Spatial expression patterns of epidermal growth factor ...

Hearing Research 141 (2000) 19^27 www.elsevier.com/locate/heares

Spatial expression patterns of epidermal growth factor receptor gene transcripts in the postnatal mammalian cochlea A. Zine, M. Ny¡eler, F. de Ribaupierre * Institute of Physiology, Universtiy of Lausanne, 7 Rue du Bugnon, CH-1005 Lausanne, Switzerland Received 3 June 1999; received in revised form 19 October 1999; accepted 25 October 1999

Abstract Recent in vitro studies demonstrated that members of the epidermal growth factor (EGF) family are involved in hair cell replacement in the postnatal mammalian organ of Corti (OC) after ototoxic damage. This suggests a role for the EGF receptor (EGFR) in this process. We examined the expression of EGFR mRNA within the normal postnatal day 3 (P3) and adult rat cochlear epithelium by RT-PCR and examined its cellular localization with non-radioactive in situ hybridization in P3 and adult cochleae. RT-PCR demonstrated that EGFR mRNA is expressed in P3 and adult cochlear epithelium. In situ hybridization localized high levels of EGFR transcripts in the OC, spiral ganglion, Ko«lliker's organ and detectable levels in the supporting cells and the stria vascularis of P3 cochlea. In the adult cochlea, EGFR transcripts were detected only in the spiral ganglion. Our results support that the EGFR is implicated in the differentiation of several cochlear cell types and in the response of OC to ototoxic damage of the P3 rat. In the adult, it may participate in the maintenance of the mature neurons and its absence in the OC may contribute to the lack of regenerative responses in the adult cochlea. ß 2000 Elsevier Science B.V. All rights reserved. Key words: Reverse transcriptase-polymerase chain reaction; Organ of Corti; Epidermal growth factor receptor; In situ hybridization; Rat

1. Introduction Epidermal growth factor (EGF) and transforming growth factor-alpha (TGFK) are two polypeptide growth factors that a¡ect the proliferation, di¡erentiation, and migration of mesenchymal and epithelial cell types (James and Bradshaw, 1984; Wang et al., 1989). Numerous in vitro studies have demonstrated that EGF and/or TGFK can in£uence the survival and di¡erentiation of a diverse population of fetal and neonatal neurons and glia derived from widespread brain regions (Morrison et al., 1987; Palata-Salaman, 1991). Both molecules exert their actions through binding to the EGF receptor (EGFR), which exhibits intrinsic protein tyrosine kinase activity leading to signal transduction and subsequent biological responses (Derynck,

* Corresponding author. Tel.: +41 (21) 692 5527; Fax: +41 (21) 692 5505; E-mail: [email protected]

1988). The mRNA and protein for EGFR are expressed in many tissues that show proliferative and regenerative repair capacity (Seroogy et al., 1995; Weickert and Blum, 1995). Studies using inner ear cultures have indicated that TGFK, EGF, EGF plus insulin, insulin-like growth factor-1, ¢broblast growth factor 2 (FGF2) and TGFK plus insulin are associated with the regenerative proliferation in damaged vestibular organs (Lambert, 1994 ; Yamashita and Oesterle, 1995; Sa¡er et al., 1996 ; Zheng et al., 1997; Kuntz and Oesterle, 1998). In the rat cochlea, applied FGF2 has been reported to protect hair cells from ototoxic damage (Low et al., 1996), possibly acting on FGF receptor 3 which is expressed in the cells (Pirvola et al., 1995). Recently, both TGFK (Staecker et al., 1995) and TGFK and/or EGF (Zine and de Ribaupierre, 1998) have been implicated in stimulating the capacity of hair cell replacement after aminoglycoside ototoxic damage in postnatal day 3 (P3) rat cochlear organotypic cultures. Despite these studies suggesting a role of the EGFR in hair cell replacement, the expression and the cellular localization of this re-

0378-5955 / 00 / $ ^ see front matter ß 2000 Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 5 9 5 5 ( 9 9 ) 0 0 2 0 3 - 8

