Somatic mosaicism and female-to-female transmission in a ... - NCBI

Proc. Nail. Acad. Sci. USA Vol. 88, pp. 39-42, January 1991 Genetics

Somatic mosaicism and female-to-female transmission in a kindred with hemophilia B (factor IX deficiency) (bleeding disorder/polymerase chain reaction/mutations/embryology)

S. A. M. TAYLOR*, K. V. DEUGAUt, AND D. P. LILLICRAP* *Department of Pathology, and tRegional Protein/DNA Chemistry Service, Department of Biochemistry, Queen's University, Kingston, ON K7L 3N6, Canada

Communicated by Oscar D. Ratnoff, September 24, 1990

The studies described here were prompted by two unusual observations in a family with hemophilia B. Elucidation of the causative mutation in the one affected male in the family revealed a change that was not compatible with his mild phenotype. In addition, the daughter and granddaughter of this patient were both diagnosed with moderately severe hemophilia B, thus representing the occurrence of femaleto-female transmission of a chromosome X-linked disorder.

Studies have shown that hemophilia B ABSTRACT (Christmas disease; factor IX deficiency) results from many different mutations in the factor IX gene, of which >95% are single nucleotide substitutions. This study has identified a previously unreported form of hemophilia B in a patient who was a somatic mosaic for a guanine-to-cysine transversion at nucleotide 31,170 in the factor IX gene. This point mutation changes the codon for residue 350 in the catalytic domain of factor IX from a cysteine to a serine. We used differential termination of primer extension to confirm and measure the degree of mosaicism. Our study shows that a varying proportion of cells from hepatic, renal, smooth muscle, and hematopoietic populations possessed normal as well as mutant factor IX sequences. These results indicate that the mutation in this patient occurred either as an uncorrected half-chromatid mutation in the female gamete or as a replication or postreplication error in the initial mitotic divisions of the zygote preceding implantation. In addition, this kindred also contains two females in successive generations who have moderately severe factor IX deficiency. The molecular pathogenesis of this latter phenomenon has been studied and seems to relate to the unaccompanied expression of the mutant factor IX gene consequent upon a second, as yet undefined, genetic event that has prevented inactivation of sequences including the mutant factor IX gene on the X chromosome inherited from the affected male.

MATERIALS AND METHODS Hemophilia B Family. The affected male is the only known case ofhemophilia in this family. He was originally diagnosed with hemophilia B following a severe posttonsillectomy hemorrhage in his daughter. He has never had spontaneous bleeding problems but does bleed excessively following surgical and dental procedures. Both the daughter and granddaughter have had spontaneous musculoskeletal bleeding episodes in addition to postprocedural bleeding. All family members gave informed consent prior to the initiation of these studies. Coagulation Studies. Factor IX clotting activity was determined in platelet-poor plasma from all individuals with a one-stage clotting assay (11). Factor IX antigen was determined with an enzyme-linked immunosorbent assay (12). All studies were performed three times with the simultaneous testing of a commercial reference plasma standard (Assayed Reference Plasma; Helena Laboratories). Results are reported as a mean of these studies. The normal range for these assays is derived from a pool of 20 normal plasmas [factor IX clotting activity, mean = 0.91 unit/ml ± 2 SD (range, 0.46-1.36 units/ml); factor IX antigen, mean = 0.93 unit/ml + 2 SD (range, 0.52-1.34 units/ml)]. Factor IX Mutation Characterization. Genomic DNA was isolated from whole blood as described (13). Oligonucleotides were synthesized to amplify all factor IX exons and splice junctions based on the published genomic DNA sequence for factor IX. The hemophilia B mutation was identified in exon H of the factor IX gene following amplification with primers corresponding to nucleotides 30,780-30,800 and 31,41031,390 of the factor IX gene (8). The genomic DNA was subjected to 30 cycles of asymmetric polymerase chain reaction (PCR) using a DNA thermal cycler (Perkin-Elmer/ Cetus) and Thermus aquaticus (Taq) DNA polymerase (Perkin-Elmer/Cetus) (14). The constituents for each PCR were 1 .g ofgenomic DNA, 50 pmol of the first and 0.5 pmol of the second amplification primer, 5 pI. of 10x Taq polymerase buffer (15), dNTPs to a final concentration of 250 ,uM (Sigma), and 2.5 units of Taq polymerase. Each PCR cycle consisted of 940C for 2 min, 550C for 2 min, and 720C for 3 min, with a final extension time of 15 min at 720C. Amplified target fragments were purified on Centricon-30 microcon-

