Somatic PTPN11 mutations in childhood acute myeloid leukaemia

research paper

Somatic PTPN11 mutations in childhood acute myeloid leukaemia

Marco Tartaglia,1,2 Simone Martinelli,1 Ivano Iavarone,3 Giovanni Cazzaniga,4 Monica Spinelli,5 Emanuela Giarin,5 Valentina Petrangeli,1 Claudio Carta,1 Riccardo Masetti,6 Maurizio Arico`,7 Franco Locatelli,8 Giuseppe Basso,5 Mariella Sorcini,1 Andrea Pession6 and Andrea Biondi4 1

Dipartimento di Biologia cellulare e Neuroscienze, Istituto Superiore di Sanita`, Rome,

Italy, 2Department of Pediatrics, Mount Sinai School of Medicine, New York, NY, USA, 3

Dipartimento di Ambiente e connessa

prevenzione primaria, Istituto Superiore di Sanita`, Rome, 4Centro Ricerca M. Tettamanti, Clinica Pediatrica Universita` di Milano Bicocca, Monza, 5

Dipartimento di Pediatria, Universita` di Padova, Padua, 6Dipartimento di Pediatria, Universita` di Bologna, Bologna, 7U.O. Onco-Ematologia

Pediatrica, Ospedale dei Bambini ‘G. Di Cristina’, Palermo, and 8Oncoematologia Pediatrica, IRCCS Policlinico San Matteo, Pavia, Italy Received 13 January 2005; accepted for publication 16 February 2005

Summary Somatic mutations in PTPN11, the gene encoding the transducer SHP-2, have emerged as a novel class of lesions that upregulate RAS signalling and contribute to leukaemogenesis. In a recent study of 69 children and adolescents with de novo acute myeloid leukaemia (AML), we documented a non-random distribution of PTPN11 mutations among French–American– British (FAB) subtypes. Lesions were restricted to FAB-M5 cases, where they were relatively common (four of 12 cases). Here, we report on the results of a molecular screening performed on 181 additional unselected patients, enrolled in participating institutions of the Associazione Italiana Ematologia Oncologia Pediatrica–AML Study Group, to provide a more accurate picture of the prevalence, spectrum and distribution of PTPN11 mutations in childhood AML and to investigate their clinical relevance. We concluded that PTPN11 defects do not represent a frequent event in this heterogeneous group of malignancies (4Æ4%), although they recur in a considerable percentage of patients with FAB-M5 (18%). PTPN11 lesions rarely occur in other subtypes. Within the FAB-M5 group no clear association of PTPN11 mutations with any clinical variable was evident. Nearly two third of the patients with this subtype were found to harbour an activating mutation in PTPN11, NRAS, KRAS2 or FLT3. Keywords: PTPN11, SHP-2, childhood acute myeloid leukaemia, FAB-M5 subtype, somatic mutation.

Correspondence: Marco Tartaglia PhD, Dipartimento di Biologia Cellulare e Neuroscienze, Istituto Superiore di Sanita`, Viale Regina Elena, 299 - 00161, Rome, Italy. E-mail: [email protected]

Deregulated tyrosyl phosphorylation is a major event involved in the pathogenesis of acute myeloid leukaemia (AML) (Kelly & Gilliland, 2002). Indeed, a number of transduction pathways that regulate cellular proliferation, survival and differentiation, including those mediated by RAS and STAT proteins, are controlled via reversible tyrosyl phosphorylation of cell surface receptors and downstream transducers. Missense mutations in PTPN11, the gene encoding the non-receptor Src-homology 2 (SH2) domain containing protein tyrosine phosphatase SHP2, have recently emerged as a novel class of lesions that contribute to leukaemogenesis (Tartaglia et al, 2004a). SHP-2 is a transducer that relays signals from activated growth factor and cytokine receptors to RAS and other intracellular signalling molecules (Neel et al, 2003). It has a signal enhancing role in most pathways (Maroun et al, 2000; Shi et al, 2000; You

et al, 2001; Agazie & Hayman, 2003), and is required during development (Tang et al, 1995; Saxton et al, 1997, 2000; Qu et al, 1998; Chen et al, 2000) and haematopoiesis (Qu et al, 1997, 1998, 2001). Germ-line gain-of-function mutations in PTPN11 cause Noonan syndrome (Tartaglia et al, 2001), a disorder characterized by multiple developmental abnormalities including facial dismorphisms, short stature, cardiac defects, skeletal malformations and an increased risk for certain haematological malignancies. More recently, a distinct class of activating mutations in the same gene has been documented to occur as a somatic event in a heterogeneous group of myeloid and lymphoid malignancies and myelodysplastic (MDS) disorders (Tartaglia et al, 2003, 2004b; Loh et al, 2004a). Leukaemia-associated PTPN11 lesions are predicted to promote SHP-2 gain-of-function by destabilizing the

