Sox genes regulate type 2 collagen expression ... - Wiley Online Library

Develop. Growth Differ. (2006) 48, 477–486

doi: 10.1111/j.1440-169x.2006.00886.x

Sox genes regulate type 2 collagen expression in avian neural crest cells Blackwell Publishing Asia

Takashi Suzuki,1 Daisuke Sakai,1 Noriko Osumi,1 Hiroshi Wada3 and Yoshio Wakamatsu2,* 1 Center for Translational and Advanced Animal Research on Human Diseases, Division of Developmental Neuroscience, Graduate School of Medicine, Tohoku University, Sendai, Miyagi 980-8575, Japan, 2Department of Developmental Neurobiology, Graduate School of Medicine, Tohoku University, Sendai, Miyagi 980-8575, Japan and 3 Laboratory of Development, Evolution and Phylogenetics, Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba 305-8572, Japan.

Neural crest cells give rise to a wide variety of cell types, including cartilage cells in the cranium and neurons and glial cells in the peripheral nervous system. To examine the relationship of cartilage differentiation and neural crest differentiation, we examined the expression of Col2a1, which encodes type 2 collagen often used as a cartilage marker, and compared it with the expression of Sox transcription factor genes, which are involved in neural crest development and chondrogenesis. We found that Col2a1 is expressed in many neural crest-derived cell types along with combinations of Sox9, Sox10 and LSox5. Overexpression studies reveal the activation of Col2a1 expression by Sox9 and Sox10, and cross-regulation of these Sox genes. Luciferase assay indicates a direct activation of the Col2a1 enhancer/promoter both by Sox9 and Sox10, and this activation is further enhanced by cAMP-dependent kinase (PKA) signaling. Our study suggests that the regulatory mechanisms are similar in cartilage and neural crest differentiation. Key words: collagen, LSox5, neural crest, PKA, Sox9, Sox10.

Introduction Neural crest cells are specified at the boundary of the neural plate and non-neural ectoderm in vertebrate embryos, and subsequently give rise to various tissues including neurons, glial cells, melanocytes and cranial mesenchymal tissues (Le Douarin & Kalcheim 1999). Bone morphogenetic protein (BMP) signaling has been known to be important for neural crest induction (Liem et al. 1995, 1997; Liu & Jessell 1998; Marchant et al. 1998; Endo et al. 2002; GarcíaCastro et al. 2002; Wakamatsu et al. 2004a; Sakai et al. 2005, 2006) and subsequent to the induction, transcription factors, such as Snail2 (formally known as Slug), Sox9, LSox5 and Sox10, are expressed. These genes are required for epithelial-mesenchymal transition (EMT) of the neural crest in avian embryos (Nieto et al. 1994; Cheung & Briscoe 2003; Perez-Alcala et al. 2004; McKeown et al. 2005; Sakai et al. 2006). *Author to whom all correspondence should be addressed. Email: [email protected] Received 20 April 2006; revised 10 July 2006; accepted 19 July 2006. © 2006 The Authors Journal compilation © 2006 Japanese Society of Developmental Biologists

BMP signaling promotes chondrogenesis (Brunet et al. 1998; Ito et al. 1999; Pizette & Niswander 2000; Shukunami et al. 2000; Tsumaki et al. 2002; Yoon & Lyons 2004). Under the influence of BMP and other signals, expression of Sox9, LSox5 and Sox10 is induced in the cartilage-forming tissues (Chimal-Monroy et al. 2003), and Sox9 and LSox5 have been shown to directly activate the Col2a1 gene, which encodes the type 2 collagen protein enriched in cartilage tissue (Lefebvre et al. 1997, 1998). While type 2 collagen expression has been used as a cartilage marker for mesoderm-derived and cranial neural crest-derived tissues, expression of Col2a1 and Sox genes has not been systematically examined in the neural crest and crest-derived tissues. In this paper, we first compared the expression of Sox9, Sox10 and LSox5 with that of Col2a1 in the neural crest and crest-derived tissues. We found that a variety of crest-derived cells co-express Col2a1 and at least one of these Sox genes. As previous reports focused on the regulation of Col2a1 by Sox9 and LSox5 in mesoderm-derived cartilage cells, we tested if these Sox genes could activate Col2a1 expression in neural tissue. Overexpression of Sox9 and Sox10 by electroporation promoted Col2a1 expression in the neural tube, while LSox5 failed to

478

T. Suzuki et al.

do so. As previously reported, Sox10 overexpression simultaneously downregulated Sox9 expression (see also McKeown et al. 2005), indicating Sox10 activates Col2a1 expression without Sox9 activity. Our luciferase assay revealed that Sox10 activated the Col2a1 enhancer/promoter, like Sox9, and the activation was enhanced by the cAMP-dependent kinase (PKA) signal.

Materials and methods Experimental animals Japanese quail (Coturnix japonica) eggs were obtained from Sendai Jun – ran (Sendai, Japan). Embryos were staged according to Hamburger and Hamilton (Hamburger & Hamilton 1951).