Hemophilia B (Christmas disease) is a chromosome X-linked recessive inherited bleeding disorder that has an incidence of approximately 1 in 30,000 males (1). The disorder is a result ofeither a deficient or defective factor IX molecule, a vitamin K-dependent serine protease that participates in the intrinsic pathway of hemostasis (2). The variability of the clinical and laboratory manifestations of hemophilia B suggests that the disease is the result of many different mutations within the factor IX gene, and studies have shown that >95% of these mutations are single nucleotide substitutions (3-5). The genetic pathology responsible for hemophilia B has been the focus of intense investigation since the cloning and characterization of the factor IX gene in 1982 (6-8). Study of the patterns of these mutations suggests that certain recurring mild mutations appear to have arisen from a common ancestor (9), whereas other severe phenotypes result from repeated mutations often at sequences involving CpG dinucleotides (5). The origin of these latter mutations has until recently been assumed to involve replication or postreplication DNA repair errors occurring during meiosis. There is growing evidence, however, to suggest that some (perhaps many) of these previously unreported mutations arise as a result of errors in replication during mitosis in early embryogenesis (10). The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Abbreviations: PCR, polymerase chain reaction; ASO, allelespecific oligonucleotide. 39

40

Genetics:

Taylor et al.

centrators (Amicon) prior to dideoxy sequencing with phage T7 DNA polymerase (Pharmacia) and [a-32P]dATP (16). The limiting primer in the PCR was used as the sequencing primer. Allele-Specific Oligonucleotide (ASO) Analysis. Genomic DNA was extracted from whole blood and other tissue sources as described above. The DNA was subjected to 30 cycles of symmetric PCR using the exon H primers detailed above. The amplified products were denatured with NaOH and applied to GeneScreenPlus nylon membrane (DuPont) in a slot-blot manifold. The membranes were prehybridized in 5x SSPE (20x SSPE = 3 M NaCl/0.2 M NaH2PO4H2O/0.02 M Na2 EDTA, pH 7.4) containing 0.1% polyvinylpyrrolidone, 0.1% Ficoll, 0.1% bovine serum albumin, and 0.5% sodium dodecyl sulfate before hybridization with the oligonucleotide probes, which had been end-labeled with [y-32P]ATP (3000 Ci/mmol, 1 Ci = 37 GBq; New England Nuclear) by using T4 polynucleotide kinase (BRL). The normal sequence probe consisted of factor IX nucleotides 31,162-31,179 (8), whereas the mutant probe was identical to this sequence apart from the replacement of a cytosine residue by a guanine residue at position 31,170. After overnight hybridization, the filters were washed first in 0.90 M NaCl/0.09 M sodium citrate, pH 7, at 230C and then in 0.60 M NaCl/0.06 M sodium citrate, pH 7, at 520C. Differential Termination of Primer Extension. Genomic DNA from the affected male's various tissues (blood leukocytes, liver, kidney, and small intestinal smooth muscle), from family members, and from a normal control were amplified by PCR with primers corresponding to nucleotides 31,149-31,165 (primer Ml) and 31,172-31,188 (primer M2) of the factor IX gene. The reaction products were purified on Centricon-30 microconcentrators. Primer Ml was endlabeled with [y-32P]ATP by using T4 polynucleotide kinase, and 30 cycles of primer extension were performed with 2 units of Taq polymerase, 2 p1 of 100 mM dTTP, 2 kd of 100 mM dCTP, and 0.5 pmol of end-labeled primer. The reaction products were analyzed, after denaturation, on a 20%6 sequencing gel using end-labeled 21- and 23-nucleotide oligonucleotides as size markers. Each primer extension experiment was repeated from five independent PCR amplifications, and the resulting autoradiographic signals were quantified by laser densitometry using an LKB Ultroscan laser densitometer and the computer program LKB 2400 Gel Scan XL.

