Somatic Hypermutation of Ig Genes is Affected ... - Wiley Online Library

doi: 10.1111/j.1365-3083.2006.01758.x ............................................................................................................................................................................................................

Somatic Hypermutation of Ig Genes is Affected Differently by Failures in Apoptosis Caused by Disruption of Fas (lpr Mutation) or by Overexpression of Bcl-2 E. F. Mastache*y, K. Lindrothz, C. Fernańdezz & A´. Gonza´lez-Fernańdez*y

Abstract *Area of Immunology, Faculty of Biology, Vigo University, Vigo, Spain; and zDepartment of Immunology, The Wenner-Gren Institute, Stockholm University, Stockholm, Sweden Received 1 November 2005; Accepted in revised form 7 March 2006 Correspondence to: A´. Gonza´lez-Fernańdez, Area of Immunology, Faculty of Biology, Vigo University, Building of Experimental Sciences, Ruá das Abelairas S/N, Campus LagoasMarcosende, Vigo, 36310, Pontevedra, Spain. E-mail: [email protected]

The effects of the two main apoptotic pathways on the somatic hypermutation process were analysed. Transgenic mice carrying the VkOx1-Jk5 rat transgene were crossed with Fas-deficient lpr mice or with mice overexpressing the Bcl-2 protein. The transgenic VkOx1 segment and the endogenous JH4-Cm Ig intron from Peyer’s patches germinal centre B cells were sequenced to study the intrinsic somatic hypermutation process without the skewing effects of specific antigen selection. The lpr/ox mice displayed, in both regions, a high level of mutations with a normal pattern of substitutions. On the contrary, the bcl-2/ox mice displayed a lower level of mutations with an altered pattern, showing a decreased mutational rate in the intrinsic hotspots of the VkOx1 gene. Our results suggest that the lpr mutation does not have a direct effect on the somatic hypermutation process, but rather on the negative selection of B cells in the germinal centres, leading to the accumulation of recurrent mutations. In contrast, Bcl-2 overexpression might influence the somatic hypermutational process either by altering the incorporation of mutations or by enhancing the repair mechanism(s). The present work supports the hypothesis that both apoptotic pathways, Fas and Bcl-2, play distinct roles in the germinal centre reactions.

Introduction Apoptosis, or programmed cell death, is a crucial regulatory mechanism for maintaining homeostasis and for avoiding potentially hazardous lymphocyte specificities in the immune system [1]. Germinal Center (GC) in secondary lymphoid organs are the sites where the expansion and affinity maturation of Ag-activated B cell clones occur, a process that ends in the production of plasma cells and memory B cells [2, 3]. Affinity maturation is achieved by two separate mechanisms namely, somatic hypermutation (SHM) of the V region of rearranged Ig genes, which is responsible for the diversification of the B-cell repertoires, followed by positive selection of B cell clones with high affinity for the eliciting antigen. Newly generated autoreactive B cells or clones with null or low affinity are negatively selected [4, 5]. These GC B cells are believed

yC. Fernańdez and A. Gonza´lez-Fernańdez share senior authorship.

420

to die by apoptosis, although occasionally forbidden clones can be rescued from death by the edition of receptors unable to recognize self antigens [6]. There are two major pathways for induction of apoptosis: cross linking of death-receptors (‘extrinsic’ pathway) or stress signals that result in the disruption of mitochondria (‘intrinsic’ pathway) [1, 7, 8]. A well-characterized example of the death-receptor-induced-apoptosis is the binding of the Fas ligand (FasL) to Fas (CD95), a member of the tumour necrosis factor receptor family [9, 10]. It has been shown that Fas is highly expressed in GC B cells [11, 12], which are susceptible to Fas-mediated apoptosis in vitro [13, 14]. These observations suggest a functional role for Fas in the negative selection within the GC. Failure of this process by the mutation of Fas (lpr mutation) results in lymphoproliferative disease, with an oligoclonal expansion of autoreactive B cells bearing somatically mutated Igs [15, 16]. In the case of stress-induced-apoptosis, the ‘intrinsic’ pathway may be activated by a number of stimuli and is modulated by Bcl-2 family members in both pro- and

# 2006 The Authors Journal compilation # 2006 Blackwell Publishing Ltd. Scandinavian Journal of Immunology 63, 420–429

E. F. Mastache et al. lpr and Bcl-2 in Somatic Hypermutation 421 ............................................................................................................................................................................................................

anti-apoptotic fashions. Transgenic mice overexpressing the anti-apoptotic proteins Bcl-2 and Bcl-xL show an accumulation of low-affinity or autoreactive B cells, indicating that these cells are purged by apoptosis in normal mice [17, 18]. On the basis of these findings, it was postulated that the mitochondrial-apoptotic-pathway also contributes to the selection process in the GC [19]. Despite these experimental findings, the data provided by in vivo studies in genetically modified mice are controversial. In some studies Fas or Bcl-2 did not apparently play a major role in the process of affinity maturation [11, 20], but other authors demonstrated that both clonal selection and affinity maturation were severely perturbed in the lpr mice [21] and in mice overexpressing Bcl-2 [22, 23]. Important to point out is that most of the current knowledge is based on the GC reaction considered as a whole, where the contribution of SHM cannot be separated from the process of antigenic selection [11, 20, 21, 23]. In this work we aimed to identify the role of apoptosis in the intrinsic SHM process without the extreme skewing effects of specific Ag selection. Our strategy exploits the findings that (a) hypermutation is an ongoing process in the GC B cells of mouse Peyer’s patches (PP) [24]; and (b) both, the endogenous JH4-Cm Ig intron [25] and the VkOx1-Jk5 [26, 27] rat transgene, are effective targets for hypermutation, even if the rat k light chain is not forming part of the surface antibody (passenger transgene). Consequently, the pattern of mutations in PP GC B cells will reflect exclusively the intrinsic characteristics of the mutational process in the Ig intron; and in the VkOx1 transgene, only a minor contribution will be due to selection by specific antigens, since most of the copies are expressed as passengers. As an apoptosis deficient animal model, we used mice either lacking a functional Fas receptor or overexpressing the Bcl-2 protein, both crossed with transgenic mice carrying the VkOx1-Jk5 rat transgene: the lpr/ox and bcl-2/ox mice, respectively. Our results show that both apoptotic pathways affect the process of SHM in different ways. In the lpr/ox mice, the intrinsic hypermutation machinery is highly active but the pattern of mutations is preserved. In contrast, overexpression of Bcl-2 results in reduction of mutations with an altered pattern in intrinsic hotspots suggesting that overexpressed Bcl-2 affects directly or indirectly the SHM process.