ª 2005 Blackwell Publishing Ltd, British Journal of Haematology, 129, 333–339

doi:10.1111/j.1365-2141.2005.05457.x

M. Tartaglia et al catalytically inactive conformation of the protein (Tartaglia et al, 2003), and provide the first evidence of a mutated protein tyrosine phosphatase acting as an oncoprotein in both lymphoid and myeloid malignancies. In a recent survey including a relatively small cohort of children and adolescents with de novo AML, we documented a low prevalence of PTPN11 mutations (approximately 5% of cases) (Tartaglia et al, 2004b). We also observed a non-random distribution of lesions among subtypes, as they were restricted to patients with acute monocytic leukaemia, i.e. French– American–British (FAB)-M5 subtype. Within this group, mutations were relatively common (four of 12 cases). Here, we report on the results of a molecular screening performed on 181 additional unselected children and adolescents enrolled in participating institutions of the Associazione Italiana Ematologia Oncologia Pediatrica (AIEOP)–AML Study Group to provide a more accurate picture of the prevalence, spectrum and distribution of PTPN11 lesions in childhood AML, as well as to investigate the clinical relevance of these genetic lesions.

Materials and methods

performed on exons 2, 3, 4, 7, 8, 12 and 13 of PTPN11, exons 1 and 2 of NRAS and KRAS2, and exons 14, 15 and 20 of FLT3. Primer sequences and polymerase chain reaction (PCR) conditions are available upon request. Unpurified PCR products were analysed by denaturing high-performance liquid chromatography (DHPLC), using the Wave 2100 or MD 4000 systems (Transgenomic, Omaha, NE, USA), at column temperatures recommended by the navigator version 1.5.4.23 software (Transgenomic). Heterozygous templates with previously identified mutations were used as positive controls during all DHPLC analyses. Amplimers having abnormal denaturing profiles were purified (Microcon PCR; Millipore, Bedford, MA, USA) and sequenced bi-directionally using the ABI BigDye terminator Sequencing Kit v.1.1 (Applied Biosystems, Foster City, CA, USA) and an ABI Prism 310 Genetic Analyser (Applied Biosystems). Sequencing results were analysed using the sequencing analysis v.3.6.1 and autoassembler v.2.1 software packages (Applied Biosystems). FLT3 length mutations were determined by cloning purified PCR products in a pCR 2.1 TOPO vector (Invitrogen, Carlsbad, CA, USA) and sequencing of purified (Plasmid Mini Kit; Qiagen, Hilden, Germany) clones.

Patients Frozen material from 181 unselected patients, aged between 1 and 16 years and enrolled in participating institutions of the AIEOP–AML Study Group, were included in the study. All samples were collected under Institutional Review Boardapproved protocols and with informed consent. Diagnosis was established by standard morphological, cytochemical and immunological criteria, and centrally reviewed. According to the FAB classification, patients were classified as M0 (n ¼ 2), M1 (n ¼ 45), M2 (n ¼ 25), M3 (n ¼ 38), M4 (n ¼ 26), M5 (n ¼ 27), M6 (n ¼ 1) and M7 (n ¼ 1). One patient exhibited AML secondary to a MDS condition (MDS-related AML). FAB subtype was not defined in 15 cases. Clinical data of the FABM5 cohort, including 12 patients previously characterized for PTPN11, NRAS and KRAS2 gene mutations (Tartaglia et al, 2004b), designated as the FAB-M5 study population, are reported in Table I. In this group, cytogenetical information was available for 26 patients (66Æ7%). According to Grimwade et al (1998), cytogenetical abnormalities were classified as favourable, including cases with t(8;21), t(15;17) and inv(16), whether alone or in conjunction with other abnormalities, adverse, including complex karyotypes, )5, )7 and del(5q), whether alone or in conjunction with intermediate cytogenetics and intermediate, including normal karyotype and abnormalities not classified as favourable or adverse.

