIC CELL SUSPENSIONS OF MUSA
transformed to log (x), and the averages were grouped by the Scott-Knott test (Scott and Knott 1974) at 5% probability. DNA extraction and SSR amplification. For each cultivar, 18 plants were randomly selected and sampled from each treatment (BAP and IAA, respectively, 0.0 and 0.0 mg L−1 [control], 0.2 and 0.1 mg L−1, 0.4 and 0.3 mg L−1, 0.6 and 0.5 mg L−1, and 0.8 and 0.7 mg L−1). Samples obtained from shoot apex micropropagation were taken as controls. Total genomic DNA was extracted using the CTAB method (Doyle and Doyle 1990). The amount and quality of the DNA were determined by comparative analysis on 0.8% agarose gels stained with ethidium bromide, and the samples were diluted in extraction buffer (1.0 M Tris-HCl, 0.5 M EDTA, pH 8.0) to a final concentration of 10 ng μL−1. Amplification reactions were completed with ultrapure water to a final volume of 15 μL containing the following reagents: 1.5 mM MgCl2, 100 μM dNTPs, 0.2 μM of each SSR primer (Creste et al. 2003, 2006) (Table 1), 1 U of Taq polymerase (Life Technologies, Carlsbad, CA), 1× buffer, and 30 ng of genomic DNA. Amplifications were carried out in a Bio-Rad MyCycler Thermal Cycler (Bio-Rad, California, USA) using a touchdown PCR program at 94°C for 4 min; 10 cycles of 94°C for 30 s, 55°C for 30 s (reduced 1°C/cycle), and 72°C for 1 min, followed by 30 cycles of 94°C for 30 s, 45°C for 30 s, and 72°C for 1 min. Amplified products were visualized on 2.5% agarose gel (Sigma-Aldrich ®) stained by ethidium bromide, by a Gel Logic 212 Pro imaging system (University of Alaska, Fairbanks, AK).
Results Induction of embryogenesis. Three months after inoculation in culture medium, only the formation of yellow callus was observed in both cultivars, regardless of the initial glutamine concentration (before autoclave). After 6 mo of growth, different responses between the banana cultivars and the concentration of autoclaved glutamine were observed for the formation of embryogenic masses (Table 2). Formation of somatic embryos occurred in the absence of glutamine in ‘Grand Naine’ (Fig. 1A) and in the presence of 200 mg L−1 of autoclaved glutamine (Table 2). Somatic embryos with whitish coloration were formed in ‘Tropical’ cultures, at the autoclaved glutamine concentrations of 50 (Fig. 1C), 100, and 150 mg L−1 (Table 2). Embryonic masses containing somatic embryos from each cultivar were used to establish cell suspensions. Establishment of cell suspensions. Embryogenic masses of various sizes and shapes appeared in approximately 2 mo after culture initiation. To synchronize these cultures, they were sieved through a 500-μm filter. Cell agglomerates of ‘Grand
Table 1. SSR primers used in the analysis of plants regenerated from ‘Grand Naine’ and ‘Tropical’ banana cell suspensions SSR primers
Sequence of primers
MaOCEN 10
ggaagaaagaagtggagaatgaa/tgaaatggataaggcagaagaa
Ma 1–27
tgaatcccaagtttggtcaag/caaaacactgtccccatctc
Ma 1–17 Mb 1–69
tgaggcggggaatcggta/ggcgggagacagatggagtt ctgcctctccttctcctttggaa/tcggtgatggctctgactca
Mb 1–100
tcggctggctaatagaggaa/tctcgagggatggtgaaaga
AGMI 67/68 CNPMF01
ataccttctcccgttcttcttc/tggaaacccaatcattgatc tgatgcattggatgatctcg/aaaacacaccaactccatccc
CNPMF 08 CNPMF 09
atcgaggaatttgggagagg/atccacaatccgatcagctc ccttcatcatcatcacggc/accacgacctcctcctcttc
CNPMF 10
cacatcacacgctctgcttc/tttttcggctgatccaattc
CNPMF 43
aaaccctccaccaacacctc/gtttggtgctcattgctgtg