Materials and methods Transgenic mice. The Lk6 transgenic mice (C57BL/6 CBA) were kindly provided by Dr Milstein (Medical Research Council, Cambridge) and carry five copies of Lk transgene (a mouse VkOx1-Jk5 rearrangement linked to a rat Ck) [26]. Intron sequences are of mouse origin, but the transgene includes a 27 bp deletion downstream of Jk5. The Lk6 mice were backcrossed to C57BL/6 for 10

generations to obtain the strain BLk6 that was generated and maintained at Stockholm University. The BLk6 mice were screened by an ELISA for the expression of the transgenic kappa rat chain in serum using anti-rat k light chains Ab (Sigma Chemical CO, St Louis, MO, USA). The B6.MRL-Tnfrsf6lpr strain, which carries the lpr mutation, was obtained from the Jackson Laboratory (Maine, USA). The C57BL/6-Em-bcl-2–36 strain, which overexpresses human bcl-2 on both B and T cell compartments [28], was originally provided by Dr A. W. Harris and afterwards bred at Stockholm University. Both, B6.MRL-Tnfrsf6lpr and C57BL/6-Em-bcl-2–36 strains were crossed independently with BLk6 mice, generating apoptosis deficient mice bearing the Lk transgene (here, we refer to both strains as lpr/ox and bcl-2/ox, respectively). The offspring in both strains of mice were tested for the presence of the rat Lk transgene using ELISA. The lpr mutation was monitored using polymerase chain reaction (PCR) amplification of DNA extracted from blood cells using the NucleoSpin kit (Clontech Laboratories Inc, Palo Alto, CA, USA) as detailed previously [29]. The expression of the human transgenic Bcl-2 protein was monitored using a fluorescence-activated cell sorter (FACS). Lymphocytes, isolated from blood using Lymphoprep (AXIS-SHIELD PoC AS, Oslo, Norway), were stained with phycoerithrin (PE)-conjugated antimouse CD45R (B220) (Pharmingen, San Diego, CA, USA) and fluorescein isothiocyanate (FITC)-conjugated anti-human Bcl-2 (DAKO A/S, Denmark) Abs and analysed using a FACScan (Becton Dickinson, Mountain View, CA, USA). In this study, lpr/ox (9–16 months old), bcl-2/ox (6 months old) mice and their respective wild type (WT) littermates were used. Wild type littermates for each group correspond to mice carrying in all cases the rat kappa transgene, but not the lpr mutation (called lpr/ox control) or the bcl-2 overexpression (called bcl-2/ox control). Animals were maintained under pathogen free conditions in the animal care facility. However, the lpr/ox mice and their WT littermates were maintained under more controlled conditions than the bcl-2/ox mice and their control group. In all cases the age, litter, and conditions where animals were maintained were identical between the experimental and their control mice. The mice were used according to the Swedish ethic guidelines regarding the use of animals in scientific research. Cell preparation and flow cytometry. Peyer’s patches were dissected from the small intestine of four mice from each group and a single cell suspension was prepared by teasing the patches on a sterile Falcon filter (BD Biosciences Discovery Labware Europe, Le Pont de Claix, France). After washing in cold PBS, the cells were double stained with FITC-conjugated peanut agglutinin (PNA) (SigmaAldrich Sweden AB, Stockholm, Sweden) at 20 mg/ml and PE-conjugated anti-mouse CD45R (B220) (Pharmingen)


E. F. Mastache et al. 422 lpr and Bcl-2 in Somatic Hypermutation ............................................................................................................................................................................................................