Proc. Natl. Acad. Sci. USA 88 (1991) A

A T G C

-orr _m or

'WWT

.-*

--G

__

B

T ,am-CG7

Catalytic Donwin Exon G

Exon H

6r) ®C-" ) FIG. 1. (A) Sequencing autoradiographs from normal genomic DNA and from affected male EW (I-1). Each autoradiograph shows the sequence around codon 350 (TGT) of the factor IX gene. In the affected male, a cytosine residue is present as the middle nucleotide of this codon, while a less distinct guanine band is still seen in the sequencing ladder. (B) Line diagram of the catalytic domain of factor IX encoded by exons G and H. The three intrachain disulfide bonds are indicated as well as the histidine (H), aspartate (D), and serine (S) residues, which constitute the catalytic triad. The site ofthe cysteineto-serine substitution at residue 350 is indicated.

cytosine residue as well as a fainter guanine band. Sequencing of this factor IX exon in both hemophilia B females showed guanine and cytosine bands of equal intensity at this nucleotide. Sequencing of the remaining exons and splice junctions in the factor IX gene of all three individuals showed no additional changes. Confirmation and Quantitative Assessment of Somatic Mosalcism. To establish the unequivocal existence of mosaicism for this mutation in the affected male, two additional strategies were used. ASO probing of amplified genomic DNA from leukocytes and liver showed the presence of both the normal and mutant sequence at nucleotide 31,170 (Fig. 2). Both of these tissues appeared to contain significantly more of the mutant sequence as compared with the normal sequence. In leukocytes from the two affected females, the two sequences were, as expected, present in equal amounts. In spite of these results, we felt that the fastidious nature of ASO testing did not lend itself to the definitive quantifi-

Ii RESULTS Coagulation and Mutation Detection Studies. The one affected male in the family had a factor IX clotting activity of 0.35 unit/ml (normal range, 0.46-1.36 units/ml) and a factor IX antigen of 0.45 unit/ml (normal range, 0.52-1.34 units/ ml). The coagulation phenotype in the two affected females showed a factor IX clotting activity of 0.03 unit/ml and a factor IX antigen of 0.04 unit/ml. Additional studies of two other vitamin K-dependent coagulation proteins (factors VII and X) in these individuals were normal, and their prothrombin times were normal (11 sec; control, 11 sec). Direct dideoxy sequencing of the PCR-amplified exon H sequence from factor IX in the affected male showed a G -. C transversion at nucleotide 31,170 of the factor IX gene (Fig. 1). This alters the codon for cysteine (TGT) at amino acid residue 350 to that for serine (TCT). Sequencing of several independently amplified products for this region showed the presence of a less distinct band, which corresponded to the normal guanine residue at nucleotide 31,170 (Fig. 1). This patient has subsequently died from a metastatic gastric carcinoma and we have analyzed the same DNA sequence from liver, kidney, and intestinal smooth muscle cells. The sequence at nucleotide 31,170 always showed an unequivocal

EWO( -1)

Norma A T G C

(aN

11

2

1_

I

:b) I

III

C

III,

NormalI

Mutant

I

I

FIG. 2. Line diagram of hemophilia B kindred: the affected male (I.1) and the hemophiliac females (II.1 and III.1). Below the pedigree are the results of allele-specific oligonucleotide probing with oligonucleotides corresponding to the normal and mutant sequence at nucleotide 31,170. The slots correspond to genomic DNA from the subjects above: 1.1 (a) is leukocyte DNA, 1.1 (b) is liver DNA, and (C) is control (normal) DNA. The mutant and normal sequences are detected with equal intensity in the two hemophilic females, while the mutant sequence is predominant in the two tissues from the affected male.

Genetics.

Taylor et al.