HEARES 3369 3-3-00 Cyaan Magenta Geel Zwart

20

A. Zine et al. / Hearing Research 141 (2000) 19^27

ceptor in the rat cochlea need to be further documented. The aims of this study were (1) to demonstrate the expression of EGFR mRNA in the P3 and adult rat cochlear epithelia using RT-PCR and (2) to determine the cellular localization of the EGFR mRNA in the P3 and adult cochlea by in situ hybridization. 2. Materials and methods 2.1. Animals and tissue preparation For RT-PCR, cochleae were removed from P3 and adult Sprague-Dawley rats, after deep Nembutal anesthesia. The stria vascularis, Reissner's and tectorial membranes were quickly removed in ice-cold RNasefree Hanks' balanced saline solution (HBSS) at pH 7.4 and discarded. The remaining cochlear tissue consisting of the organ of Corti (OC), its surrounding lateral and medial supporting cells, most of the spiral ganglion and part of the basilar membrane is de¢ned here as `cochlear epithelium'. It was immediately frozen and stored at 380³C until use. For in situ hybridization, cochleae of P3 and adult rats (3^4 months old) were ¢xed by perilymphatic perfusion with 4% paraformaldehyde, those of adults by intracardiac perfusion after Nembutal anesthesia. The specimens were immersed in fresh ¢xative (4^8 h, 4³C), followed by decalci¢cation in 0.5 M EDTA for the adult cochleae. Samples were embedded in para¤n and serial sections of 10 Wm were cut in the transverse plane and mounted onto gelatin-coated slides. 2.2. RNA extraction and reverse transcription Cochlear tissue from P3 and adult rats was homogenized in guanidinium thiocyanate by several passages through a sterile syringe needle. Total RNA was isolated by cesium chloride density gradient ultracentrifugation. After precipitation in chilled 70% ethanol, the pellet was resuspended in nuclease-free water and stored at 370³C. Immediately before use, RNA was precipitated by centrifugation, washed with 70% ethanol, and dried on ice. Polyadenylated RNA (mRNA) was puri¢ed from total RNA through oligo(dT)-cellulose separation (Pharmacia). The ¢rst strand cDNA synthesis was initiated by the addition of 9 Wl solution containing 2 Wl of 100 mM DTT, 4 Wl of 5Utranscription bu¡er (250 mM Tris-HCl pH 8.3, 375 mM KCl, 15 mM MgCl2 ), 1 Wl of dNTP, (10 mM each), 1 Wl of 33 U/Wl RNasin and 1 Wl of Superscript II RNase free reverse transcriptase (Gibco BRL). The reaction was performed at 37³C for 1 h, followed by denaturation at 95³C for 5 min and cooling at 4³C.

2.3. PCR ampli¢cation and primers Sequences of the 20-mer oligonucleotides used for PCR ampli¢cation of the reverse transcribed RNA were obtained from a published cDNA sequence of the extracellular domain of the rat EGFR (Petch et al., 1990 ; GenBank accession number M37394). They are listed in the 5P to 3P direction with the following coordinates : forward primer was AGTGGTCCTTGGAAACTTGG (nucleotides 330^349), and reverse primer was GTTGACATCCATCTGGTACG (nucleotides 974^993). PCR was performed in 100 Wl ¢nal volume containing 10 Wl of reverse transcription reaction, 50 mM KCl, 10 mM Tris-HCl, 2 mM MgCl2 , 2.5 U of Taq DNA polymerase (Pharmacia), distilled water and 1 WM of forward and reverse primers. The mixture was incubated in a Biometra thermal cycler for 30 cycles using the following pro¢le: an initial denaturation step at 94³C for 2 min, then repeated cycles of 94³C for 1 min (denaturation), 53³C for 1 min (annealing), and 72³C for 1 min (elongation). At the end of the reactions, PCR products were analyzed by electrophoresis through 1% agarose gel, and the DNA was visualized by ethidium bromide staining and UV illumination. All PCR ampli¢cations were run on at least three independent samples of cochlear tissue. As negative control each sample was run in duplicate, with and without reverse transcriptase in the reaction mixture, to con¢rm that the ampli¢cation bands came from RNA and not from the ampli¢cation of genomic DNA or contaminating cDNA. Positive control of the PCR ampli¢cation was carried out using 50 ng of a 2.1 kb rat EGFR cDNA (Petch et al., 1990) as a substrate for PCR reaction. The pBluescript plasmid containing this cDNA was kindly provided by Dr. S. Earp (University of North Carolina, USA). 2.4. EGFR probes Rat EGFR antisense and sense riboprobes were obtained by transcribing the pBluescript vector containing a 2.1 kb cDNA encoding the transmembrane and extracellular domains of the rat EGFR (Petch et al., 1990). For the antisense probe, the plasmid was linearized with SalI and the transcription performed using a T7 RNA polymerase. For the sense probe, the plasmid was linearized with BamHI and the transcription was performed using a T3 RNA polymerase (all enzymes supplied by Promega, Madison, WI, USA). The nonradioactive labeling reaction using the digoxigenindUTP method was performed as described by the manufacturer (Boehringer-Mannheim). The resulting riboprobes were degraded to an average length of 150 bp