The expression vectors of quail Sox9 and chick Sox10 in pyDF30 were previously described (Sakai et al. 2006). pEGFP-N1 was purchased from BD Clontech (Mountain View, CA, USA). Electroporation into the neural tube Electroporation into the neural tube of the quail embryo was performed basically as described (Funahashi et al. 1999). In brief, DNA of pEGFP-N1 and another expression vector were mixed at 1 : 1 (5 µg/µL in phosphatebuffered saline (PBS) containing a trace amount of fast green) and injected into the lumen of posterior neural tube (segmental plate level) of stage 12 embryos. The condition of electroporation was 25 V, 50 ms duration, 250 ms interval for five times. Twenty-four hours after electroporation, transfected embryos were fixed for in situ hybridization and immunostainings.

In situ hybridization In situ hybridization on section and in whole-mount preparation were performed as described previously (Wakamatsu & Weston 1997). The coding sequences of quail LSox5 were polymerase chain reaction (PCR)amplified from oligo (dT)-primed E7 embryo cDNA (forward primer: ATGCTCACTGACCCTGATTTAC, reverse primer: TGATCCCATGGCAAGAAGCTTG). Quail Snail2, Foxd3, Sox9 and Sox10 cDNA for cRNA probe were described previously (Cheng et al. 2000; Kos et al. 2001; Wakamatsu et al. 2004b; Sakai et al. 2006). Quail Col2a1 was PCR-amplified from oligo (dT)-primed E7 embryo cDNA (forward primer: TCCAAGAAGAACCCTGCCAG, reverse primer: ATATCCACGCCAAACTCCTG). Antibodies and immunological staining HNK1 (mouse IgM, Tucker et al. 1988) was used as described previously (Wakamatsu et al. 2004a). AntiHA (rabbit IgG, Roche, Basel, Switzerland) and 2B1.5 anti-Collagen II (mouse IgG2a; NeoMarkers, Fremont, CA, USA) antibodies were commercially obtained. Immunological staining on sections was performed as described previously (Wakamatsu et al. 1993, 1997). Fluorochrome-conjugated secondary antibodies were purchased from Jackson ImmunoResearch Laboratories (West Grove, PA, USA). Sections treated with antibodies were also exposed to DAPI (Sigma Chemicals, St Louis, MO, USA) to visualize nuclei. Expression vectors The coding sequence of quail LSox5 was inserted into pyDF-HA for N-terminal HA-tagging and expression.

Luciferase assay Construction of a Luciferase reporter, carrying Col2a1 enhancer/promoter in pGL3-basic (AmershamPharmacia, Uppsala, Sweden), was constructed by inserting the Col2a1 promoter sequence (Lefebvre et al. 1996) and intron enhancer sequence (Zhou et al. 1995). NIH3T3 cells were transfected with the Luciferase reporter and effecter plasmid DNA with LipofectAMINE Plus reagent (Invitrogen, Carilsbad, CA, USA). pRL-TK was always co-transfected to normalize for transfection efficiency (Dual-Luciferase Assay System; Promega, Madison, WI, USA). Cell lysates were prepared for luciferase activity after 36 h of culture with the PicaGene Dual kit (Toyo Ink, Tokyo, Japan). To activate the PKA signal, 1 mM of cAMP analog 8bromo-cAMP (Calbiochem, San Diego, CA, USA) was added in culture.

Results Expression of Col2a1 and Sox genes in neural crest/ crest-derived tissues Expression of Col2a1 mRNA was examined by in situ hybridization and compared with that of Sox9, Sox10 and LSox5, as well as with the neural crest marker HNK1. Faint expression of Col2a1 was first detected in the premigratory neural crest cells in the head neural folds of Hamburger and Hamilton (HH) stage 8 embryos, slightly after the onset of Sox9 (HH stage 6.5–7, see Sakai et al. 2006) and before that of Sox10 (HH stage 9, see Sakai et al. 2006). At stage 9–11, Col2a1 appeared to be expressed in migrating neural crest cells at the cranial level (Fig. 1A,E). Identity

© 2006 The Authors Journal compilation © 2006 Japanese Society of Developmental Biologists

Sox and Col2a1 expression in neural crest

479

Fig. 1. Expression of Col2a1 and Sox genes in cranial neural crest cells. (A–D) Whole-mount in situ of stage 9 embryos (dorsal views). Migrating neural crest cells (arrowheads) express Col2a1 (A), Sox9 (B), LSox5 (C) and Sox10 (D). Sox9 mRNA is also detected in crest cells at more caudal levels (B, arrows) and in the notochord (B, asterisk). (E–H) Whole-mount in situ of stage 11 embryos (dorsal views). Migrating neural crest cells (arrowheads) express Col2a1 (E) and Sox10 (H). Sox9 expression is only observed in dorsally remaining crest cells (F, arrow), and LSox5 mRNA is not detectable in neural crest cells at this stage (G). (I, J) A transverse section of stage 12 embryo at midbrain level, hybridized with Col2a1 probe (I), and counterstained with HNK1 antibody (J). Dorso-laterally migrating HNK1-positive crest cells co-express Col2a1 mRNA (arrowheads). Col2a1 expression is also observed in the notochord (I, arrow). (K, L) Side views of stage 13 embryos hybridized with Col2a1 (K) and Sox10 (L). Expression of Col2a1 and Sox10 is observed in crest-derived cells entering the branchial arches (arrowheads) and forming cranial ganglia (arrows), as well as otic placode (asterisks).