Proc. Natl. Acad. Sci. USA 88 (1991)

Primer *

CCATCTATAACAACATGTTCT

GGTAGATATTGTTGTACAAGACACGT---

norn mal

21 nucleotides

termination (no dGTP) Primer *

CCATCTATAACAACATGTTCTC

GGTAGATATTGTTGTACAAGAGACACGT---

mutaant

23 nucleotides

FIG. 3. Illustration of the principle underlying the differential termination of primer extension experiments. The end-labeled 17mer primer is hybridized to the PCR-amplified template, and primer extension is performed in the presence of dCTP and dTTP only. Products of 21 nucleotides and 23 nucleotides result from extension from normal and mutant templates, respectively.

cation of the extent of mosaicism in the various tissues from the affected male. Therefore, we carried out additional studies utilizing a technique of differential termination of primer extension to distinguish normal from mutant sequences. With this technique, a labeled synthetic 17-nucleotide primer hybridized to the noncoding strand five nucleotides away from the site of mutation. Extension of the primer in the presence of only dTTP and dCTP resulted in the addition of only four nucleotides in the normal sequence and six nucleotides in the mutated sequence, permitting precise determination of the proportion of mutant sequence by measurement of the ratio of the 23-nucleotide (mutant) extension product to the 21nucleotide (normal) product, as shown in Fig. 3. These experiments showed that the proportions of cells carrying the normal sequence at nucleotide 31,170 in the liver, leukocytes, kidney, and smooth muscle cells were 13%, 9o, 48%, and 52%, respectively (Fig. 4 and Table 1). Additional Studies on the Female Hemophiliacs. The extremely unusual finding of moderately, severe hemophilia in females in two successive generations was also further investigated. No additional clinical abnormalities were identified in either female, and cytogenetic studies showed no evidence of a chromosome X, autosome translocation nor any other abnormalities (the karyotype in the affected male was also normal). As detailed above, no additional sequence changes were identified in the factor IX gene in either woman, and Southern analysis of the regulatory regions of factor IX up to 100 kb 5' and 3' from the gene showed no gross changes. Finally, factor IX polymorphic haplotypes were obtained for both women (intragenic Taq I and threonine/

1l

(a)

(b)

(c)

(d)

III

C 23nt

21nt-

FIG. 4. Diagram of the hemophilia B kindred identified as in Fig. 2. (Lower) Results of the differential termination of primer extension studies. Mutant sequences are represented by a band at 23 nucleotides (nt), and normal sequence, by a band at 21 nucleotides. (Upper) Samples 1.1 (a), 1.1 (b), 1.1 (c), and 1.1 (d) represent DNA from smooth muscle, kidney, liver, and leukocytes, respectively. C represents genomic DNA from a normal control. Densitometric analysis of the autoradiographic band intensities is shown in Table 1.

41

Table 1. Summary of the densitometric analysis of the differential termination of primer extension studies of the guanine-to-cytosine transversion at nucleotide 31,170 % of total cells, mean ± SD (n = 5) Kindred sample Normal Mutant 1.1 Leukocytes 9.3 ± 1.6 90.7 ± 1.6 Liver 13.1 ± 4.6 86.9 ± 4.6 Kidney 47.6 ± 1.6 52.4 ± 1.6 Smooth muscle 52.0 ± 2.0 48.0 ± 2.0 11.1 Leukocytes 50.5 ± 5.8 49.5 ± 5.8 111.1 Leukocytes 49.2 ± 1.6 50.8 ± 1.6 Kindred are identified as in Fig. 2.

alanine-148 polymorphisms) and demonstrated the presence of two normal X chromosomes with different haplotypes (data not shown).