Molecular analyses Bone marrow aspirates were obtained at diagnosis, prior to therapy, as well as during follow-up. Mononuclear cells were separated using a Ficoll gradient and genomic DNA was isolated using a standard protocol. Mutational screening was 334

Statistical analyses Descriptive analyses were conducted to examine the distribution of variables of interest. Pearson’s chi-squared test was used to evaluate statistical significance (at 95% level) of differences in proportions among groups; Fisher’s exact test (two-tailed P-values) was alternatively adopted when an expected cell value in a contingency table was T 205G > A

G60V E69K

181G > A

D61N

181G > C 213T > A 215C > T 226G > A 1520C > A

D61H F71L A72V E76K T507K

1504T > G

S502A

AML, acute myeloid leukaemia; FAB, French–American–British; MDS, myelodysplastic; DHPLC, denaturing high-performance liquid chromatography. *Including 69 AML cases reported in Tartaglia et al (2004b). FAB-M2Eo. This case carried a 38G > A change (Gly13Asp) in NRAS. §This case carried a 34G > A change (Gly12Ser) in KRAS2. In this and previous case DHPLC profiles and electropherograms indicated that concomitant mutations were present in a fraction of blasts.

FLT3, NRAS and KRAS2 mutations in paediatric patients with FAB-M5 The AML-M5 study population and the three PTPN11-positive cases with different FAB subtype were also analysed for exons 14, 15 and 20 of FLT3 and exons 1 and 2 of NRAS and KRAS2. Results are shown in Table III. Two FAB-M5 patients with mutated PTPN11 were found to carry a concomitant mutation in one of the RAS genes. In these cases, DHPLC profiles and electropherograms indicated that both PTPN11 and RAS lesions were present in a fraction of blasts, suggesting that these lesions were unlikely to represent primary events during leukaemogenesis. Leukaemic cells were not available to evaluate whether mutations coexisted in the same cell clone or were in independent cellular subpopulations. Within the AML-M5 study population FLT3, NRAS and KRAS2 defects were observed in 10 (25Æ6%; 95% CI, 13Æ0–42Æ1%), seven (17Æ9%; 95% CI, 7Æ5–33Æ5%) and four (10Æ3%; 95% CI, 2Æ9–24Æ2%) patients respectively. FLT3 gene lesions affecting the juxtamembrane region included three distinct internal tandem duplications (ITD), three complex lesions, each characterized by an ITD associated with an additional short nucleotide insertion and one six-base pair deletion. Three distinct missense changes involving Asp835 and a novel mutation affecting the aspartic residue at codon 839 were also identified 336

in the activation loop of the tyrosine kinase domain. In the case carrying the Asp839Gly change, mutation analysis of genomic DNA obtained during disease remission demonstrated absence of the mutated allele, providing evidence that this novel lesion was a somatic event acquired in the leukaemic cells. Mutations in the NRAS and KRAS2 genes affected the canonical mutational hotspots, i.e. codons 12, 13 and 61. FLT3 and RAS defects were found to coexist in two children, and two distinct FLT3 lesions were observed in one patient. In all cases, concomitant RAS and/or FLT3 lesions appeared to represent a fraction of the total blast population. Four of the five patients carrying concomitant PTPN11, RAS and/or FLT3 mutations were older than 13 years, and the remaining case was a 7-yearold child.

Clinical relevance of PTPN11 mutations The main biological and clinical features of the overall FABM5 study population and subgroups of patients with or without mutations in PTPN11, NRAS/KRAS2 or FLT3 are shown in Table I. The presence of PTPN11 mutations was not related to any specific-gene rearrangement or cytogenetical risk group. Similarly, no statistically significant association with white blood cell (WBC) count at diagnosis was evident, although patients with mutated PTPN11 had a lower median WBC count (19Æ4 · 109/l) as compared with patients without mutations (57Æ3 · 109/l). Analysis of distribution of PTPN11 mutations by gender and age at diagnosis did not reveal any significant association. On the contrary, a possible association with advanced age at diagnosis was observed for both RAS and FLT3 activating mutations. Results from unconditional logistic regression analysis confirmed this trend, indicating that mutations in FLT3 and/or RAS were significantly associated with a late onset of disease. Specifically, taking age at diagnosis 10 years (OR ¼ 15Æ1; 95% CI, 2Æ3–100Æ3). A possible association with a normal karyotype was observed for patients carrying activating FLT3 mutations (five of seven cases). In contrast to WBC counts in patients with PTPN11 lesions, an elevated median WBC count at diagnosis was observed in patients with FLT3 and RAS mutations.