480

T. Suzuki et al.

Fig. 2. Expression of Col2a1 and Sox genes in cranial neural crest derivatives. (A) A transverse section of stage 25 embryo, showing the expression of Col2a1 mRNA. Col2a1 expression is detected in the trigeminal ganglia (tg), maxillary process (mx), as well as mesenchyme cells surrounding eye (arrowheads). (B–B′′′) Trigeminal ganglia corresponding to the boxed area in (A), showing the expression of Col2a1, Sox9, LSox5 and Sox10, respectively. (C–C′′′) Maxillary process corresponding to the boxed area in (A), showing the expression of Col2a1, Sox9, LSox5 and Sox10, respectively. While expression of Col2a1, Sox9 and LSox5 are predominantly observed in the condensing mesenchyme, Sox10 expression is restricted to the Schwann cell precursors (arrows).

of Col2a1-positive cells as migrating neural crest cells was further confirmed by co-expression of the HNK1 antigen (Fig. 1I,J). In contrast, expression of Sox genes progressively changed over time. While Sox9, Sox10 and LSox5 were all expressed in the migrating neural crest cells at stage 9 (Fig. 1B–D), at stage 11, expression of both Sox9 and LSox5 was severely downregulated in migrating cranial crest cells (Fig. 1F,G). In contrast, Sox10 expression persisted (Fig. 1H) and co-expression with Col2a1 was observed in the crest cells entering the facial primodium (Fig. 1K,L). Sox10 expression in the facial primodium diminished at later stages and persistent expression was only observed in cranial ganglia and Schwann cell precursors along the peripheral nerve (Fig. 2B′′′, C′′′). In contrast, Sox9 expression reappeared in the crest-derived mesenchyme cells of maxillary and mandibular arches (Fig. 2C′ and data not shown). Co-expression of Col2a1 and LSox5 was observed in the cranial ganglia, Schwann cell precursors along the nerve and in the mesenchyme cells of maxillary and mandibular arches at stage 24 (Fig. 2A, B, B″, C, C″, and data not shown). Co-expression of Col2a1, Sox9 and LSox5 was also observed in crestderived mesenchymes surrounding eye, notochord cells and surrounding mesoderm-derived mesenchymes (Fig. 2A and data not shown). At the trunk level, both Col2a1 and Sox10 are detected in migrating crest cells (Fig. 3A,B). Thus, Col2a1-positive and Sox10-positive crest cells were found in the migration staging area (Weston 1991), between the dorsal neural tube and dorso-medial edge of somites. It has been reported that Sox10 is expressed in the crest-derived cells forming the peripheral nervous system (PNS) (Cheng et al. 2000; Britsch et al. 2001; Sonnenberg-Riethmacher et al.

2001). Both Sox10 and Col2a1 expression were also observed in medially migrating HNK1-positive neural crest-derived cells at the hindlimb level of stage 18 embryos (Fig. 3C–E), as well as neuron-glia precursors in the periphery of the nascent dorsal root ganglia (DRG) of stage 21–24 embryos (Fig. 3F,I–K). LSox5 expression was also observed in the peripheral DRG cells (Fig. 3H). In contrast, expression of Sox9 was not observed in the crest-derived neural tissues at these stages (see Fig. 3G as an example). Consistent with the roles of Sox genes and Col2a1 in cartilage differentiation, Sox9 expression was broadly observed in the sclerotomal mesenchyme, as well as in the notochord (Fig. 3G). Expression of Col2a1 and LSox5 was also detected in the notochord and surrounding sclerotome (Fig. 3F,H), while Sox10 expression was not detected in these tissues (Fig. 3K). Taken together, Col2a1 expression was not restricted to the cartilage tissues and the Sox genes we examined (or at least one of them) were always co-expressed in the crest-derived Col2a1-positive cells. Sox genes activate Col2a1 expression As described above, Col2a1 expression in the neural crest lineages correlated with the expression of Sox genes. In order to examine the regulation of Col2a1 expression by Sox genes in the neural tissue, we transfected nascent neural tubes at stage 12, which were able to respond to neural crest-inducing factors (Cheung & Briscoe 2003; Honore et al. 2003; Perez-Alcala et al. 2004; Cheung et al. 2005; Sakai et al. 2006) by electroporation and overexpressed Sox9, Sox10 and LSox5 (Fig. 4). As previously described (Cheung & Briscoe 2003; Cheung et al. 2005), Sox9 overexpression in the