HEARES 3369 3-3-00 Cyaan Magenta Geel Zwart

A. Zine et al. / Hearing Research 141 (2000) 19^27

21

using alkaline hydrolysis to facilitate tissue penetration (Cox et al., 1984). 2.5. Non-radioactive in situ hybridization Before hybridization, 10 Wm para¤n-embedded sections were depara¤nized and rehydrated through ethanol into phosphate bu¡ered saline and re¢xed with 4% paraformaldehyde. They were then treated with 0.2 N HCl, digested with proteinase K and acetylated with acetic anhydride. Prehybridization was done by covering the sections with prehybridization solution (50% formamide, 0.3 M NaCl, 20 mM Tris-HCl (pH 8.0), 5 mM EDTA, 10% dextran sulfate, 1UDenhardt's solution, 0.5 mg/ml yeast tRNA, 1 mg/ml sheared salmon sperm DNA) for 1 h at 40³C. Hybridization was carried out with 250 ng/ml riboprobe in prehybridization solution at 50³C overnight. Sections were washed in high stringency conditions and treated with RNase A. Detection of bound riboprobes was done as described previously by SchaerenWeimers and Ger¢n-Moser (1993). Brie£y, sections were washed once for 5 min in bu¡er 1 (0.1 M maleic acid, 0.15 M NaCl, pH 7.0), incubated for 1 h in bu¡er 2 (1.5% Boehringer blocking reagent, in bu¡er 1), incubated for 2 h in sheep anti-digoxigenin antibody conjugated to alkaline phosphatase (Boehringer-Mannheim) 1:500 in bu¡er 2 and washed twice for 30 min in bu¡er 1. Color reaction was performed by the NBT/ BCIP method according to Boehringer-Mannheim until the signal developed. The reaction was stopped by washing in distilled water and the sections were mounted in 80% glycerol in distilled water and photographed under light and Nomarski optics. The care and use of the animals reported on in this study were approved by the ethical committee for experiments on animals of the Etat de Vaud, Switzerland, authorization No. 1075. 3. Results 3.1. RT-PCR analysis of the cochlear epithelium expression of the EGFR mRNA The expression of EGFR mRNA was investigated by RT-PCR in the cochlear epithelium from P3 and adult rats. RNAs extracted from either P3 or adult pooled cochlear epithelia were reverse transcribed into cDNA and then ampli¢ed by PCR with speci¢c primers deduced from the sequence of the extracellular region of the rat EGFR (Petch et al., 1990). The reaction generated a single ampli¢ed product of the expected size (664 bp), visible on an ethidium bromidestained agarose gel when RNAs from P3 or adult coch-

Fig. 1. RT-PCR products ampli¢ed from P3 and adult cochlear sensory epithelia RNA target using primers speci¢c for the EGFR and analyzed by electrophoresis on a 1% agarose gel as described in Section 2. Negative controls ampli¢ed without reverse transcription for samples from P3 (3RT (P3)) and from adult (3RT (adult)) cochlear epithelia. Also shown is the positive control from a plasmid containing rat EGFR cDNA (lane P). Expected ampli¢ed products of 664 bp for EGFR were obtained. First and last lanes (M) contain a 100 bp ladder for determination of the molecular weight of ampli¢ed products.