Naine’ were very small and white-to-yellowish in color, whereas those of ‘Tropical’ were more intensely yellow and larger. After 4 mo, the formation of very small, quickly multiplying cell agglomerates was observed for ‘Grand Naine’ (Fig. 1B, E) whereas much larger cell agglomerates were observed for ‘Tropical’ (Fig. 1D, G). This variety needed a large number of subcultures to form a suspension of small clumps of cells. Plant regeneration from cell suspensions. Two weeks after suspension cultures were placed on semisolid media, proembryonic structures were observed in both cultivars. After 4 wk, embryos were observed, regardless of growth regulator concentrations (Fig. 1F, H). After 45 d, embryos were selected and transferred to fresh medium for maturation and germination (Fig. 1I, J), and regeneration of plants with a very welldeveloped root systems was observed. Plant growth was normal for both cultivars, with good development of the root system during of acclimation in the greenhouse (Fig. 1K). ‘Grand Naine’ produced more somatic embryos in MS basal medium without growth regulators, with an average of 11,072 somatic embryos per milliliter of 3.3% SCV, but these embryos did not convert to plants efficiently (Table 3). However, Table 2. Frequency (%) of embryogenic mass (SE) and nonembryogenic calli (NEC) obtained from male inflorescence of ‘Grand Naine’ and ‘Tropical’ banana Cultivars
Glutamine concentration (mg L−1) 0
50
100
150
200
SE NEC SE NEC ES NEC SE NEC SE NEC Grand Naine 50 50 Tropical 0 0
0 100 60 40
0 0 50 50
0 100 40 60
50 50 0 50
MORAIS-LINO ET AL.
Figure 1. Induction of somatic embryogenesis, cell suspension, and plant regeneration of ‘Grand Naine’ (A, B, E, F, I) and ‘Tropical’ (C, D, G, H, J, K). (A) Embryogenic mass in culture medium without glutamine. (B, D) Cell suspension. (C) Embryogenic mass in culture medium with 50 mg L−1 of glutamine. (E, G) Cell agglomerates. (F) Somatic embryos
from regeneration medium without growth regulators. (H) Somatic embryos formed in culture medium with growth regulators 30 d after planting. (I) Germination of somatic embryos. (J) Regenerated plants. (K) Hardening of plants in the greenhouse. Bars: A, C, F, H, 1 mm; E, G, 0.1 mm.
addition of 0.8 mg L−1 BAP and 0.7 mg L−1 IAA resulted in a larger number of regenerated plants, with an average of 1896 plants per milliliter of 3.3% SCV. ‘Tropical’ produced the most embryos (295) and regenerated plants per milliliter of 5% SCV in MS basal medium without regulators.
The frequency with which embryos converted into plants showed clear genotypic differences with ‘Grand Naine’ showing a maximum of 20.21% and ‘Tropical’, a minimum of 55.52% and a maximum of 79.72% (Table 3).
Table 3. Response regeneration from cell suspensions of ‘Grand Naine’ and ‘Tropical’ at different levels of BAP and IAA (0.0 and 0.0 mg L−1, 0.2 and 0.1 mg L−1, 0.4 and 0.3 mg L−1, 0.6 and 0.5 mg L−1, and 0.8 and 0.7 mg L−1) Treatment
1 2 3 4 5 t cv
Number of embryos per milliliter SCV
Number of plants
Embryos that did not germinate
Rate of conversion into plants (%)
GN
T
GN
T
GN
T
GN
T
11.072.6 az 8.558.4 a 10.950.0 a 6.495.7 a 6.076.6 a 0.6011 ns 9.23
295.4 a 106.0 a 127.8 a 152.0 a 250.4 a 0.1899 ns 9.07
1b 706.8 a 677.3 a 621.0 a 1.896.0 a 0.0008** 25.85
164 a 84.5 b 87.75 b 93.8 b 149.8 a 0.0115** 6.07
11.071.0 a 7.851.6 a 10.272.7 a 5.874.8 a 4.180.7 a 0.5571 ns 13.47
131.4 a 21.5 a 40.0 a 58.2 a 100.6 a 0.5523 ns 21.6
0.01 8.01 6.19 9.48 20.21
55.52 79.72 68.69 61.71 59.82
**Significant at 5% z
Averages followed by the same small case letters in the column do not differ between themselves by the Scott-Knott test at 5% probability
EMBRYOGENIC CELL SUSPENSIONS OF MUSA
A total of 4000 and 1534 plants of ‘Grand Naine’ and ‘Tropical’, respectively, were acclimatized (Fig. 1K). Three months after acclimatization in greenhouse, no morphological variation was observed among plants of either cultivar. Plants transferred to the field also showed normal development, and no somaclonal variation was detected.