481

Fig. 3. Expression of Col2a1 and Sox genes in trunk neural crest cells and their derivatives. (A, B) Whole-mount in situ of stage 13 embryos (dorsal views). Neural crest cells residing in the migration staging area (arrowheads) express Col2a1 (A) and Sox10 (B). Asterisk in (A) indicates expression of Col2a1 in the notochord. (C–E) Neighboring transverse sections of stage 18 embryo at hindlimb level, hybridized with Col2a1 (C) and Sox10 (E) probes. The Col2a1-stained section is counterstained with HNK1 antibody (D). Ventro-medially migrating crest cells (arrowheads) express Col2a1, HNK1 antigen and Sox10. (F–H) Transverse sections of stage 21 embryo hybridized with Col2a1 (F), Sox9 (G) and LSox5 (H) at the mid-trunk level. Strong expression of Col2a1 is observed in the notochord (F, arrow) and surrounding sclerotome cells. Col2a1 expression is also observed in the peripheral cells of developing dorsal root ganglia (DRG) (F, arrowheads) and in the neural tube cells. Sox9 is expressed in the notochord (G, arrow), sclerotomederived mesenchyme cells (G, arrowheads), and the neural tube cells. LSox5 expression is in the peripheral DRG cells (H, arrowheads), neural tube cells and notochord (H, arrow). (I–K) Neighboring transverse sections of stage 24 embryo at mid-trunk level, hybridized with Col2a1 (I) and Sox10 (K) probes. The Col2a1-stained section is counterstained with HNK1 antibody (J). Peripheral cells in the HNK1-positive DRG express Col2a1 and Sox10 (arrowheads).

neural tube induced Sox10 expression (Fig. 4G), as well as ectopic HNK1 immunoreactivity (Fig. 4P). Expression of Col2a1 and LSox5 was also induced (Fig. 4A,J). Interestingly, in most cases the induction of Col2a1 expression was restricted to the dorsal 2/3 of the transfected neural tubes, suggesting that there is a dorsal-ventral difference in the ability to respond to Sox9 overexpression (see Discussion). In contrast, ectopic expression of Sox10 and HNK1 immunoreactivity were induced both in dorsal and ventral domains of the transfected neural tubes (Fig. 4G,P). Sox10 expression induced HNK1 immunoreactivity throughout the Sox10-transfected neural tubes (Fig. 4Q), as described (McKeown et al. 2005). Sox10 overexpression also induced Col2a1 in the dorsal neural

tube (Fig. 4B), thus the effect of Sox10 overexpression on Col2a1 was comparable to that of Sox9. Interestingly, Sox10 overexpression reduced the relatively low levels of endogenous Sox9 expression in the ventral neural tube further (Fig. 4E), as previously reported (McKeown et al. 2005). Although LSox5 has been shown to upregulate the expression of Col2a1 in cartilage cells, overexpression of LSox5 failed to induce Col2a1 or Sox9/10, while weak expression of HNK1 was induced in the neural tube along the dorso-ventral axis (Fig. 4R). Such weak activity of LSox5, along with the weak activation of Col2a1 reporter gene (see below), questioned the performance of the construct. However, a strong nuclear localization of HA-tagged LSox5 protein was


482

T. Suzuki et al.

Fig. 4. Misexpression of Sox genes in the neural tube. Stage 12 caudal neural tube was electroporated with expression vectors of Sox9 (left column), Sox10 (middle column) and LSox5 (right column). An expression vector of GFP was always co-transfected to indicate transfected areas (M– O). Sox9 misexpression promotes expression of Col2a1 (A, arrowheads), Sox10 (G, arrowheads), and LSox5 (J, arrowheads), as well as HNK1 antigen (P, arrowheads). Sox10 misexpression also promotes expression of Col2a1 (B, arrowheads) and HNK1 antigen (Q, arrowheads), but downregulates Sox9 in the ventral neural tube (E, arrowheads). LSox5 overexpression shows little effect on the expression of genes examined in this study, although clear nuclear localization of transgene-derived HA-tagged LSox5 protein is observed with anti-HA antibody staining (O, inset).

confirmed in the neural tube (Fig. 4O, inset). In addition, LSox5 misexpression in the neural tube at the hindbrain level promoted the increase of Foxd3positive migrating crest cells (data not shown) as reported previously (Perez-Alcala et al. 2004), further indicating that the transgene-derived LSox5 was functional in many aspects. Activation of Col2a1 by group E Sox genes enhanced by PKA signal The overexpression studies above suggested that in the neural tube/neural crest cells, Sox9 and Sox10 are

important for the expression of Col2a1. As Sox9 directly activates Col2a1 transcription through the Col2a1 enhancer (Lefebvre et al. 1997, 1998), we tested if Sox10 could activate the Col2a1 enhancer. A Luciferase reporter construct carrying the Col2a1 enhancer/promoter was co-transfected with Sox genes into NIH3T3 cells (Fig. 5). Although the magnitude of activation varied, all Sox genes examined could activate the reporter. Interestingly, when Sox9 and Sox10 were co-transfected, the activation was at the intermediate level of the results obtained by the transfection of Sox9 or Sox10 alone. Similar results were observed when LSox5 was co-transfected with Sox9 and/or Sox10.