at 0.4 mg/ml for 40 min at 4 C. The B220þ PNAhigh cell population was isolated by sorting in a FACSVantage SE (Becton Dickinson). PP cell pellets were stored at 70 C until use. Isolation and amplification of DNA. Genomic DNA was isolated by treating the frozen cell pellets with proteinase K (100 mg/ml) (Roche Diagnostics S.L, Barcelona, Spain) in NH4 buffer (Bioline UK Ltd, London, UK)/1.5 mM MgCl2/ 0.5% Tween 20 at 56 C for 60 min followed by heat inactivation at 95 C for 30 min. Transgenic VkOx1 sequences were amplified by PCR using the primers previously described VKOX-BACK and LKFOR [24]. Amplification was carried out for 35 cycles (92 C, 2 min; 55 C, 1.5 min; 72 C, 2 min), and ending with 10 min at 72 C in NH4 buffer/1.5 mM MgCl2 containing 375 mM dNTP (Finnzymes Oy, Espoo, FIN) and 5 units of BIOTAQTM polymerase (Bioline) in a final volume of 50 ml. The PCR product was purified on agarose gel using NucleoSpin Extract kit (MACHEREY-NAGEL GmbH & Co. KG, Du¨ren, Germany). Purified PCR product was reamplified for 30 cycles and purified again under the same conditions as described above. Reamplified DNA was digested with EcoRI and BamHI (New England Biolabs UK Ltd, England, UK), purified with QIAquickPCR Purification Kit (QIAGEN GmbH, Hilden, Germany) and cloned into plasmid vector pBluescript þ using standard techniques [30]. To estimate the background error rate due to PCR, the transgenic V region from a previously characterized hybridoma carrying the Ig k light transgene was amplified and cloned as described above. Seventeen clones of this hybridoma were sequenced independently. For monitoring mutation at the endogenous IgH locus, the intronic region flanking the 30 -side of VHJ558/D/JH4 rearrangements was amplified by PCR using the primers previously described [25]. A PCR was carried out in 25 ml of a mixture containing 1.25 units of the high fidelity AccuTaq LA Polymerase (Sigma-Aldrich Quı´mica S.A., Madrid, Spain), 2.5 ml 10X PCR buffer (Sigma-Aldrich), 500 mM dNTP, and 400 nM of each primer. The thermal profile consisted of 10 cycles of 94 C (20 s), 64–55 C (touch down annealing) (20 s), and 4 min extension times at 68 C followed by a further 30 cycles, but with these extensions performed at 55 C. The PCR products were purified similarly as those of the transgene, reamplified for 30 cycles using the forward primer that hybridizes in a region 30 of JH4, JH4-2 (50 CTCCTCAGGTAAGAATGGCCTCTCCAGGT30 ) and purified again, as described above. Reamplified DNA was cloned into plasmid vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen SA, Barcelona, Spain). Sequencing. Each sequence reaction for rat transgene and Ig intron region was performed using the primers JK5FOR [31] and JH4-2, respectively. About 25–100 fmoles of pretreated plasmid (at 96 C 3 min) was sequenced using the Dye terminator Cycle Sequencing kit (Beckman Coulter,

Fullerton, CA, USA) in an automated DNA sequencer (CEQTM 2000, Beckman Coulter). In order to discriminate between transgene-encoded light chains (which contain a 27 bp deletion downstream of the Jk segment) from endogenous mouse light chains, the VkOx1 plasmids inserts were also sequenced with the LKFOR primer, that hybridizes downstream of the deleted region [24]. The multiple alignments of the sequences with their respective germline sequences were performed using the CLUSTAL X (version 1.8) multiple sequence alignment program. The GENEDOC (version 2.6.2002) software was also used to edit the results obtained. Statistical analysis. Mann–Whitney was used to evaluate data. It was considered statistically significant where P < 0.05.

Results Differences in the somatic hypermutation rate in transgenic Vk Ox1 region between lpr/ox and bcl-2/ox mice

The effect of apoptosis deficiency on the process of SHM was investigated in lpr/ox and bcl-2/ox mice, and compared with their respective control groups (all of them carrying the VkOx1-Jk5 rat transgene). The GC B cells were purified from PP as the B220þ and PNAhigh population using a FACSVantage SE. As it is shown in Fig. 1, there were no major differences between the percentages of B220þ/PNAhigh populations observed in test groups and those in their respective control mice (Fig. 1). Analysis of transgene sequences revealed that lpr/ox mice showed a significant increase (P < 0.005) in the total number of mutations, as compared to its control group (Table 1). Sixty-four percent of the lpr/ox clones carried more than one mutation with a frequency of mutation per bp of 2 102, while in its control group, only 20% showed more than one mutation with a frequency of mutation per bp of 0.5 102. It is important to note that the mutation frequency within the lpr/ox control mice was only slightly above the background error rate (0.2 102 mutation per bp). On the contrary, bcl-2/ox mice showed a significant decrease (P < 0.05) in the total number of mutations compared with bcl-2/ox control group. Only 59% of the analysed sequences in bcl-2/ox mice carried more than one mutation, showing a frequency of mutation of 1.2 102 per bp. In contrast, 83% of the clones in its control group showed more than one mutation, with a frequency of mutation of 2.3 102 mutation per bp (Table 1). No major differences in the accumulation of mutations per clone were observed between the groups, with the exception of when the two control groups were compared. While the majority of the clones in bcl-2/ox control mice accumulated high number of mutations ranging from 1 to 16, a large proportion of clones from lpr/ox control mice carried one or zero mutations (Fig. 2). These data, and also the differences found in the frequency of mutations


E. F. Mastache et al. lpr and Bcl-2 in Somatic Hypermutation 423 ............................................................................................................................................................................................................ Control Acquisition Dot Plot

104

lpr /ox Acquisition Dot Plot

FL2-H 102

FL2-H 102

102 FL1-H

103

100

101

101

104

100

104

Control Acquisition Dot Plot

5.6%

101

102 FL1-H

103

100

101

FL2-H

103

4.3%

104

104

100

101

102 FL1-H

103

104

PNA

between both control groups (Table 1), indicate that differences in the genetic background or, alternatively, in the environmental conditions where these mice were maintained may influence the level of mutations in those mice.

VκOx1 Transgene

A

Control

lpr /ox

8

Nucleotide substitution preferences in rat transgene

4

It is well known that the hypermutation process exhibits a preference for transitions over transversions [32] and that the nucleotide A mutates with a higher frequency compared to the complementary nucleotide T [33], being in the ratio A/T of approximately 2. The Fig. 3 shows that the pattern of nucleotide substitution preferences observed in PP GC B cells in the groups of mice analysed was similar to that previously defined for VkOx1 sequences

3 2

0

1

Mutations

Mutations per base pair (102)z

Control lpr/ox Control bcl-2/ox

44 28 23 27

9 18 19 16

58 161* 152 96y

0.5 2 2.3 1.2

*(P < 0.05) compared with lpr/ox control group. y(P < 0.05) compared with bcl-2/ox control group. zThe mutation per base pair was calculated as, total number of mutations/ (total number of clones analysed 282 bp sequenced).