DISCUSSION This hemophilia B kindred demonstrates two phenomena of interest in consideration of the pathogenesis of inherited single-gene disorders. The demonstration of somatic mosaicism for the hemophilia B mutation in the affected male has important implications in terms of the timing of this event. In view of the ratios of normal and mutant sequences in the kidney and smooth muscle cells, the mutation in the affected male reported here has been shown to be either the result of a half-chromatid mutation generated during meiosis that was not corrected before fertilization (17) or a replication or post-replication repair error during the first mitotic divisions in the zygote preceding implantation. This mutation has changed the codon for a cysteine at amino acid residue 350 in the factor IX catalytic domain to a codon for serine. This mutation has not been reported previously. However, the cysteine residue at position 350 participates in an intrachain disuffide bond with the cysteine at residue 336. Green et al. (4) have reported the finding of a mutation that results in the substitution of an arginine for the cysteine at the paired 336 residue. The individual affected with this mutation (factor IX London 8) has a moderately severe phenotype (factor IX clotting activity of 0.02 unit/ml and factor IX antigen of 0.02 unit/ml) that contrasts with the mild laboratory and clinical manifestations in the affected male that we have studied. Interestingly, however, the London 8 phenotype appears very similar to that manifest in our two affected females, suggesting that their disease represents the unaccompanied expression of mutant factor IX. The presence of somatic mosaicism for a mutant allele is suggested by a mild phenotype occurring as a previously unobserved single-gene mutation (18). There is only one previous reference to this phenomenon in an affected individual (19), a boy with mild ornithine transcarbamylase (OTC) deficiency. This patient had been found to have a large deletion of the OTC gene in his lymphocytes but on further testing was discovered to be a somatic mosaic for this mutation. In consideration of this phenomenon, we would emphasize that the sensitivity of tests required to demonstrate mosaicism for point mutations has only recently been achieved. Even with direct sequencing of PCR-amplified products, we were unsure of the presence of normal sequence in this patient until we had confirmed its existence with ASO and quantified it with differential termination experiments. The tissue-specific and consistent ratios of normal-to-mutant sequence obtained from five separate PCR reactions for each

42

Genetics: Taylor et al.

specimen validate the use of this latter technique in the analysis of mosaicism (Table 1). In view of the fastidious nature of ASO testing, we suggest that differential termination of primer extension is the method of choice for precise measurement of mosaic cell populations. There have been several recent reports of isolated germline mosaicism in chromosome X-linked (10, 20-23) and autosomal (24, 25) disorders. The presence of mosaicism in most of these cases has been inferential, following the study of several affected children born to normal parents using biochemical and restriction fragment length polymorphism linkage studies. Two studies of hemophilia A kindreds have shown direct evidence of mosaicism in a mother's germ-line and somatic cells (10, 26). Our data concerning the various degrees of mosaicism provide a detailed insight into the embryological derivation of the tissues examined. Both kidney and smooth muscle cells comprised populations of which 50%o possess the normal sequence. These findings support the notion of a common origin of these tissues from embryonic mesoderm. In contrast, the percentage of cells with normal sequence in liver and leukocyte populations was -10%. As liver tissue originates from embryonic endoderm, this difference might be expected. However, these results raise a question as to the derivation of hematopoietic cells. Our results indicate an endodermal origin for these cells, which is in conflict with the mesodermal derivation proposed in some embryological texts (27, 28). Finally, although evidence for germ-line mosaicism was not assessed in this instance, in view of the established mesodermal derivation of gonadal tissue, it was very likely present. This has important implications for genetic counseling of daughters of such patients. The cause of the moderately severe hemophilic phenotype in the two females in this kindred requires additional study. In the few prior reports of hemophilia B in women, the usual cause has been either a cytogenetic abnormality [Turner's syndrome (29) or X-chromosome deletions (30, 31)] or extreme bias in the X-chromosome inactivation process in a single female (32). In this family, it appears that in both women, the X chromosome bearing the normal factor IX gene has been exclusively inactivated (although minimal expression from this locus cannot be ruled out). The likelihood of this phenomenon occurring by chance in two successive generations is extraordinarily small. We believe that a second genetic change perhaps affecting the primary inactivation center on the mutant X chromosome has resulted in the unaccompanied expression of the mutant factor IX sequence in these women.

Proc. Natl. Acad. Sci. USA 88 (1991) 2. Davie, E. W. (1987) in Hemostasis and Thrombosis: Basic Principles and Clinical Practice, eds. Colman, R. W., Hirsch, J., Marder, V. J. & Salzman, E. W. (Lippincott, Philadelphia), pp. 242-267. 3. Montandon, A. J., Green, P. M., Giannelli, F. & Bentley, D. R. (1989) Nucleic Acids Res. 17, 3347-3358. 4. Green, P. M., Bentley, D. R., Mibashan, R. S., Nilsson, I.-M. & Giannelli, F. (1989) EMBO J. 8, 1067-1072. 5. Koeberl, D. D., Bottema, C. D. K., Buerstedde, J.-M. & Sommer, S. S. (1989) Am. J. Hum. Genet. 45, 448-457. 6. Kurachi, K. & Davie, E. W. (1982) Proc. Natl. Acad. Sci. USA 79, 6461-6464. 7. Choo, K. H., Gould, K. G., Rees, D. J. G. & Brownlee, G. G. (1982) Nature (London) 299, 178-180. 8. Yoshitake, S., Schach, B. G., Foster, D. C., Davie, E. W. & Kurachi, W. (1985) Biochem. J. 24, 3736-3750. 9. Thompson, A. R., Bajaj, S. P., Chen, S.-H. & MacGillivray,