lear epithelia were tested as the template for the RTPCR (Fig. 1). In the positive control consisting of the plasmid sample that contains a 2.1 kb cDNA encoding the transmembrane and extracellular domains of the rat EGFR, a similar PCR ampli¢ed product (664 bp) was obtained (Fig. 1, lane P). In the negative controls, omission of either RNA template (data not shown) or reverse transcriptase (3RT) during reverse transcription and subsequent PCR with EGFR primers resulted in the absence of ampli¢ed products. These results show ¢rst that RNA templates were necessary to observe the ampli¢cation products and second that this product originates from mRNA rather than from contaminating genomic DNA. 3.2. Distribution of EGFR transcripts in the cochlea Single-stranded digoxigenin-labeled RNA probes were transcribed from the pBluescript KS‡ plasmid containing rat EGFR cDNA, in sense and antisense orientations, to be used for in situ hybridization. The EGFR sense riboprobes which served as negative controls showed no evidence of speci¢c patterns of labeling (Fig. 2B), although occasional, non-speci¢c labeling of the cartilaginous or bony capsule was observed

HEARES 3369 3-3-00 Cyaan Magenta Geel Zwart

22

A. Zine et al. / Hearing Research 141 (2000) 19^27

HEARES 3369 3-3-00 Cyaan Magenta Geel Zwart

A. Zine et al. / Hearing Research 141 (2000) 19^27 Table 1 Summary of the expression patterns of EGFR transcripts in the P3 and adult cochleae Region Inner hair cells Outer hair cells Spiral ganglion Ko«lliker's organ Inner sulcus Deiters' cells Hensen cells Stria vascularis Spiral limbus Cochlear capsule

P3

Adult

Base

Apex

Base

Apex

+ +++ ++ ++

++ +++ +++ +++

3 3 +

3 3 ++

++ ++ ++ + ++

++ + + ++ ++

3 3 3 3 3 +

3 3 3 3 3 +

3, Structures for which no hybridization signal was observed with antisense riboprobes for EGFR mRNA; +, weak signal; ++, moderate signal; +++, strong signal.

with both sense and antisense probes. The antisense riboprobes for EGFR mRNA gave speci¢c patterns of hybridization in the P3 and adult cochleae. Speci¢c patterns of labeling were observed in several populations of cells within the P3 cochlea (Fig. 2A). In the OC, high levels of EGFR transcripts were detected in the two types of sensory hair cells of the OC: inner hair cells (IHCs) and outer hair cells (OHCs) (Fig. 2C^E). However, the level of hybridization observed over the OHCs was somewhat higher than that seen over the IHCs (Fig. 2C,D). EGFR transcripts were also strongly expressed in the perikarya of the spiral ganglion neurons, with the highest signal detected in the apical cochlear turn (Figs. 2A and 3C). The Deiters' cells below the OHCs showed a moderate expression of EGFR mRNA in comparison to the hair cells and the spiral ganglion neurons (Fig. 2C,E). High magni¢cation indicated that the hybridization signal of EGFR mRNA concerned the cytoplasm in proximity to the nucleus of the labeled cells (Fig. 2E,F). This distribution is in agreement with previous observations on other cells showing a perinuclear localization of the EGFR transcripts (Sibon et al., 1994). Expression of EGFR transcripts was also detected in a number of non-sensory cells within the P3 cochlea