10 1

8

2

6 5

Control

3

bcl-2/ox

16

16 0

15

13

Clones >1 mutation (%)

0

9

VkOx1 transgene Clones total

19

12 11

Table 1 Transgene mutations in Peyer’s patches GC B cells from apoptosis-deficient and control mice

Mice

18 10

7

B

(20) (64) (83) (59)

103

bcl-2/ox

FL2-H 102 100

102 FL1-H

Acquisition Dot Plot

101 100

Figure 1 Flow cytometry analysis of lymphocytes from Peyer’s patches. The percentage of GC B cells (B220þ PNAhigh) in lpr/ox (A), bcl2/ox (B) mice and in their respective controls are indicated in each graph, which correspond to the sorted population per group of mice.

101

102

100 104

B

101

103

B220

100

6.4%

103

7.6%

103

104

A

10

12

0

8

1 2

6

11 3 1

5

8

4 7

5

4 3

2

Figure 2 Accumulation of mutations in the transgenic V region from Peyer’s patches GC B cells. The area of each sector in the pie charts of lpr/ox (A), bcl-2/ox (B) mice and in their respective controls represents the proportion of clones with the indicated number of mutations.


424 lpr and Bcl-2 in Somatic Hypermutation E. F. Mastache et al. ............................................................................................................................................................................................................ VκOx1 Transgene

A

Control

lpr /ox

to T

C

to

% A

G

T 0.80 0.20 0 f r C 0.75 0.19 0.06 o 0.68 m A 0.19 0.13 G 0.06 0.19 0.75

-

T

mut 16 28 28 28

% C

A

G

T - 0.23 0.59 0.18 f r C 0.72 - 0.11 0.17 o m A 0.23 0.05 - 0.72 G 0.06 0.25 0.69

-

mut 11 33

PP

C to

24 T

Control

T T

-

to C

A

bcl-2/ox

G

0.57 0.26 0.17

f 0.10 0.14 r C 0.76 o 0.53 m A 0.29 0.18 G 0.14 0.19 0.67

-

% mut 15 28 33 24

T

T

to C

-

0.57 0.33 0.10

A

G

f r C 0.80 - 0.06 0.14 o A 0.21 0.17 - 0.62 m G 0.06 0.19 0.75 -

A

G

% mut

32 T

B

C

% mut

f r o m

-

C 0.79

0.63 0.21 0.16 -

A 0.34 0.29

0.13 0.08 -

G 0.20 0.16 0.64

15 23

0.37

36

-

26

22 36 25 17

Figure 3 Nucleotide substitutions in the mutated transgene from Peyer’s patches PNAhigh B Cells. The tables show, for each of the four bases in the VkOx1 sequence, the proportional distribution with which it is mutated to one of the other three bases in all groups of mice analysed: lpr/ox (A), bcl-2/ox (B) mice and in their respective controls, compared with data from PP (C) taken from reference [34]. In the last column on the right of each table is shown the percentage of mutations for each base.

in PP GC B cells of mice carrying the VkOx1-Jk5 transgene [34], except in lpr/ox mice. In this case, lpr/ox mice showed a frequency of the transversion from T to A higher than the transition from T to C (Fig. 3). The figure also shows the percentages of mutation of the four bases. In all cases, except for the bcl-2/ox mice, the ratio between the percentages of mutations targeting the nucleotide A compared to those affecting the complementary nucleotide T (A/T ratio) was approximately 2. Sequences from bcl-2/ox mice showed, in contrast, no mutational bias for A, with an A/T ratio of 1.1. Thus, the overexpression of Bcl-2 protein in bcl-2/ox mice alters the characteristic mutational bias of the process of SHM. Reduced hotspot mutations in bcl-2/ox mice

Hypermutation does not occur randomly within Ig V genes. Instead, certain positions constitute favoured sites of mutation (hotspots) while other positions are rarely mutated (coldspots) [35]. In order to study whether or not the hypermutation machinery of lpr/ox and bcl-2/ox mice displayed the expected clustering of mutation in intrinsic hotspots, we analysed the distribution of mutations along the VkOx1 transgene (Fig. 4). In lpr/ox mice (Fig. 4A), we observed the presence of the most characteristic intrinsic hotspots of the VkOx1 gene (third base of Ser-26, second of Ser-31 and second of Ser-77), as well as bases in Ser-7, His-34, Ala-60, Tyr-71 and Thr-85. Despite the low number of

mutations in the lpr/ox control group, mutations at the intrinsic hotspots Ser-26, Ser-31 and Ser-77 were also found (Fig. 4A). The data in Table 2 show that in lpr/ ox mice and in its control group, 12 out of 161 total mutations (7%) and 3 out of 58 total mutations (5%), respectively, were localized in the three hotspots encoding Ser-26, Ser-31 and Ser-77. In contrast, when bcl-2/ox mice and their control group were compared, unexpected differences in hotspot mutations were observed (Fig. 4B). While in the control group, 10 out of 152 mutations (7%) were at these three hotspots, in bcl-2/ox mice only 3 out of 96 mutations (3%) were at these positions showing a decrease in the percentage of mutations located at those special hotspots (Table 2). Surprisingly, in 27 sequences from bcl-2/ox mice, not a single mutation was found in Ser77, a position frequently mutated in the other groups. The number of mutations found within two hotspot consensus motifs, RGYW/WRCY (where R is A or G, Y is C or T and W is A or T) and WA/TW, preferentially mutated by the SHM mechanism [33, 36], were also analysed. The lpr/ox mice displayed a significant increase (P < 0.005) in the number of mutations targeting hotspot motifs compared with its control group (Table 2). On the contrary, bcl-2/ox mice displayed a significant reduction (P < 0.005) in hotspot targeting in the VkOx1 region compared with its control group (Table 2). In addition, we quantified the number of deleterious mutations in the VkOx1 transgenes (Table 2). The results show that mutations generating stop codons are present in



lpr /ox

Mutations

A

Control

VκOx1 Nucleotide position 0

Ser7 (II)