Fig. 5. Sox9 and Sox10 activate Col2a1 enhancer/promoter under the influence of the cAMP-dependent kinase (PKA) signal. NIH3T3 cells were co-transfected with expression vectors of Sox9, Sox10, LSox5, as well as combinations of these Sox genes, along with Col2a1 enhancer/promoter-luciferase reporter gene, and cultured for 36 h with or without 8-bromocAMP. Results are shown as fold induction compared with the value obtained by a transfection of Col2a1 enhancer/promoterluciferase and empty vector. Error bars indicate standard deviations obtained from the data of three independent experiments. Both Sox9 and Sox10 activate the reporter, and the activation is further enhanced by cAMP stimulation. LSox5 expression shows only limited activation of the reporter, and LSox5 co-expression decreases the activation of the reporter by Sox9 and/or Sox10.

As previously reported, PKA signaling enhances Sox9-mediated transcriptional activation of Col2a1 enhancer/promoter (Huang et al. 2000). Thus, we tested if Sox10 also responded to the PKA signal. Accordingly, an addition of cAMP analogue in the culture media further enhanced the reporter activation by the expression of Sox9 and Sox10.

Discussion In this study, we showed that Col2a1 is expressed in early neural crest cells and crest-derived tissues. As summarized in Figure 6, we also revealed that Col2a1 expression in the crest lineages is correlated with the expression of Sox genes, and both Sox9 and Sox10 can activate Col2a1 promoter/enhancer. Activation of Col2a1 transcription by group E Sox genes in crest-derived cells, in particular by Sox10, is one of the novel findings of this study.

483

Fig. 6. Summary of the regulatory network of Sox genes and Col2a1. In early neural crest cells, Sox9 is first expressed and Sox9 induces expression of LSox5 and Sox10. Sox10 in turn downregulates Sox9 in migrating crest cells, as well as in the peripheral nervous system (PNS) cells. In cartilage-forming mesenchyme cells, Sox10 expression is not maintained and Sox9 is recovered. Thus, different combinations of Sox genes activate the expression of Col2a1.

Why do distinct sets of Sox genes, in particular Sox9 and Sox10, have to activate Col2a1 in different stages of development of the neural crest lineage? One possibility is that, while both Sox9 and Sox10 can activate Col2a1 transcription, Sox9 and Sox10 also regulate the expression of unique sets of genes. One such example known in neural crest lineage is Snail2, which encodes a Zn-finger transcription factor and is required for EMT of avian neural crest cells (Nieto et al. 1994; Sakai et al. 2006). As we have previously reported, Sox9 directly activated the Snail2 promoter, but Sox10 failed to do so (Sakai et al. 2006). Thus, the requirement of other target genes in distinct developmental stages of crest-derived cells may direct the switch in Sox expression if Col2a1 expression needs to be maintained. Such a switch in Sox expression seems to be accomplished, at least in part, by cross-regulation mechanisms, such as the activation of Sox10 by Sox9, and the repression of Sox9 by Sox10. How Sox10 regulates Col2a1 transcription is unknown. In the case of cartilage cells, Sox9, LSox5 and Sox6 forms a protein complex on the Col2a1 enhancer to activate the transcription (Lefebvre et al. 1998). In particular, LSox5 and Sox6 form a dimer through their coiled-coil domains and this dimerization increases the affinity to the HMG binding sequence of the enhancer. In our Luciferase assay, LSox5 expression showed very little activation of the Col2a1 reporter, possibly due to the lack of co-factors such as Sox6. Thus, co-expression of LSox5 with Sox9 may lead to