Discussion Recently, we provided genetic evidence that somatic mutations in the PTPN11 gene contribute to leukaemogenesis and implicated a gain-of-function mechanism. We documented that these lesions were common in infants and children with JMML, a clonal myeloproliferative/MDS disorder of infancy, and occur in a smaller percentage of paediatric patients with other myeloid and lymphoid disorders, including AML. In the present study, we extended those initial observations, investigating the


PTPN11 Mutations in Childhood AML Table III. NRAS, KRAS2 and FLT3 gene mutations in 39 childhood AML cases with FAB-M5 subtype, enrolled with the Associazione Italiana Ematologia Oncologia Pediatrica Study Group*.

Gene

No. of cases

Nucleotide change

Amino acid change

NRAS

3 2 1§ 1 1– 1 1 1 1**

35G > A 38G > A 183A > C 183A > T 34G > A 35G > A 38G > A 183A > C ITD, 1744–1809 + Ins GTTCCC, 1810 ITD, 1747–1809 + Ins GGAGAGGAGCTTTCCGGGGTC, 1810 ITD, 1750–1806 + Ins CCAAAGGGGGAATCTACT, 1807 Del 1786–1791 ITD, 1783–1803 ITD, 1780–1800 ITD, 1792–1821 2503G > C 2503G > T 2505T > G 2516A > G

G12D G13D N61H N61H G12S G12D G13D N61H ITD, 582–603 + Ins VP, 604 ITD, 583–603 + Ins GEEKSGV, 604

KRAS2

FLT3

1

1

1 1 1 1 1** 1§ 1 1

ITD, 584–602 + Ins PKGEST, 603 Del 596–597 ITD, 595–601 ITD, 594–600 ITD, 598–607 D835H D835Y D835E D839G

AML, acute myeloid leukaemia; FAB, French–American–British; ITD, internal tandem duplication; Ins, insertion; Del, deletion. *Including 12 cases reported in Tartaglia et al (2004b). The NRAS 35G > A and FLT3 2505T > G lesions coexisted in one case, both representing a subpopulation(s) of blasts. Including one patient with a 181G > C mutation in PTPN11. §Lesions coexisted, both representing a subpopulation(s) of blasts. –Patient exhibiting a 213T > A change in PTPN11. **Lesions coexisted, the 2503G > C change representing a small percentage of blasts.

relevance of the contribution of PTPN11 mutations to AML pathogenesis in a cohort including 181 unselected paediatric patients enrolled in Italian institutions participating in the AIEOP–AML Study Group. Combined with the results from our previous survey, the present data provide a more accurate picture of the prevalence, distribution and spectrum of PTPN11 mutations in childhood de novo AML. We conclude that PTPN11 lesions are not a frequent event in this heterogeneous group of myeloid malignancies (4Æ0%; 95% CI, 1Æ9–7Æ3%), although they recur in children and adolescents with FAB-M5 (17Æ9%; 95% CI, 7Æ5–33Æ5%). Finally, within the FAB-M5 group no clear association of PTPN11 mutations with any clinical variable is evident. Consistent with the data recently produced on JMML (Tartaglia et al, 2003; Loh et al, 2004a), acute lymphoblastic leukaemia (Tartaglia et al, 2004b), childhood and adult MDS and chronic myelomonocytic leukaemia (Tartaglia et al, 2003; Loh et al, 2004a, 2005), childhood AML-associated PTPN11 mutations are missense changes, affect residues located at the N-SH2/PTP interacting surfaces, and are predicted to upreg-

ulate SHP-2 physiological activation by impairing the switching between the inactive and active conformations, favouring a shift in the equilibrium towards the latter. The first functional data indicate that SHP-2 gain-of-function confers proliferative and/or survival advantage to the haematopoietic cell progenitor by aberrant activation of signal transduction pathways, including those mediated by RAS proteins (Tartaglia et al, 2003; Loh et al, 2004a; Chan et al, 2005). Interestingly, the largely mutually exclusive occurrence of two distinct groups of PTPN11 mutations in haematological malignancies (acquired as a somatic event) and developmental disorders (with germline origin), strongly suggest that distinct gain-of-function thresholds for SHP-2 activity are required to perturb cellular processes, each depending on the transduction pathway(s) involved. Moreover, the preferential association of PTPN11 mutations with specific leukaemia subtypes, as defined by lineage, cell type and stage of differentiation, supports the idea that the cellular context is critical for SHP-2 contribution to clonal expansion. We hypothesize that the preferential association of SHP-2 gain-of-function with the FAB-M5 subtype is