23

(Table 1). These included the pool of the remnant precursor cells that form the so called Ko«lliker's organ or the greater epithelial ridge, located medial to the IHC row, which showed higher expression in the apical turn (Fig. 2A,C) ; the stria vascularis cells; the spiral limbus cells ; the Deiters' cells underneath the OHCs and the Hensen cells, laterally to the OHC region. Within the stria vascularis (Fig. 3E), EGFR transcripts were con¢ned to the basal cells, with decreasing hybridization level from the base to the apex of the cochlea. In contrast to the extensive expression of EGFR mRNA within the P3 cochlea, in the adult cochlea (Fig. 3), hybridization disappeared in many cochlear structures (Fig. 3B). In all cochlear turns, a hybridization signal remained only in the spiral ganglion neurons (Fig. 3F) and the highest EGFR mRNA expression was detected in the apical cochlear turn (Fig. 3D). 4. Discussion 4.1. EGFR gene expression in the cochlea In this study, we initially used RT-PCR to characterize the expression of EGFR mRNA transcripts in the P3 and adult cochlear epithelia. We then con¢rmed this expression by analyzing the cellular localization of EGFR transcripts within the P3 and adult rat cochleae using non-radioactive in situ hybridization. RT-PCR analysis of the cochlear epithelium tissue indicated that the same EGFR mRNA transcripts are expressed in both P3 and adult rats. RT-PCR results revealed no qualitative di¡erence in the expression pattern of EGFR between P3 and adult cochlear samples. However, the in situ hybridization used to determine the precise cellular localization of the EGFR transcripts revealed a more widespread distribution within the P3 cochlea as compared with the adult. In the P3 cochlea, in situ hybridization analysis of EGFR gene transcripts indicated that this growth factor receptor is expressed in various cell types including sensory and non-sensory cells (Table 1). However, some of these transcripts are expressed at higher levels in

6 Fig. 2. Non-radioactive in situ hybridization analysis of the spatial distribution of EGFR transcripts in the P3 cochlea. (A) Cochlea section hybridized to an antisense digoxigenin-labeled riboprobe. At this low magni¢cation, strong EGFR transcript expression is seen in the structures associated with the OC, spiral ganglion neurons (SGN) and the organ of Ko«lliker's (OK). This expression appeared to increase in a gradient from base to apex in the SGN and OK. (B) Control section adjacent to that used in A hybridized to digoxigenin-labeled sense riboprobes was negative. (C) Cochlear canal (CC) of the apical turn. Intense expression of EGFR transcripts is found in the OK cells. At the level of the OC, hybridization is observed in the three rows of OHCs (arrows) and in a row of IHCs (arrow). (D) Basal cochlear turn, with a high hybridization signal detected over the OHC region (long arrow). In the OK, hybridization is weaker (short arrows) in comparison with the apical turn. Note a de¢ned transcript expression in some Hensen cells (open arrow) lateral to the OHC region. (E) Apical turn of another cochlea, with strong labeling in both IHCs (open arrow) and OHCs (long arrows). Speci¢c labeling is also observed in the perinuclear cytoplasm of Deiters' cells (D) underneath the OHCs. (F) Moderately to strongly labeled foci of hybridization signal are present scattered throughout the perikaryal cytoplasm of the spiral ganglion neurons. Scale bars: 10 Wm (A^D); 5 Wm (E); 2 Wm (F).

HEARES 3369 3-3-00 Cyaan Magenta Geel Zwart

24

A. Zine et al. / Hearing Research 141 (2000) 19^27

HEARES 3369 3-3-00 Cyaan Magenta Geel Zwart

A. Zine et al. / Hearing Research 141 (2000) 19^27

speci¢c regions. For instance, high levels of EGFR transcripts are found in both OHCs and IHCs, with the highest expression observed in the OHCs, spiral ganglion neurons and Ko«lliker's organ cells. A moderate level of transcripts is detected in the basal stria vascularis cells and some supporting cells such as Deiters' cells and Hensen cells. A widespread distribution of EGFR transcripts has also been observed in di¡erent brain areas of the neonatal rat (Kornblum et al., 1997). In contrast to the P3 cochlea, the EGFR transcripts are not detected in most cochlear cell types in the adult by in situ hybridization. The expression of the EGFR transcripts is detected only in the spiral ganglion neurons. The hybridization intensity of the spiral ganglion neurons increased gradually from base to apex within the adult cochlea. The limited expression of EGFR to the spiral ganglion neurons may suggest that ligands acting through this receptor such as TGFK and EGF may support the survival and the maintenance of the mature neurons. Other growth factor receptors like the bFGF receptors (Lefebvre et al., 1991) and the GDNF receptor K (Ylikoski et al., 1998) were reported to be expressed in adult auditory neurons and have been shown to play a protective role in response to injury. On the other hand, the spatial distribution patterns of EGFR transcripts within the P3 cochlea reported in the present study by hybridization in situ correlate with previous immunocytochemical studies (Zine and de Ribaupierre, 1999) that detected the EGFR protein. This correlation indicates that EGFR protein is produced by cells that express EGFR transcripts, con¢rming its importance for the normal development of numerous cochlear structures. One exception to this correlation was the absence of EGFR protein in the spiral ganglion neurons of the normal P3 cochlea, although the present in situ hybridization study revealed strong EGFR mRNA in the P3 spiral ganglion. One has to consider that in situ hybridization can only identify the cells in which EGFR mRNA is produced but cannot determine whether the mRNA is translated to protein nor whether this protein is inserted in the cell membrane. However, the EGFR protein was detected in the peripheral ¢bers of the spiral ganglion neurons in P3 cochlear cultures after aminoglycoside treatment (Zine and de Ribaupierre, 1999). This might be ex-