484

T. Suzuki et al.

the formation of an incomplete complex with lower transcriptional activity. It remains to be studied if Sox10 acts like Sox9, forming a complex with LSox5 and Sox6 to activate the Col2a1 reporter. Considering that co-expression of Sox9 and Sox10 results in intermediate levels of reporter activation compared to the expression of either Sox9 or Sox10, and that co-expression of LSox5 with Sox9 or Sox10 shows lower activation of the reporter compared to the expression of either Sox9 or Sox10, the way Sox10 activates Col2a1 transcription may be similar to that of Sox9. In this study, we described the enhancement of Sox10 function by the PKA signal (Fig. 5). In cartilage cells, PKA-mediated phosphorylation of Sox9 enhances its transcriptional activation of Col2a1 enhancer/promoter (Huang et al. 2000). We have reported the requirement of the PKA signal in the induction of neural crest formation and subsequent EMT by BMP4 and Sox9 (Sakai et al. 2006), and our current results with Sox10 further emphasize the importance of the PKA signal in neural crest development. It seems unlikely that Sox10 activity is regulated by PKA-mediated direct phosphorylation because no consensus site for PKA-mediated phosphorylation is conserved in Sox10. If this could be the case, there will be more PKA-substrates responsible for Sox proteins to activate Col2a1 transcription. It is nevertheless of note that the upregulation of Col2a1 by Sox9/Sox10 transfection was restricted in the dorsal 2/3 of the neural tube. It is well known that Sonic hedgehog signaling in the ventral neural tube inhibits the PKA signal in the ventral neural tube (for a review see Litingtung & Chiang 2000), and that the accumulation of phosphorylated CREB indicates high PKA activity in the dorsal neural tube (Chen et al. 2005). Potential dorso-ventral difference of PKA activity is consistent with a previous report, showing that Sox9 overexpression promotes ectopic induction of EMT only in the dorsal neural tube (Cheung & Briscoe 2003), although Sox9/Sox10 overexpression in the ventral neural tube promotes EMT when allowed to develop for a prolonged period (McKeown et al. 2005), possibly caused by changes in the PKA signal level over time. Thus, the modulation of PKA activity in the neural tube along the dorso-ventral axis may create the difference in the ability of Sox9/Sox10 transfection. It is interesting to note that the induction of HNK1 by Sox9/Sox10 and the induction of Sox10 expression by Sox9 do not appear to be affected by the dorso-ventral difference of the neural tube. This observation is consistent with the idea that there are PKA-dependent and independent targets for Sox proteins, as we have previously demonstrated that Sox9

can activate the Snail2 promoter in a PKA-independent fashion, while the Sox9-mediated induction of EMT of neural crest cells requires the PKA-mediated phosphorylation of Sox9 (Sakai et al. 2006). As mentioned in the Introduction, the importance of Sox family genes in neural crest formation, EMT and differentiation has been extensively described (for reviews see Hong & Saint-Jeannet 2005; Sakai & Wakamatsu 2005). In particular, Sox9, Sox10 and LSox5 appear to have significant roles in early neural crest development (Spokony et al. 2002; Cheung & Briscoe 2003; Honore et al. 2003; Lee et al. 2004; Perez-Alcala et al. 2004; Sakai et al. 2006). These Sox genes are all expressed in the cartilage differentiation, and at least Sox9 and LSox5 have been known to activate Col2a1 transcription in cartilage cells. These observations indicate that both in early neural crest development and in cartilage differentiation, a common mechanism is used. Although further studies in primitive chordates are required, it is possible that the regulatory system would have been established in ancestral animals, and that such a system might be co-opted in neural crest and cartilage in vertebrates. Nevertheless, the regulatory systems of neural crest development by group E Sox genes have become more complex after multiple group E Sox genes have segregated from the ancestral gene in vertebrate evolution, as group E Sox genes appear to interact and to cross-regulate. The role of Col2a1 in neural crest development remains to be studied. Like other extracellular matrix components, type 2 collagen may support the migration of neural crest cells. Alternatively, but not exclusively, as we have observed anti-type 2 collagen immunoreactivity in the basement membrane of the PNS as well as other epithelial tissues (Yoshio Wakamatsu, unpubl. observ., 2005), type 2 collagen may also contribute to the formation of the PNS. In addition, Col2a1 generates distinct isoforms by alternative splicing and one of the isoforms contains a cysteine-rich domain which can bind to BMP and transforming growth factor (TGF)β proteins (Ng et al. 1993; Cheah et al. 2005). Thus, Col2a1 expression in the neural crest cells may affect the cell behavior and determine its fate by modulating BMP signaling.

Acknowledgements We thank Dr Carol Erickson (University of California, Davis) for comments on the manuscript. This work was supported in part by grants to Yoshio Wakamatsu from the Ministry of Education, Science, Sports and Culture, Japan (14034203, 14033205, 14017005, 13138201, 16015214, 16027201, 17024003).