R. T. A. (1990) Lancet 335, 418.

We thank Dr. Peter J. Bridge and David Picketts for helpful discussions and Hermina Wensing for assistance in preparation of the manuscript. S.A.M.T. and D.P.L. are supported by grants from the Ontario Ministry of Health and The Canadian Medical Research Council.

10. Levinson, B., Lehesjoki, A.-E., De la Chapelle, A. & Gitschier, J. (1990) Am. J. Hum. Genet. 46, 53-62. 11. Giddings, J. C. (1980) in A Practical Guide to Blood Coagulation and Haemostasis, ed. Thomson, J. M. (Churchill Livingstone, Edinburgh), pp. 117-157. 12. Yoshioka, A., Giddings, J. C., Thomas, J. E., Fujimura, Y. & Bloom, A. L. (1985) Br. J. Haematol. 59, 265-269. 13. Lillicrap, D. P., Liddell, M. B., Matthews, R. J., Peake, I. R. & Bloom, A. L. (1986) Br. J. Haematol. 62, 557-565. 14. Gyllenstein, U. B. & Erlich, H. A. (1988) Proc. Natl. Acad. Sci. USA 85, 7652-7656. 15. Paabo, S. (1989) Proc. NatI. Acad. Sci. USA 86, 1939-1943. 16. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, 5468-5470. 17. Gartler, S. M. & Francke, U. (1975) Am. J. Hum. Genet. 27, 218-223. 18. Hall, J. G. (1988) Am. J. Hum. Genet. 43, 355-363. 19. Maddalena, A., Sosnoski, D. M., Berry, G. T. & Nussbaum, R. L. (1989) N. Engl. J. Med. 319, 999-1003. 20. Darras, B. T. & Franke, U. (1987) Nature (London) 329, 556-558. 21. Wood, S. & MacGillivray, B. C. (1988) Hum. Genet. 78, 282-284. 22. Gitschier, J., Levinson, B., Lehesjoki, A.-E. & De la Chapelle, A. (1989) Lancet i, 273-274. 23. Higuchi, M., Kochhan, L. & Olek, K. (1988) Mol. Biol. Med. 5, 23-27. 24. Byers, P. H., Tsipouras, P., Bonadio, J. F., Starman, B. J. & Schwartz, R. C. (1988) Am. J. Hum. Genet. 42, 237-248. 25. Bradley, T. B., Wohl, R. C., Petz, L. D., Perkins, H. A. & Reynolds, R. D. (1980) Johns Hopkins Med. J. 146, 236-240. 26. Gitschier, J. (1988) Am. J. Hum. Genet. 43, 274-279. 27. Oppenheimer, S. P. & Lefevre, G., Jr. (1984) Introduction to Embryonic Development (Allyn & Bacon, Boston). 28. Langman, J. (1977) Medical Embryology: Human Development-Normal and Abnormal (Williams & Wilkins, Baltimore). 29. Bithell, T. C., Pizarro; A. & MacDiarmid, W. D. (1970) Blood 36, 169-172. 30. Spinelli, A., Schmid, W. & Straub, P. W. (1976) Br. J. Haematol. 34, 129-133. 31. Nisen, P., Stamberg, J., Ehrenpreis, R., Velascas, S., Shende, A., Engelberg, J., Karayalcin, G. & Waber, L. (1986) N. Engl.

1. Giannelli, F., Choo, K. H., Rees, D. J. G., Boyd, Y., Rizza, C. R. & Brownlee, G. G. (1983) Nature (London) 303,181-182.

32. Revesz, R., Schuler, D., Goldschmidt, B. & Elodi, S. (1972) J. Med. Genet. 9, 3%-399.

J. Med. 315,1139-1143.