Ser77 Tyr71 (II) Thr85 (II) Ala60 (III) (II)

19 38 57 76 95 114 133 152 171 190 209 228 247 266 285

B bcl-2/ox

Control

Mutations

Figure 4 Distribution of mutations along the transgenic V region of Peyer’s patches GC B cells. Data are shown as the total number of mutations found in each nucleotide position along the VkOx1 transgene in lpr/ox (A), bcl-2/ox (B) mice and in their respective controls. The dominant individual hotspots are marked with the name and position of the amino acid, followed by the particular position in the codon (Roman numerals). The previously described most dominant intrinsic hotspots in the VkOx1 gene (third base of Ser-26, second base of Ser-31 and second base of Ser-77) are marked in bold.

6 5 4 3 2 1 0 1 2

Ser26 (III) Ser31 Ser26 (II) His34 (II) (I)

all groups, being much higher in the lpr/ox mice (36% of the clones), compared with 7–17% of clones analysed in the other groups (Table 2).

Analysis of mutations in endogenous JH4-Cm Ig intron

To further analyse the contribution of apoptosis in the intrinsic process of SHM, we selected an endogenous Ig target sequence, the JH4-Cm mouse Ig intron. The results indicate, similarly to those from the rat transgene, that lpr/ ox mice showed a significant increase (P < 0.05) in the number of mutations per bp as compared to their control littermates (1.8 and 0.8 102, respectively), and that

4 3 2 1 0 1 2 3 4 5

Ser26 Ser14 (III) Tyr36 (II) Ser31 (II) (II)

Ala60 (II)

Ser77 (II)

lpr/ox clones were highly mutated (Fig. 5A). On the contrary, bcl-2/ox mice displayed a significant reduction (P < 0.005) in the number of mutations per bp compared with their WT littermates (0.4 and 2.4 102, respectively) (Fig. 5B), even much more striking than the reduction observed in rat transgene region (Table 1). Finally, while no significant differences were found in the total number of mutations focusing hotspots motifs between lpr/ox mice and their control littermates (Table 3), bcl-2/ox mice showed again a significant reduction (P < 0.005) in hotspots mutations compared with its control group (Table 3). Thus, and similarly as in the rat transgene, the overexpression of the Bcl-2 protein alters the hotspot targeting by the SHM mechanism.

Table 2 Hotspots mutations in transgenic VkOx1 sequence from Peyer’s patches GC B cells

Discussion

VkOx1 transgene

Mice

Mutations at Ser-26, Ser-31, Ser-77

Mutations at RGYW/WRCY and WA/TWz


3 12 10 3

26 63* 86 42y

% of clones with stop codons 7 36 17 15

*P < 0.005 compared with lpr/ox control group. yP < 0.005 compared with bcl-2/ox control group. zMutations in G-C bps within RGYW/WRCY hotspots motifs, and in A-T bps within WA/TW hotspot motifs.

The objective of this work was to assess whether mutated Fas (lpr/ox mice) or overexpression of Bcl-2 protein (bcl2/ox mice) cause differences in the frequency or pattern of mutations in Ig genes of GC B cells, but in the absence of specific immunization. The hypermutational process was examined in PP GC B cells, carrying several copies of the mouse gene VkOx1-Jk5 linked to a rat constant region and in the 50 region of the JH4-Cm mouse Ig intron (358 pb). All transgene copies, either expressed or not, are able to mutate [27]. The majority of the copies are in fact nonexpressed, which allowed us to study mutational events


426 lpr and Bcl-2 in Somatic Hypermutation E. F. Mastache et al. ............................................................................................................................................................................................................ JH4-Cμ Intron

A

Control

lpr /ox 30

9 10

28 16

8

0

1

12

7 6

7

26

5

1

25 2

6

2 0.8

× 10–2

B

3 mutations/bp

1.8

× 10–2

bcl-2/ox

Control 28 29

13 0

3

27 1

19 18

30

6 5 4

mutations/bp

0

2 27

2 3

1

2.4 × 10–2 mutations/bp

0.4 × 10–2 mutations/bp

Figure 5 Mutations in the 50 region (358 bp) of the JH4-Cm mouse Ig intron in GC B cells. Pie slices represent the proportion of clones in lpr/ ox (A), bcl-2/ox (B) mice and in their respective controls that have the number of mutations indicated. The total number of clones analysed is indicated in the central circle of each pie. The overall mutation rate is given below each chart. Mann–Whitney test showed significant differences in total number of mutations between each test group and its respective control group (P < 0.05).

directly related to the hypermutation machinery with only minor contribution of antigen driven selection. We found that both the lpr/ox and the bcl-2/ox mice were able to accumulate mutations in the transgenic VkOx1 segment and in the 50 region of the JH4-Cm mouse Ig intron, suggesting that recruitment of B cell clones for SHM was

Table 3 Hotspots mutations in endogenous JH4-Cm region from Peyer’s patches GC B cells