References Britsch, S., Goerich, D. E., Riethmacher, D. et al. 2001. The transcription factor Sox10 is a key regulator of peripheral glial development. Genes Dev. 15, 66 –78. Brunet, L. J., McMahon, J. A., McMahon, A. P. & Harland, R. M. 1998. Noggin, cartilage morphogenesis, and joint formation in the mammalian skeleton. Science 280, 1455 –1457. Cheah, K. S. E., Wang, S. Y. Y., Zhang, J. C. L., Leung, A. W. L., Chan, D. & Tam, P. P. L. 2005. Procollagen IIA regulates BMP/TGFβ signaling in patterning the heart and its major vessels. Mech. Dev. 122, supplement (abstract for 15th International Society of Developmental Biologists Congress). Chen, A. E., Ginty, D. D. & Fan, C.-M. 2005. Protein kinase A signalling via CREB controls myogenesis induced by Wnt proteins. Nature 433, 317–322. Cheng, Y., Cheung, M., Abu-Elmagd, M. M., Orme, A. & Scotting, P. J. 2000. Chick sox10, a transcription factor expressed in both early neural crest cells and central nervous system. Brain Res. Dev. Brain Res. 121, 233–421. Cheung, M. & Briscoe, J. 2003. Neural crest development is regulated by the transcription factor Sox9. Development 130, 5681–5693. Cheung, M., Chaboissier, M. C., Mynett, A., Hirst, E., Schedl, A. & Briscoe, J. 2005. The transcriptional control of trunk neural crest induction, survival, and delamination. Dev. Cell 8, 179–192. Chimal-Monroy, J., Rodriguez-Leon, J., Montero, J. A. et al. 2003. Analysis of the molecular cascade responsible for mesodermal limb chondrogenesis: Sox genes and BMP signaling. Dev. Biol. 257, 292–301. Endo, Y., Osumi, N. & Wakamatsu, Y. 2002. Bimodal functions of Notch-mediated signaling are involved in neural crest formation during avian ectoderm development. Development 129, 863 – 873. Funahashi, J., Okafuji, T., Ohuchi, H., Noji, S., Tanaka, H. & Nakamura, H. 1999. Pax-5 regulates mid-hindbrain organizer’s activity through an interaction with Fgf8. Dev. Growth Differ. 41, 59–72. García-Castro, M., Marcelle, C. & Bronner-Fraser, M. 2002. Ectodermal Wnt function as a neural crest inducer. Science 297, 848–851. Hamburger, V. & Hamilton, H. L. 1951. A series of normal stages in the development of the chick embryo. J. Morph. 88, 49 –92. Hong, C. S. & Saint-Jannet, J. P. 2005. Sox proteins and neural crest development. Semin. Cell Dev. Biol. 16, 694–703. Honore, S. M., Aybar, M. J. & Mayor, R. 2003. Sox10 is required for the early development of the prospective neural crest in Xenopus embryos. Dev. Biol. 260, 76 – 96. Huang, W., Zhou, X., Lefebvre, V. & de Crombrugghe, B. 2000. Phosphorylation of SOX9 by cyclic AMP-dependent protein kinase A enhances SOX9′s ability to transactivate a Col2a1 chondrocyte-specific enhancer. Mol. Cell. Biol. 20, 4149 – 4158. Ito, H., Akiyama, H., Shigeno, C. & Nakamura, T. 1999. Noggin and bone morphogenetic protein-4 coordinately regulate the progression of chondrogenic differentiation in mouse clonal EC cells, ATDC5. Biochem. Biophys. Res. Commun. 260, 240–244. Kos, R., Reedy, M. V., Johnson, R. L. & Erickson, C. A. 2001. The winged-helix transcription factor FoxD3 is important for establishing the neural crest lineage and repressing melanogenesis in avian embryos. Development 128, 1467–1479. Le Douarin, N. M. & Kalcheim, C. 1999. The Neural Crest, 2nd edn. Cambridge University Press, Cambridge.