Genetic stability of the plantlets using SSR markers. No somaclonal variation was detected between the plants regenerated from the cell suspensions for either cultivar based on PCR assays using 11 SSR primer sets. All primers presented standard single allele patterns, regardless of the treatment used and of the plant genotyped (Fig. 2A, B). Thus, it is possible to infer that the protocols used to obtain cell suspensions as well as those used to regenerate the plants did not induce genetic variation.
Figure 2. SSR profile of different banana plants regenerated from cell suspensions of ‘Grand Naine’ (A) and ‘Tropical’ (B) using CNMPF-09 and CNMPF-43 primers, respectively. M = 50-bp ladder marker
Discussion Somatic embryogenesis is a complex process where the survival and growth of regenerated plants depend on the conditions of cultivation and are genotype dependent (Arnold et al. 2002). Amino acid supplementation enhances somatic embryogenesis in several species. Glutamine is a biomolecule highly thermolabile and, when autoclaved for 20 min during medium preparation, is converted to 5-oxo proline (pyroglutamine acid) (Sandal et al. 2011). In Cucumis anguria L., the addition of autoclaved glutamine increased the number somatic embryos induced from hypocotyl and leaf explants (Ju et al. 2014) and greatly enhanced the production of shoots from callus (Jeyakumar et al. 2014). In banana, autoclaved glutamine has been used to induce formation and multiplication of embryogenic callus to establish cell suspension culture and to induce somatic embryo development and maturation of diploid (AA: Jalil et al. 2003; AB: Mohandas et al. 2013), triploid (Georget et al.
(Invitrogen). Samples 1–18 (treatment 1), 19–36 (treatment 2), 42–59 (treatment 3), 60–77 (treatment 4), 37–41, and 78–82 control plants.
MORAIS-LINO ET AL.
2000; AAA: Chung et al. 2006; Pérez-Hernández and RosellGarcía 2008; Husin et al. 2014; Remakanthan et al. 2014; Jafari et al. 2015; AAB: Chung et al. 2006; Morais-Lino et al. 2008; ABB: Dai et al. 2010; Elayabalan et al. 2013), and tetraploid (AAAB: Kosky et al. 2002) genotypes. Husin et al. (2014) observed that autoclaved glutamine promoted the development of somatic embryos of Musa acuminata cv. Berangan, resulting in a greater number of regenerated plants in less time compared with proline. In the present study, only autoclaved glutamine was used to induce embryogenesis and it was shown to be necessary for the induction of somatic embryogenesis in ‘Tropical’ (200 mg L−1). On the other hand, ‘Grand Naine’ developed embryos in culture medium without glutamine, as reported earlier (Assani et al. 2001; Remakanthan et al. 2014). The ability of a cell suspension to regenerate is a very important measure of its quality. In the present study, the cell suspensions were diluted 20 and 30 times, for ‘Tropical’ and ‘Grand Naine’, respectively, with the objective of increasing regeneration efficiency. The results obtained are in agreement with those observed by other authors. In a study of ‘Grand Naine’ (AAA), Côte et al. (1996) observed germination rates of 3–20% from a total of 370,000 embryos mL−1 of agglomerated cells. Strosse et al. (2006) regenerated 48,000 Cavendish plants and 20,000 plantains mL−1 of compacted cells. Morais-Lino et al. (2008) obtained an average of 558 plants mL−1 of 5% SCV form cell suspensions of Brazilian plantains ‘Terra’. Kulkarni and Bapat (2013) reported that about 40% of the torpedo stage somatic embryos of cv. ‘Rajeli’ developed into plants, with elongated shoots and good root system. In the present study, both cultivars had reasonably high plant conversion rates compared to those obtained by Houllou-Kido et al. (2005), who obtained a regeneration rate of only around 400 plants 10 mL−1 of compacted but not diluted cells. The differences in