Mice

JH4-Cm intron Mutations at RGYW/WRCY and WA/TWy


30 72 147 9*

*P < 0.005 compared with bcl-2/ox control group. yMutations in G-C bps within RGYW/WRCY hotspots motifs, and in A-T bps within WA/TW hotspot motifs.

functional in both strains of mice. However, the number of mutations per base and mutations targeting hotspots were different in the two strains of mice. The lpr/ox mice exhibited an increased accumulation of mutations with a normal distribution, while the bcl-2/ox mice showed a decrease in the mutation frequency and a reduction of mutations within the common RGYW/WRCY and WA/TW hotspot consensus motifs. In addition, bcl-2/ox mice displayed an atypical no mutational bias for the nucleotide A, with an A/T ratio of 1.1 (Fig. 3). This ratio differs from those obtained in the rest of the groups analysed and those previously published for the VkOx1-Jk5 in normal mice [34]. Alabyev and Manser [37], using MSH2-deficient mice crossed with mice overexpressing Bcl-2, found an altered A/T mutational in the VH186.2 coding region but not a reduction in the mutational rate affecting hotspots in JH flanking region of PP GC B cells. Due to the known mutagenic role of MSH2 [38, 39], the effect of Bcl-2 overexpression may be masked by the absence of MSH2 in their mice. This possible implication of Bcl-2 in the process of SHM has also been claimed by Kuo et al. [22] in PC-immunized bcl-2-transgenic mice, where they found an impaired clustering of mutations to hotspots motifs, but a normal frequency of mutation [22]. On the other hand, Smith et al. [23] showed that the overexpression of Bcl-2 in transgenic mice immunized with NP causes an accumulation of antigen-specific memory B cells with less mutated VH genes [23]. These contradictory results could be due not only to differences in the protocol of immunization and in the cells analysed, but also to the effect of antigen immunization which could mask the intrinsic SHM process. In this scenario, our approach avoids the skewing effects of specific antigen selection because, in the absence of immunization, mainly passenger transgenes and an endogenous Ig intron region were analysed. Moreover, the analysis of both expressed and not expressed copies of the transgene is giving a crucial information, because it shows mutations that in other circumstances will not be observed, as those recorded in antigen-selected cells. It is worthy to note the unexpected differences found in somatic mutation activity when both control groups were compared (Table 1 and Fig. 2). There are two possible explanations considering the genetic background or the placement in different compartments in our animal facilities. The bcl-2/ox and their control mice could be more exposed to environmental antigens than lpr/ox mice and their WT littermates. However, the fact that the level of mutations is lower in the group of lpr/ox control mice than in the bcl-2/ox control group (Table 1 and Fig. 2), neither invalidates the comparison between lpr/ox and bcl-2/ox mice nor affects the main issue of this work because the comparisons were done in animals maintained under the same conditions, and of the same age and sex. Indeed, the type of nucleotide substitutions (Fig. 3) and mutational A/T ratio (Fig. 3), and the pattern of distribution of



mutations (Fig. 4) that is quite characteristic and preserved in the process of SHM, are both maintained in controls (lpr/ox and bcl-2/ox controls) and in lpr/ox mice, but clearly affected in bcl-2/ox mice. The results obtained in bcl-2/ox mice showing a lower level of mutations and a reduced number of mutations within intrinsic hotspots indicate that alteration of apoptosis by overexpression of Bcl-2 affects the process of SHM. Taking into account the ability of Bcl-2 to retard the cell cycle progression [40–43], a possible explanation for our findings is that overexpression of Bcl-2 allows an increased repair of mutations. Alternatively, Bcl-2 could interact with the hypermutation/repair machinery, leading to a modulation of the mismatch repair activity. This could imply a Hypermutation

Centroblast

more efficient repair of mutations located mainly in hotspots and adenines in the VkOx1-Jk5 transgene. A possible cause for the high degree of mutations observed in lpr/ox mice could be that Fas inactivation allows B cells to re-enter several cycles of hypermutation leading to accumulation of highly mutated low affinity B cells which was also suggested by Takahashi et al. [21]. This recurrence of B cell mutations may even explain the accumulation of deleterious mutations found in the transgenic VkOx1 region in lpr/ox mice. Based on data from various reports [19, 21, 22] and the results presented here, we propose a model to explain the role for Fas and Bcl-2 mediated apoptosis in the GC reaction (Fig. 6). Regulation of cell death and survival

Selection

Observed

Centrocyte Normal SHM

Inactive FAS Bcl-2 low


Survival signals

Inactive FAS Bcl-2 high

Normal pattern of SHM Hotspots preserved

WT Active FAS Bcl-2 low

Normal SHM


Re-entry?

lpr /ox


Inactive FAS Bcl-2 high Inactive FAS Bcl-2 low


Altered SHM

Apoptosis

Apoptosis



More mutations More deleterious mutations Hotspots preserved

Less mutations Altered mutational ratio A/T Hotspots altered

bcl-2/ox Repair?

Dark zone

Active FAS Bcl-2 high

Apoptosis

Light zone

⊥ = Blockade SHM = Somatic hypermutation

Figure 6 Proposed Hypothesis of the Role of Fas and Bcl-2 in GC Reactions. Under normal conditions (WT), centroblasts (expressing an inactive Fas and low levels of Bcl-2) undergo a normal process of somatic hypermutation (hypermutation step) in the dark zone of the GC. Later on, centrocytes in the light zone are selected (selection step). Survival signals will rescue high affinity centrocytes by the up-regulation of Bcl-2 maintaining Fas in an inactive form. In contrast, null, low or autoreactive cells will die by apoptosis induced by an active Fas and low levels of Bcl-2. In lpr/ox mice, the presence of a mutated and inactive Fas (lpr mutation) does not affect the hypermutation step but can block apoptosis (^), thereby altering the selection process. The B cell clones that should be eliminated by apoptosis survive and could re-enter the hypermutation step, accumulating high number of mutations but with a normal pattern. Finally, in bcl-2/ox mice, the overexpression of Bcl-2 protein alters the process of somatic hypermutation at the stage of centroblast. Our hypothesis is that Bcl-2 could interact with the machinery of hypermutation/repair favouring the repair of the mutated nucleotides. The resulting mutated cells show lower number of mutations, an affected A/T mutational ratio and an altered pattern of hotspots. The next step, the selection process, does not seem to be affected.