485

Lee, Y. H., Aoki, Y., Hong, C. S., Saint-Germain, N., Credidio, C. & Saint-Jeannet, J. P. 2004. Early requirement of the transcriptional activator Sox9 for neural crest specification in Xenopus. Dev. Biol. 275, 93 –103. Lefebvre, V., Zhou, G., Mukhopadhyay, K. et al. 1996. An 18base-pair sequence in the mouse Proα1(II) collagen gene is sufficient for expression in cartilage and binds nuclear proteins that are selectively expressed in chondrocytes. Mol. Cell. Biol. 16, 4512– 4523. Lefebvre, V., Huang, W., Harley, V. R., Goodfellow, P. N. & de Cromburgghe, B. 1997. SOX9 is a potent activator of the chondrocyte-specific enhancer of the proα1(II) collagen gene. Mol. Cell. Biol. 17, 2336 –2346. Lefebvre, V., Li, P. & de Crombuggle, B. 1998. A new long form of Sox5 (L-Sox5), Sox6 and Sox9 are coexpressed in chondrogenesis and cooperatively active the type II collagen gene. EMBO J. 17, 5718 –5733. Liem, K. F., Tremmi, G., Roelink, H. & Jessell, T. M. 1995. Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Cell 82, 969 – 979. Liem, K. F. Jr, Tremml, G. & Jessell, T. M. 1997. A role for the roof plate and its resident TGF-β related proteins in neuronal patterning in the dorsal spinal cord. Cell 91, 127–138. Litingtung, Y. & Chiang, C. 2000. Control of Shh activity and signaling in the neural tube. Dev. Dyn. 219, 143 –154. Liu, J.-P. & Jessell, T. M. 1998. A role for rhoB in the delamination of neural crest cells from the dorsal neural tube. Development 125, 5055 –50671. Marchant, L., Linker, C., Ruiz, P., Guerrero, N. & Mayor, R. 1998. The inductive properties of mesoderm suggest that the neural crest cells are specified by a BMP gradient. Dev. Biol. 198, 319 –329. McKeown, S. J., Lee, V. M., Bronner-Fraser, M., Newgreen, D. F. & Farlie, P. G. 2005. Sox10 overexpression induces neural crest-like cells from all dorsoventral levels of the neural tube but inhibits differentiation. Dev. Dyn. 233, 430 – 444. Ng, L. J., Tam, P. P. & Cheah, K. S. 1993. Preferential expression of alternatively spliced mRNAs encoding type II procollagen with a cysteine-rich amino-propeptide in differentiating cartilage and nonchondrogenic tissues during early mouse development. Dev. Biol. 159, 403 – 417. Nieto, M. A., Sargent, M. G., Wilkinson, D. G. & Cooke, J. 1994. Control of cell behavior during vertebrate development by Slug, a zinc finger gene. Science 264, 835–839. Perez-Alcala, S., Nieto, M. A. & Barbas, J. A. 2004. LSox5 regulates RhoB expression in the neural tube and promotes generation of the neural crest. Development 131, 4455 – 4465. Pizette, S. & Niswander, L. 2000. BMPs are required at two steps of limbs chondrogenesis: formation of prechondrogenic condensations and their differentiation into chondrocytes. Dev. Biol. 219, 237–249. Sakai, D. & Wakamatsu, Y. 2005. Regulatory mechanisms for neural crest formation. Cells Tissues Organs 179, 24–35. Sakai, D., Tanaka, Y., Endo, Y., Osumi, N., Okamoto, H. & Wakamatsu, Y. 2005. Regulation of Slug transcription in embryonic ectoderm by beta-catenin-Lef/Tcf and BMPSmad signaling. Dev. Growth Differ. 47, 471– 482. Sakai, D., Suzuki, T., Wada, H., Osumi, N. & Wakamatsu, Y. 2006. Cooperative action of Sox9, Snail2, and PKA signaling in early neural crest development. Development 133, 1323 –1333. Shukunami, C., Akiyama, H., Nakamura, T. & Hiraki, Y. 2000. Requirement of autocrine signaling by bone morphogenetic protein-4 for chondrogenic differentiation of ATDC5 cells. FEBS. Lett. 469, 83 – 87.


486

T. Suzuki et al.

Sonnenberg-Riethmacher, E., Miehe, M., Stolt, C. C., Goerich, D. E., Wegner, M. & Riethmacher, D. 2001. Development and degradation of dorsal root ganglia in the absence of the HMGdomain transcription factor Sox10. Mech. Dev. 109, 253–265. Spokony, R. F., Aoki, Y., Saint-Germain, N., Magner-Fink, E. & Saint-Jeannet, J. P. 2002. The transcription factor Sox9 is required for cranial neural crest development in Xenopus. Development 129, 421– 432. Tsumaki, N., Nakase, T., Miyaji, T. et al. 2002. Bone morphologenetic protein signals are required for cartilage formation and differently regulate joint development during skeletogenesis. J. Bone Miner. Res. 17, 898 – 906. Tucker, G. C., Delarue, M., Zada, S., Boucaut, J. C. & Thiery, J. P. 1988. Expression of the HNK-1/ NC-1 epitope in early vertebrate neurogenesis. Cell Tissue Res. 251, 457– 465. Wakamatsu, Y. & Weston, J. A. 1997. Sequential expression and role of Hu RNA-binding proteins during neurogenesis. Development 124, 3449 –3460. Wakamatsu, Y., Watanabe, Y., Shimono, A. & Kondoh, H. 1993. Transition of localization of the N-myc protein from nucleus to cytoplasm in differentiating neurons. Neuron 10, 1–9.

Wakamatsu, Y., Watanabe, Y., Nakamura, H. & Kondoh, H. 1997. Regulation of the neural crest cell fate by N-myc: promotion of ventral migration and neuronal differentiation. Development 124, 1953 –1962. Wakamatsu. Y., Endo, Y., Osumi, N. & Weston, J. A. 2004a. Multiple roles of Sox2, an HMG-box transcription factor in avian neural crest development. Dev. Dyn. 229, 74 – 86. Wakamatsu, Y., Osumi, N. & Weston, J. A. 2004b. Expression of a novel secreted factor, Seraf, indicates an early segregation of Schwann cell precursors from neural crest during avian development. Dev. Biol. 268, 162–173. Weston, J. A. 1991. Sequential segregation and fate of developmentally restricted intermediate cell populations in the neural crest lineage. Curr. Top. Dev. Biol. 25, 133 –153. Yoon, B. S. & Lyons, K. M. 2004. Multiple functions of BMPs in chondogenesis. J. Cell Biochem. 93, 93 –103. Zhou, G., Garofalo, S., Mukhopadyay, K., Lefebvre, V., Smith, C. N., Eberspaecher, H. & de Crombrugghe, B. 1995. A 182 bp fragment of the mouse pro alpha 1(II) collagen gene is sufficient to direct chondrocyte expression in transgenic mice. J. Cell Sci. 108, 3677–3684.