25

plained by a change of EGFR mRNA expression and/or an increase of its translated copies, which produced appropriate amounts of EGFR protein to be detected by immunohistochemistry in the P3 cochlear cultures after aminoglycoside injury. 4.2. Potential functions of EGFR The present study demonstrates that EGFR gene transcripts are expressed in a majority of cell types within the P3 cochlea and restricted to the ganglion spiral neurons in the adult cochlea. In the case of the P3 cochlea, the presence of a high level of these gene transcripts in this period during which the spiral ganglion and the OC have not yet completed the process of terminal di¡erentiation suggests that the interactions of EGFR with its ligands may play an important role in the normal development of the OC. Its increased expression from base to apex may contribute to the di¡erential sensitivity of basal and apical OC to ototoxic insults (Hawkins, 1976). In a previous PCR study, Malgrange et al. (1998) reported the expression of the EGFR and two of its ligands (EGF and TGFK) in the OC and stria vascularis tissue samples of the P3 rat. Since further understanding of the function of the EGFR is dependent upon de¢ning its precise cellular and subcellular distribution we also determined the cell type-speci¢c expression of EGFR, in addition to the characterization of its expression in both P3 and adult cochleae by RT-PCR. Our present results concerning the spatial distribution of EGFR mRNA in the P3 cochlea in combination with those of Malgrange et al. (1998) demonstrating the expression of mRNA of both EGF and TGFK in the OC and stria vascularis by PCR indicate that both the receptor and its ligands can be synthesized by the same cell type at least in the OC and stria vascularis. Thus, EGFR ligands may act either on the cells expressing them or on those in proximity suggesting an autocrine and/or paracrine mode in the regulation of the normal development and di¡erentiation of the OC. These modes of action have been reported for TGFK in other model systems (Lee et al., 1995). Furthermore, the ligand proteins produced by the stria vascularis cells, released into the endolymphatic £uid, could reach by di¡usion the apical surface of the OC

6 Fig. 3. Comparison of the distribution of EGFR transcripts in P3 and adult cochleae, under light (A^D) and Nomarski optics (E,F). (A) Cross-section through the whole P3 cochlea showing hybridization signal in the spiral ganglion neurons (SGN) and in structures associated with the OC. (B) Within the adult cochlea, EGFR transcripts are located only in the SGN of all cochlear turns, with a much higher hybridization signal observed in the apical cochlear turn. (C) High magni¢cation of the SGN from the apical turn of P3 cochlea from A, showing an intense level of EGFR transcripts expression in the SGN. (D) High magni¢cation of SGN from the apical turn of the adult cochlea from B, a moderate hybridization signal as compared to P3 cochlea (C). (E) Cross-section through the middle turn of P3 cochlea, the same cell types as pointed out in Fig. 2D, exhibited speci¢c hybridization signal, in addition to the labeling of the basal cells of the stria vascularis (SV). (F) In comparison to E, in the middle turn of the adult cochlea, EGFR transcript distribution is restricted to the SGN. Scale bar: 20 Wm.