337

M. Tartaglia et al caused by the deregulation of transduction pathways that selectively control proliferation and/or survival of the myeloid cell precursor. A similar situation is observed in JMML, which is characterized by excessive proliferation of immature and mature myelomonocytic cells (Emanuel et al, 1996; Arico` et al, 1997). Consistent with our hypothesis, the hallmark of JMML cells is the hypersensitive pattern of myeloid progenitor colony growth in response to granulocyte-macrophage colony-stimulating factor (GM-CSF) (Emanuel et al, 1991), because of the inability to downregulate RAS. In JMML the pathological activation of the RAS/MAPK cascade result from oncogenic PTPN11 or RAS mutations or loss-of-function of neurofibromin, a negative modulator of RAS encoded by the NF1 tumour suppressor gene. Remarkably, studies have provided strong evidence that RAS hyperactivity resulting from neurofibromin loss-of-function is restricted to GM-CSF signalling in haematopoietic cells in vivo (Birnbaum et al, 2000). Similarly, it has been recently demonstrated that SHP-2 gain-of-function induces macrophage progenitor hyperproliferation in response to GM-CSF but not to M-CSF (Chan et al, 2005). In the present survey, no attempt was made to extend the mutational screening to the entire coding sequence of PTPN11. Somatic PTPN11 mutations have been identified in more than 100 individuals with either haematological malignancies or myeloproliferative/MDS disorders (Tartaglia et al, 2003, 2004b; Loh et al, 2004a,b, 2005). To date, in contrast to what is observed in Noonan syndrome, all molecular lesions but one have been missense changes that affect exons 3 and 13. This evidence strongly supports that these exons do represent the major hotspot regions for leukaemia-associated PTPN11 lesions. In view of such consideration, we do not expect that the true prevalence of mutations in the present AML cohort could be significantly higher. Accordingly, no mutation affecting exons 2, 4, 7, 8 and 12, which encompass the remaining PTPN11 mutational hotspots in Noonan syndrome and related developmental disorders (Tartaglia & Gelb, 2005), was identified in the group of patients with FAB-M5. Nearly two-thirds of the patients with FAB-M5 harboured an activating mutation in PTPN11, NRAS, KRAS2 or FLT3. This finding further points out the relevant contribution of deregulated RAS signalling to pathogenesis of childhood AML. Interestingly, in five of these patients, PTPN11, RAS and/or FLT3 lesions were found to coexist. In all cases, these concomitant genetic lesions appeared to represent only a fraction of the total blast population, strongly suggesting that these lesions did not represent primary events during leukaemogenesis, but might have an important role in disease progression, contributing to clonal selection. In conclusion, the present data indicate that PTPN11 defects are frequently observed among children with FAB-M5, but rarely occur in paediatric patients with other subtypes. Our findings are consistent with those recently documented by Loh et al (2004b). An important question is whether or not PTPN11 lesions significantly affect prognosis. No clear association with any clinical variable was observed in the present 338

FAB-M5 cohort; however, a definitive answer to this question would require a larger scale analysis.

Acknowledgements We are indebted to patients and their families who participated in the study and the clinicians of the AIEOP centres for providing bone marrow samples. The study was supported in part by grants from Ricerca finalizzata 1% FSN-2003 (Stabilita` del genoma: bersagli molecolari nella prevenzione e nel controllo delle neoplasie) and Telethon-Italy (GGP04172) (MT), from AIRC, FIRB, COFIN2003 0689942, Fondazione Cariplo and Fondazione Tettamanti (AB and GC), from MiurCNR and Fondazione Citta` Della Speranza (GB).