embryogenic response during culture induction to plant regeneration from cell suspensions may be due to various factors involved in the process. One factor could be that these cultivars belong to different genomic groups and ploidy level (‘Grand Naine’; AAA and ‘Tropical’; AAAB). The frequency of embryo production is dependent on the genomic group and differs among varieties within the same group (Strosse et al. 2006; Youssef et al. 2010). The formation of a greater number of embryos from ‘Grand Naine’ in culture medium lacking growth regulators and the conversion of only one plant in this same medium could be caused by the lack of growth regulators. Auxins and cytokinins are the two main growth regulators involved in regulation of cell division and differentiation, besides playing a key role in differentiation (Fehe’r et al. 2003). Kulkarni and Bapat (2013) reported that incorporation of BAP at 0.8 μM in culture medium resulted in maximum embryo germination (40%)
and that medium free of growth regulators yielded poor germination response, with short and weak plants produced. Namanya et al. (2014) plated cell suspensions of the ‘Nakyetengu’ (AAA) in culture medium without growth regulator and noted the development of 2.18×103 embryos mL−1 SCV. Germination of these embryos was observed at 2.8 and 6.2% for two cell suspension lines in culture medium with 0.22 μM BAP and 1.14 μM IAA. In the present study, although the cell suspensions of ‘Grand Naine’ presented smaller clusters of cells and a greater number of embryos mL−1 SCV, the ratio of conversion to plants was much lower compared to ‘Tropical’. These are good conversion rates compared to other reported results (Jalil et al. 2003—13%; Remakanthan et al. 2014—3%). Microsatellites are highly sensitive markers capable of monitoring genetic variation and signaling the occurrence of potentially deleterious mutations during in vitro culture, since they can reflect a relatively high mutation rate (Lopes et al. 2006; Burg et al. 2007). SSRs have proved to be extremely efficient in studies aiming to detect genetic instability in plants originated from somatic embryogenesis (Jin et al. 2008; Marum et al. 2009). Evaluation of the genetic stability of the plants originating from cell suspensions is essential before adapting the present protocol as a large-scale clonal propagation process (Jin et al. 2008). The plants regenerated in the present study were morphologically normal, suggesting normal development without somaclonal variation. Microsatellite marker analysis of regenerated plants of both genotypes showed no genetic variation occurrence, but the genetic fidelity of these plants regenerated from cell suspensions needs to be further monitored until harvest. This technique has great potential to accelerate the propagation of banana in developing countries.
Conclusion The results show that the protocol used to induce somatic embryogenesis and plant regeneration from cell suspensions is effective to obtain banana plants on a fairly large scale without any observable somaclonal variation and that the protocol can be used as part of methods involving the application of biotechnology to promote the genetic improvement of banana.
References Arnold S, Sabala I, Bozhkov P, Dyachok J, Filonova L (2002) Developmental pathways of somatic embryogenesis. Plant Cell Tissue Organ Cult 69:233–249 Assani A, Chabane D, Haïcour R, Bakry F, Wenzel G, Foroughi-Wehr B (2005) Protoplast fusion in banana (Musa spp.): comparison of