HEARES 3369 3-3-00 Cyaan Magenta Geel Zwart

26

A. Zine et al. / Hearing Research 141 (2000) 19^27

to interact with the EGFR protein shown to be present on the hair cell stereocilia, Ko«lliker's organ and supporting cell apical surfaces (Zine and de Ribaupierre, 1999). Additional studies would be required to determine the cellular distribution of both EGF and TGFK within the normal developing cochlea to shed more light on the potential interactions between EGFR and its ligands. Since a pleiotropism in the function of this receptor is well established (Earp et al., 1995; Weiss et al., 1997), EGF/TGFK-EGFR interaction might have di¡erent effects including di¡erentiation, survival and regeneration-repair processes within the P3 rat cochlea. It has been demonstrated that exogenous TGFK and EGF stimulate the capacity of hair cell replacement, after aminoglycoside damage in the P3 rat cochlear cultures (Staecker et al., 1995; Zine and de Ribaupierre, 1998). In view of these ¢ndings, it is possible that Ko«lliker's organ and/or supporting cells expressing EGFR transcripts might be the source of the replacement hair cells observed in the ototoxically damaged P3 OC in culture. Its absence from the adult OC may be one of the factors that limit the capacity of hair cell replacement in the mature mammalian cochlea. Acknowledgements This work was supported by the Swiss National Science Foundation Grant 31-49782.96. We are grateful to Dr. J.L. Martin for his laboratory facilities, to Dr. S. Earp (University of North Carolina, USA) for generous provision of the rat EGFR cDNA and to M. Capt for histological assistance.

References Cox, K.H., DeLeon, D.V., Angerer, L.M., Angerer, R.C., 1984. Detection of mRNAs in sea urchin embryos by in situ hybridization using asymmetric RNA probes. Dev. Biol. 101, 485^502. Derynck, R., 1988. Transforming growth factor alpha. Cell 54, 593^ 595. Earp, H.S., Dawson, T.L., Li, X., Yu, H., 1995. Heterodimerization and functional interaction between EGF receptor family members: a new signaling paradigm with implications for breast cancer research. Breast Cancer Res. Treat. 35, 115^132. James, R., Bradshaw, R.A., 1984. Polypeptide growth factors. Annu. Rev. Biochem. 53, 259^292. Hawkins, J.E., 1976. Drug ototoxicity. In: Keidel, W.E., Ne¡, W.D. (Eds.), Handbook of Sensory Physiology, Vol. 5, Springer, New York, pp. 707^748. Kornblum, H.I., Hussain, R.J., Bronstein, J.M., Gall, C.M., Lee, D.C., Seroogy, K.B., 1997. Prenatal ontogeny of the epidermal growth factor receptor and its ligand, transforming growth factor alpha, in the rat brain. J. Comp. Neurol. 380, 243^261. Kuntz, A.L., Oesterle, E.C., 1998. Transforming growth factor K with