References Agazie, Y.M. & Hayman, M.J. (2003) Molecular mechanism for a role of SHP-2 in epidermal growth factor receptor signaling. Molecular and Cellular Biology, 23, 7875–7886. Arico`, M., Biondi, A. & Pui, C.-H. (1997) Juvenile myelomonocytic leukemia. Blood, 90, 479–488. Birnbaum, R.A., O’Marcaigh, A., Wardak, Z., Zhang, Y.Y., Dranoff, G., Jacks, T., Clapp, D.W. & Shannon, K.M. (2000) Nf1 and Gmcsf interact in myeloid leukemogenesis. Molecular Cell, 5, 189–195. Chan, R.J., Leedy, M.B., Munugalavadla, V., Voorhorst, C.S., Li, Y., Yu, M. & Kapur, R. (2005) Human somatic PTPN11 mutations induce haematopoietic cell hypersensitivity to granulocyte-macrophage colony stimulating factor. Blood, First Edition Paper, DOI 10.1182/ blood-2004-10-4002. Chen, B., Bronson, R.T., Klaman, L.D., Hampton, T.G., Wang, J.F., Green, P.J., Magnuson, T., Douglas, P.S., Morgan, J.P. & Neel, B.G. (2000) Mice mutants for Egfr and Shp2 have defective cardiac semilunar valvulogenesis. Nature Genetics, 24, 296–299. Emanuel, P.D., Bates, L.J., Castleberry, R.P., Gualtieri, R.J. & Zuckerman, K.S. (1991) Selective hypersensitivity to granulocyte-macrophage colony-stimulating factor by juvenile chronic myeloid leukemia haematopoietic progenitors. Blood, 77, 925–929. Emanuel, P.D., Shannon, K.M. & Castleberry, R.P. (1996) Juvenile myelomonocitic leukemia: molecular understanding and prospects for therapy. Molecular Medicine Today, 2, 468–475. Grimwade, D., Walker, H., Oliver, F., Wheatley, K., Harrison, C., Harrison, G., Rees, J., Hann, I., Stevens, R., Burnett, A. & Goldstone, A. (1998) The importance of diagnostic cytogenetics on outcome in AML: analysis of 1612 patients entered into the MRC AML 10 trial. The Medical Research Council Adult and Children’s Leukemia Working Parties. Blood, 92, 2322–2333. Hof, P., Pluskey, S., Dhe-Paganon, S., Eck, M.J. & Shoelson, S.E. (1998) Crystal structure of the tyrosine phosphatase SHP-2. Cell, 92, 441– 450. Kelly, L.M. & Gilliland, D.G. (2002) Genetics of myeloid leukemias. Annual Reviews in Genomics and Human Genetics, 3, 179–198. Loh, M.L., Vattikuti, S., Schubbert, S., Reynolds, M.G., Carlson, E., Lieuw, K.H., Cheng, J.W., Lee, C.M., Stokoe, D., Bonifas, J.M., Curtiss, N.P., Gotlib, J., Meshinchi, S., Le Beau, M.M., Emanuel, P.D. & Shannon, K.M. (2004a) Mutations in PTPN11 implicate the SHP-2 phosphatase in leukemogenesis. Blood, 103, 2325–2331.