EMBRYOGENIC CELL SUSPENSIONS OF MUSA chemical (PEG: polyethylene glycol) and electrical procedure. Plant Cell Tissue Organ Cult 83:145–151 Assani A, Haïcour R, Wenzel G, Côte F, Bakry F, Foroughi-Wehr B, Ducreux G, Aguillar ME, Grapin A (2001) Plant regeneration from protoplasts of dessert banana cv. Grand Naine (Musa spp., Cavendish sub-group AAA) via somatic embryogenesis. Plant Cell Rep 20:482–488 Burg K, Helmersson A, Bozhkov P, Von Arnold S (2007) Developmental and genetic variation in nuclear microsatellite stability during somatic embryogenesis in pine. J Exp Bot 58:687–698 Chung JP, Chang TL, Chi AYM, Shii CT (2006) Triploid banana cell growth phases and the correlation of medium pH changes with somatic embryogenesis in embryogenic cell suspension culture. Plant Cell Tissue Organ Cult 87:305–314 Côte FX, Domergue R, Monmarson S, Schwendiman J, Teisson C, Escalant JV (1996) Embryogenic cell suspensions from the male flower of Musa AAA cv. Grand Nain. Physiol Plant 97:285–290 Creste S, Benatti TR, Orsi MR, Risterucci AM, Figueira A (2006) Isolation and characterization of microsatellite loci from a commercial cultivar of Musa acuminata. Mol Eco Notes 6:303–306 Creste S, Tulmann Neto A, Silva SO, Figueira A (2003) Genetic characterization of banana cultivars (Musa spp.) from Brazil using microsatellite markers. Euphytica 132:259–268 Dai X, Xiao W, Huang X, Zhao J, Chen Y, Huang X (2010) Plant regeneration from embryogenic cell suspensions and protoplasts of dessert banana cv, ‘Da Jiao’ (Musa paradisiacal ABB Linn.) via somatic embryogenesis. In Vitro Cell Dev Biol Plant 46:403–410 Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. Focus 12:13–15 Elayabalan S, Kalaiponmani K, Pillay M, Chandrasekar A, Selvarajan R, Kumar KK, Balasubramanian P (2013) Efficient regeneration of the endangered banana cultivar ‘Virupakshi’ (AAB) via embryogenic cell suspension from immature male flowers. Afr J Biotechnol 12: 563–569 Fehe’r A, Pasternak TP, Dudits D (2003) Transition of somatic plant cells to an embryogenic state. Plant Cell Tissue Organ Cult 74:201–228 Food and Agriculture Organization of the United Nations Disponível em: http://www.faostat.fao.org/site/340/default.aspx>. Cited 06/07/2014 Fourré JL (2000) Somaclonal variation and genetic molecular markers in woody plants. In: Jain SM, Minocha SC (eds) Molecular biology of woody plants. Kluwer, The Netherlands, pp 425–449 Georget F, Domergue R, Ferrière N, Côte FX (2000) Morphohistological study of the different constituents of a banana (Musa AAA, cv. Grande naine) embryogenic cell suspension. Plant Cell Rep 19: 748–754 Guimarães NCC, Torga PP, Resende EC, Chalfun Júnior A, Paiva E, Paiva LV (2009) Identification of somaclonal variants in ‘Prata Anã’ banana using molecular and cytogenetic techniques. Ciênc Agrotecnol 33:448–454 (in Portuguese) Houllou-Kido LM, Kido EA, Falco MC, Silva Filho MC, Figueira AVO, Nogueira NL, Rossi ML, Tulmann Neto A (2005) Somatic embryogenesis and the effect of particle bombardment on banana Maçã regeneration. Pesq Agrop Brasileira 40:1081–1086 Husin N, Jalil M, Othman RY, Khalid N (2014) Enhancement of regeneration efficiency in banana (Musa acuminata cv. Berangan) by using proline and glutamine. Sci Hortic 168:33–37 Jafari N, Othman RY, Tan BC, Khalid N (2015) Morphohistological and molecular profiles during the developmental stages of somatic embryogenesis of Musa acuminata cv. ‘Berangan’ (AAA). Acta Physiol Plant 37:45–56 Jalil M, Khalid N, Othman RY (2003) Plant regeneration from embryogenic suspension cultures of Musa acuminata cv. Mas (AA). Plant Cell Tissue Organ Cult 75:209–214 Jeyakumar JJ, Kamaraj M, Thiruvengadam M (2014) Efficient plant regeneration from petiole explants of West Indian gherkin (Cucumis anguria L.) via indirect organogenesis. J Plant Biochem Biotechnol 23:307–315