428 lpr and Bcl-2 in Somatic Hypermutation E. F. Mastache et al. ............................................................................................................................................................................................................ during the GC reaction occurs in two main steps: hypermutation and selection. While undergoing SHM, centroblasts divide actively maintaining low levels of Bcl-2 and high levels of inactive Fas. The resulting B cells move to the light zone where high affinity centrocytes are positively selected. At this stage, co-stimulatory signals would lead to maintenance of Fas in an inactive form and to upregulation of Bcl-2 rescuing the cells from Fas-inducedapoptosis. The B cells with null or low receptor engagement express active Fas becoming sensitive to apoptosis. Certainly, constitutive overexpression of Bcl-2 or defects in Fas will modify this scenario. Inactivation of Fas in lpr/ ox mice (Fig. 6) will not have major implications in the hypermutation step. Cells will undergo a normal process of SHM but, in the selection step, most centrocytes will survive due to their inactive mutated Fas. Some of these cells could re-enter the GC and undergo further rounds of mutations resulting in highly mutated B cells but showing a normal SHM pattern. In contrast, in bcl-2/ ox mice we propose that the hypermutation process is altered due to abnormal expression of Bcl-2 in the dark zone centroblasts, leading to modulation of the hypermutation/repair process (Fig. 6). Thus, centroblasts in bcl-2/ ox mice have a lower number of mutations and an altered pattern of intrinsic hotspots. The resulting mutated centrocytes will be subjected to a normal selection process mediated by functional Fas, even in the presence of high levels of Bcl-2 protein. Collectively, the results presented in this paper contribute new evidence for the role of Fas and Bcl-2 in the process of SHM. However, further experiments will help to ascribe the exact role of Bcl-2 in the SHM process.

Acknowledgments We thank Xunta de Galicia (Spain) for the DNAautomatic sequencer (Beckman); Dr Susana Magadań and Dr A. Sanjuan and his group for sequencing assistance and Refaat Shalaby and Jose´ Faro for helpful discussions and editorial comments. This work was supported by Instituto de Salud Carlos III y Xunta de Galicia. E.F.M. was supported by a FPU grant from the Ministerio de Educacioń, Cultura y Deporte (Spain), and K.L. was supported by a grant from Stockholm University.

References 1 Opferman JT, Korsmeyer SJ. Apoptosis in the development and maintenance of the immune system. Nat Immun 2003;4:410–5. 2 Berek C, Berger A, Apel M. Maturation of the immune response in germinal centers. Cell 1991;67:1121–9. 3 Rajewsky K. Clonal selection and learning in the antibody system. Nature 1996;381:751–8.

4 Kelsoe G. Life and death in germinal centers (redux). Immunity 1996;4:107–11. 5 Pulendran B, van Driel R, Nossal GJ. Immunological tolerance in germinal centres. Immunol Today 1997;18:27–32. 6 Papavasiliou F, Casellas R, Suh H et al. V(D)J recombination in mature B cells: a mechanism for altering antibody responses. Science 1997;278:298–301. 7 Budihardjo I, Oliver H, Lutter M, Luo X, Wang X. Biochemical pathways of caspase activation during apoptosis. Annu Rev Cell Dev Biol 1999;15:269–90. 8 Green DR. Apoptotic pathways: paper wraps stone blunts scissors. Cell 2000;102:1–4. 9 Nagata S, Golstein P. The Fas death factor. Science 1995;267:1449–56. 10 Krammer PH. CD95’s deadly mission in the immune system. Nature 2000;407:789–95. 11 Smith KG, Nossal GJ, Tarlinton DM. FAS is highly expressed in the germinal center but is not required for regulation of the B-cell response to antigen. Proc Natl Acad Sci USA 1995;92:11628–32. 12 Martinez-Valdez H, Guret C, de Bouteiller O, Fugier I, Banchereau J, Liu YJ. Human germinal center B cells express the apoptosis-inducing genes Fas, c-myc, P53, and Bax but not the survival gene bcl-2. J Exp Med 1996;183:971–7. 13 Liu YJ, Barthelemy C, de Bouteiller O, Arpin C, Durand I, Banchereau J. Memory B cells from human tonsils colonize mucosal epithelium and directly present antigen to T cells by rapid upregulation of B7-1 and B7-2. Immunity 1995;2:239–48. 14 Choe J, Kim HS, Zhang X, Armitage RJ, Choi YS. Cellular and molecular factors that regulate the differentiation and apoptosis of germinal center B cells. Anti-Ig down-regulates Fas expression of CD40 ligand-stimulated germinal center B cells and inhibits Fasmediated apoptosis. J Immunol 1996;157:1006–16. 15 Shlomchik MJ, Marshak-Rothstein A, Wolfowicz CB, Rothstein TL, Weigert MG. The role of clonal selection and somatic mutation in autoimmunity. Nature 1987;328:805–11. 16 Watanabe-Fukunaga R, Brannan CI, Copeland NG, Jenkins NA, Nagata S. Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature 1992;356:314–7. 17 Hande S, Notidis E, Manser T. Bcl-2 obstructs negative selection of autoreactive, hypermutated antibody V regions during memory B cell development. Immunity 1998;8:189–98. 18 Takahashi Y, Cerasoli DM, Dal Porto JM et al. Relaxed negative selection in germinal centers and impaired affinity maturation in bcl-xL transgenic mice. J Exp Med 1999;190:399–410. 19 van Eijk M, Defrance T, Hennino A, de Groot C. Death-receptor contribution to the germinal-center reaction. Trends Immunol 2001;22:677–82. 20 Smith KG, Weiss U, Rajewsky K, Nossal GJ, Tarlinton DM. Bcl-2 increases memory B cell recruitment but does not perturb selection in germinal centers. Immunity 1994;1:803–13. 21 Takahashi Y, Ohta H, Takemori T. Fas is required for clonal selection in germinal centers and the subsequent establishment of the memory B cell repertoire. Immunity 2001;14:181–92. 22 Kuo P, Alban A, Gebhard D, Diamond B. Overexpression of bcl-2 alters usage of mutational hot spots in germinal center B cells. Mol Immunol 1997;34:1011–8. 23 Smith KG, Light A, O’Reilly LA, Ang SM, Strasser A, Tarlinton D. bcl-2 transgene expression inhibits apoptosis in the germinal center and reveals differences in the selection of memory B cells and bone marrow antibody-forming cells. J Exp Med 2000;191:475–84. 24 Gonza´lez-Fernańdez A´, Milstein C. Analysis of somatic hypermutation in mouse Peyer’s patches using immunoglobulin kappa lightchain transgenes. Proc Natl Acad Sci USA 1993;90:9862–6. 25 Jolly CJ, Klix N, Neuberger MS. Rapid methods for the analysis of immunoglobulin gene hypermutation: application to transgenic and gene targeted mice. Nucleic Acids Res 1997;25:1913–9.