PTPN11 Mutations in Childhood AML Loh, M.L., Reynolds, M.G., Vattikuti, S., Gerbing, R.B., Alonzo, T.A., Carlson, E., Cheng, J.W., Lee, C.M., Lange, B.J. & Meshinchi, S. (2004b) PTPN11 mutations in pediatric patients with acute myeloid leukemia: results from the Children’s Cancer Group. Leukemia, 18, 1831–1834. Loh, M.L., Martinelli, S., Cordeddu, V., Reynolds, M.G., Vattikuti, S., Lee, C.M., Wulfert, M., Germing, U., Haas, P., Niemeyer, C., Beran, M.E., Strom, S., Lu¨bbert, M., Sorcini, M., Estey, E.H., Gattermann, N. & Tartaglia, M. (2005) Acquired PTPN11 mutations occur rarely in adult patients with myelodysplastic syndromes and chronic myelomonocytic leukemia. Leukemia Research, 29, 459–462. Maroun, C.R., Naujokas, M.A., Holgado-Madruga, M., Wong, A. & Park, M. (2000) The tyrosine phosphatase SHP-2 is required for sustained activation of extracellular signal-regulated kinase and epithelial morphogenesis downstream from the Met receptor tyrosine kinase. Molecular and Cellular Biology, 20, 8513–8525. Neel, B.G., Gu, H. & Pao, L. (2003) The ‘Shp’ing news: SH2 domaincontaining tyrosine phosphatases in cell signaling. Trends in Biochemical Sciences, 28, 284–293. Qu, C.K., Shi, Z.Q., Shen, R., Tsai, F.Y., Orkin, S.H. & Feng, G.S. (1997) A deletion mutation in the SH2-N domain of Shp-2 severely suppresses hematopoietic cell development. Molecular and Cell Biology, 17, 5499–5507. Qu, C.K., Yu, W.M., Azzarelli, B., Cooper, S., Broxmeyer, H.E. & Feng, G.S. (1998) Biased suppression of hematopoiesis and multiple developmental defects in chimeric mice containing Shp-2 mutant cells. Molecular and Cell Biology, 18, 6075–6082. Qu, C.K., Nguyen, S., Chen, J. & Feng, G.S. (2001) Requirement of Shp-2 tyrosine phosphatase in lymphoid and hematopoietic cell development. Blood, 97, 911–914. Saxton, T.M., Henkemeyer, M., Gasca, S., Shen, R., Rossi, D.J., Shalaby, F., Feng, G.S. & Pawson, T. (1997) Abnormal mesoderm pattering in mouse embryos mutant for the SH2 tyrosine phosphatase Shp-2. EMBO Journal, 16, 2352–2364. Saxton, T.M., Ciruna, B.G., Holmyard, D., Kulkarni, S., Harpal, K., Rossant, J. & Pawson, T. (2000) The SH2 tyrosine phosphatase Shp2

is required for mammalian limb development. Nature Genetics, 24, 420–423. Shi, Z.-Q., Yu, D.-H., Park, M., Marshall, M. & Feng, G.-S. (2000) Molecular mechanism for the Shp-2 tyrosine phosphatase function in promoting growth factor stimulation of Erk activity. Molecular and Cellular Biology, 20, 1526–1536. Tang, T.L., Freeman, Jr, R.M., O’Reilly, A.M., Neel, B.G. & Sokol, S.Y. (1995) The SH2-containing protein-tyrosine phosphatase SH-PTP2 is required upstream of MAP kinase for early Xenopus development. Cell, 80, 473–483. Tartaglia, M. & Gelb, B.D. (2005) Noonan syndrome and related disorders: genetics and pathogenesis. Annual Reviews in Genomics and Human Genetics, 6 (in press). Tartaglia, M., Mehler, E.L., Goldberg, R., Zampino, G., Brunner, H.G., Kremer, H., van der Burgt, I., Crosby, A.H., Ion, A., Jeffery, S., Kalidas, K., Patton, M.A., Kucherlapati, R.S. & Gelb, B.D. (2001) Mutations in PTPN11, encoding the protein tyrosine phosphatase SHP-2, cause Noonan syndrome. Nature Genetics, 29, 465–468. Tartaglia, M., Niemeyer, C.M., Fragale, A., Song, X., Buechner, J., Jung, A., Hahlen, K., Hasle, H., Licht, J.D. & Gelb, B.D. (2003) Somatic PTPN11 mutations in juvenile myelomonocytic leukemia, myelodysplastic syndromes and acute myeloid leukemia. Nature Genetics, 34, 148–150. Tartaglia, M., Niemeyer, C.M., Shannon, K.M. & Loh, M.L. (2004a) SHP-2 and myeloid malignancies. Current Opinions in Hematology, 11, 44–50. Tartaglia, M., Martinelli, S., Cazzaniga, G., Cordeddu, V., Iavarone, I., Spinelli, M., Palmi, C., Carta, C., Pession, A., Arico`, M., Masera, G., Basso, G., Sorcini, M., Gelb, B.D. & Biondi, A. (2004b) Genetic evidence for lineage-related and differentiation stage-related contribution of somatic PTPN11 mutations to leukemogenesis in childhood acute leukemia. Blood, 104, 307–313. You, M., Flock, L.M., Yu, D. & Feng, G.-S. (2001) Modulation of the nuclear factor jB pathway by Shp-2 tyrosine phosphatase in mediating the induction of interleukin (IL)-6 by IL-1 or tumor necrosis factor. Journal of Experimental Medicine, 193, 101–109.


339