Jin S, Mushke R, Zhu H, Tu L, Lin Z, Zhang Y, Zhang X (2008) Detection of somaclonal variation of cotton (Gossypium hirsutum) using cytogenetics, flow cytometry and molecular markers. Plant Cell Rep 27:1303–1316 Ju H-JJ, Jeyakumar J, Kamaraj M, Praveen N, Chung I-M, Kim S-H, Thiruvengadam M (2014) High frequency somatic embryogenesis and plant regeneration from hypocotyl and leaf explants of gherkin (Cucumis anguria L.). Sci Hortic 169:161–168 Kosky RG, Silva MF, Pérez LP, Gilliard T, Martínez FB, Vega MR, Milian MC, Mendonza EQ (2002) Somatic embryogenesis of the banana hybrid cultivar FHIA-18 (AAAB) in liquid medium and scaled-up in a bioreactor. Plant Cell Tissue Organ Cult 68:21–26 Kulkarni VM, Bapat VA (2013) Somatic embryogenesis and plant regeneration from cell suspension cultures of Rajeli (AAB), an endangered banana cultivar. J Plant Biochem Biotechnol 22:132–137 Leroy XJ, Leon K, Branchard M (2000) Plant genomic instability detected by microsatellite primers. Electron J Biotechnol 3:5–10 Lopes T, Pinto G, Loureiro J, Costa A, Santos C (2006) Determination of genetic stability in long-term somatic embryogenic cultures and derived plantlets of cork oak using microsatellite markers. Tree Physiol 26:1145–1152 Marum L, Rocheta M, Maroco J, Oliveira MM, Miguel C (2009) Analysis of genetic stability at SSR loci using somatic embryogenesis in maritime pine (Pinus pinaster). Plant Cell Rep 28:673–682 Mohandas S, Sowmya HD, Meenakshi S (2013) Somatic embryogenesis and plant regeneration through cell suspension in diploid (AB) banana cultivar Elakki Bale (syn Neypoovan). J Plant Biochem Biotechnol 22:245–249 Morais-Lino LS, Santos-Serejo JA, Silva SO, Santana JRF, Kobayashi AK (2008) Cell suspension culture and plant regeneration of a Brazilian plantain, cultivar Terra. Pesq Agrop Brasileira 43:1325– 1330 Murashige T, Skoog T (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473–497 Namanya P, Mutumba G, Magambo SM, Tushemereirwe W (2014) Developing a cell suspension system for Musa-AAA-EA cv. ‘Nakyetengu’: a critical step for genetic improvement of Matooke East African Highland bananas. In Vitro Cell Dev Biol Plant 50: 442–450 Pérez-Hernández JB, Rosell-García P (2008) Influorescence proliferation for somatic embryogenesis induction and suspension-derived plant regeneration from banana (Musa AAA, cv. ‘Dwarf Cavendish’) male flowers. Plant Cell Rep 27:965–971 Remakanthan A, Menon TG, Soniya EV (2014) Somatic embryogenesis in banana (Musa acuminate AAA cv. Grand Naine): effect of explant and culture conditions. In Vitro Cell Dev Biol Plant 50:127– 136 Rustagi A, Jain S, Kumar D, Shekhar S, Jain M, Bhat V, Sarin N (2015) High efficiency transformation of banana [Musa acuminata L. cv. Matti (AA)] for enhanced tolerance to salt and drought stress through overexpression of a peanut salinity-induced pathogenesisrelated class 10 protein. Mol Biotechnol 57:27–35 Sandal I, Bhattacharya A, Saini U, Kaur D, Sharma S, Gulati A, Kumar JK, Kumar N, Dayma J, Das P, Singh B, Ahuja PS (2011) Chemical modification of L-glutamine to alpha-amino glutarimide on autoclaving facilitates Agrobacterium infection of host and nonhost plants: a new use of a known compound. BMC Chem Biol 11:1–13 SAS Institute Inc. Statistical Analysis System. Release 9.1. (Software). Cary, 2002–2003 Scott A, Knott MA (1974) cluster analysis method for grouping means in the analysis of variance. Biometrics 30:507–512 Strosse H, Schoofs H, Panis B, Andre E, Reyniers K, Swennen R (2006) Development of embryogenic cell suspensions from shoot meristematic tissue bananas and plantains (Musa spp.). Plant Sci 170:104–112
MORAIS-LINO ET AL. Xiao W, Huang X, Gong Q, Dai XM, Zhao JT, Wei YR, Huang XL (2009) Somatic hybrids obtained by asymmetric protoplast fusion between Musa Silk cv. Guoshanxiang (AAB) and Musa acuminata cv. Mas (AA). Plant Cell Tissue Organ Cult 97: 313–321
Youssef M, James A, Mayo-Mosqueda A, Ku-Cauich JR, GrijalvaArango R, Escobedo-GM RM (2010) Influence of genotype and age of explant source on the capacity for somatic embryogenesis of two Cavendish banana cultivars (Musa acuminata Colla, AAA). Afr J Biotechnol 9:2216–2223