E. F. Mastache et al. lpr and Bcl-2 in Somatic Hypermutation 429 ............................................................................................................................................................................................................ 26 Sharpe MJ, Milstein C, Jarvis JM, Neuberger MS. Somatic hypermutation of immunoglobulin kappa may depend on sequences 3’ of C kappa and occurs on passenger transgenes. EMBO J 1991;10:2139–45. 27 Betz AG, Rada C, Pannell R, Milstein C, Neuberger MS. Passenger transgenes reveal intrinsic specificity of the antibody hypermutation mechanism: clustering, polarity, and specific hot spots. Proc Natl Acad Sci USA 1993;90:2385–8. 28 Strasser A, Harris AW, Vaux DL et al. Abnormalities of the immune system induced by dysregulated bcl-2 expression in transgenic mice. Curr Top Microbiol Immunol 1990;166:175–81. 29 Singer GG, Abbas AK. The fas antigen is involved in peripheral but not thymic deletion of T lymphocytes in T cell receptor transgenic mice. Immunity 1994;1:365–71. 30 Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual, 2nd edn. New York: Cold Spring Harbor Laboratory Press, 1989. 31 Rada C, Gupta SK, Gherardi E, Milstein C. Mutation and selection during the secondary response to 2-phenyloxazolone. Proc Natl Acad Sci USA 1991;88:5508–12. 32 Neuberger MS. Novartis Medal Lecture. Antibodies: a paradigm for the evolution of molecular recognition. Biochem Soc Trans 2002;30:341–50. 33 Milstein C, Neuberger MS, Staden R. Both DNA strands of antibody genes are hypermutation targets. Proc Natl Acad Sci USA 1998;95:8791–4. 34 Betz AG, Milstein C, Gonza´lez-Fernańdez A´, Pannell R, Larson T, Neuberger MS. Elements regulating somatic hypermutation of an immunoglobulin kappa gene: critical role for the intron enhancer/ matrix attachment region. Cell 1994;77:239–48.

35 Wagner SD, Neuberger MS. Somatic hypermutation of immunoglobulin genes. Annu Rev Immunol 1996;14:441–57. 36 Rogozin IB, Pavlov YI, Bebenek K, Matsuda T, Kunkel TA. Somatic mutation hotspots correlate with DNA polymerase eta error spectrum. Nat Immun 2001;2:530–6. 37 Alabyev B, Manser T. Bcl-2 rescues the germinal center response but does not alter the V gene somatic hypermutation spectrum in MSH2-deficient mice. J Immunol 2002;169:3819–24. 38 Rada C, Ehrenstein MR, Neuberger MS, Milstein C. Hot spot focusing of somatic hypermutation in MSH2-deficient mice suggests two stages of mutational targeting. Immunity 1998;9:135–41. 39 Reynaud CA, Aoufouchi S, Faili A, Weill JC. What role for AID: mutator, or assembler of the immunoglobulin mutasome? Nat Immun 2003;4:631–8. 40 Linette GP, Li Y, Roth K, Korsmeyer SJ. Cross talk between cell death and cell cycle progression: BCL-2 regulates NFAT-mediated activation. Proc Natl Acad Sci USA 1996;93:9545–52. 41 Mazel S, Burtrum D, Petrie HT. Regulation of cell division cycle progression by bcl-2 expression: a potential mechanism for inhibition of programmed cell death. J Exp Med 1996;183: 2219–26. 42 O’Reilly LA, Huang DC, Strasser A. The cell death inhibitor Bcl-2 and its homologues influence control of cell cycle entry. EMBO J 1996;15:6979–90. 43 Huang DC, O’Reilly LA, Strasser A, Cory S. The anti-apoptosis function of Bcl-2 can be genetically separated from its inhibitory effect on cell cycle entry. EMBO J 1997;16:4628–38.