insulin stimulates cell proliferation in vivo in adult rat vestibular sensory epithelium. J. Comp. Neurol. 399, 413^423. Lambert, P.R., 1994. Inner ear hair cell regeneration in a mammal: Identi¢cation of a trigger factor. Laryngoscope 104, 701^718. Lee, D.C., Fenton, F.E., Berkowitz, E.A., Hissong, M.A., 1995. Transforming growth factor K: Expression, regulation, and biological activities. Pharmacol. Rev. 47, 51^85. Lefebvre, P.P., Staecker, H., Weber, T., Van de Water, T.R., Rogister, B., Moonen, G., 1991. TGFL1 modulates bFGF receptor message expression in cultured adult auditory neurons. NeuroReport 2, 305^308. Low, W., Dazet, S., Baird, A., Ryan, A.F., 1996. Basic ¢broblast growth factor, FGF-2, protects rat cochlear hair cells in organotypical culture from aminoglycoside injury. J. Cell Physiol. 167, 443^450. Malgrange, B., Rogister, B., Lefebvre, P.P., Mazy-Servais, C., Welcher, A.A., Bonnet, C., Hsu, R.Y., Rigo, J.M., Van de Water, T.R., Moonen, G., 1998. Expression of growth factors and their receptors in the postnatal cochlea. Neurochem. Res. 8, 1133^1138. Morrison, R.S., Kornblum, H.I., Leslie, F.M., Bradshaw, R.A., 1987. Trophic stimulation of cultured neurons from neonatal rat brain by epidermal growth factor. Science 238, 72^75. Palata-Salaman, C.R., 1991. Epidermal growth factor and the nervous system. Peptides 12, 653^663. Petch, L.A., Harris, J., Raymond, V.W., Blasband, A., Lee, D.C., Earp, H.S., 1990. A truncated secreted form of the epidermal growth factor receptor is encoded by an alternatively spliced transcript in normal rat tissue. Mol. Cell. Biol. 10, 2973^2982. Pirvola, U., Cao, Y., Oellig, C., Suqqiang, Z., Pettersson, R.F., 1995. The site of action of neuronal acid ¢broblast growth factor is the organ of Corti of the rat cochlea. Proc. Natl. Acad. Sci. USA 92, 9269^9273. Sa¡er, L.D., Gu, R., Corwin, J.T., 1996. An RT-PCR analysis of mRNA for growth factor receptors in damaged and control sensory epithelia of rat utricles. Hear. Res. 94, 14^23. Schaeren-Weimers, N., Ger¢n-Moser, A., 1993. A single protocol to detect transcripts of various types and expression levels in neural tissue and cultured cells: in situ hybridization using digoxigeninlabelled cRNA probes. Histochemistry 100, 431^440. Seroogy, K.B., Gall, C.M., Lee, D.C., Kornblum, H.I., 1995. Proliferative zones of postnatal rat brain express epidermal growth factor receptor mRNA. Brain Res. 670, 157^164. Sibon, O.C.M., Humbel, B.M., De Graaf, A., Verkleij, A.J., Cremers, F.F.M., 1994. Ultrastructural localization of epidermal growth factor, EGF-receptor transcripts in the cell nucleus using pre-embedding in situ hybridization in combination with ultra-small gold probes and silver enhancement. Histochemistry 101, 223^232. Staecker, H., Lefebvre, P.P., Malgrange, B., Moonen, G., Van de Water, T.R., 1995. Regeneration and mammalian auditory hair cells. Science 267, 709^711. Wang, S.L., Shiverick, K.T., Ogilvie, S., Dunn, W.A., Raizada, M.K., 1989. Characterization of epidermal growth factor receptors in astrocytic glial and neuronal cells in primary culture. Endocrinology 124, 240^247. Weickert, C.S., Blum, M., 1995. Striatal TGFK: Postnatal developmental expression and evidence for a role in the proliferation of subependymal cells. Dev. Brain Res. 86, 203^216. Weiss, F.U., Daub, H., Ullrich, A., 1997. Novel mechanisms of RTK signal generation. Curr. Opin. Genet. Dev. 7, 80^86. Yamashita, H., Oesterle, E.C., 1995. Induction of cell proliferation in mammalian inner-ear sensory epithelia by transforming growth factor K and epidermal growth factor. Proc. Natl. Acad. Sci. USA 92, 3152^3155. Ylikoski, J., Pirvola, U., Virkkala, J., Suvanto, P., Liang, X.Q., Magal, E., Altschuler, R., Miller, J.M., Saarma, M., 1998. Guinea pig

HEARES 3369 3-3-00 Cyaan Magenta Geel Zwart

A. Zine et al. / Hearing Research 141 (2000) 19^27 auditory neurons are protected by glial cell line-derived growth factor from degeneration after noise trauma. Hear. Res. 124, 17^ 26. Zheng, J.L., Helbig, C., Gao, W.Q., 1997. Induction of cell proliferation by ¢broblast and insulin-like growth factors in pure rat inner ear epithelial cell cultures. J. Neurosci. 17, 216^226.

27

Zine, A., de Ribaupierre, F., 1998. Replacement of mammalian auditory hair cells. NeuroReport 9, 263^268. Zine, A., de Ribaupierre, F., 1999. Tissue speci¢c levels and cellular distribution of epidermal growth factor receptors within control and neomycin-damaged neonatal rat organ of Corti. J. Neurobiol. 38, 313^322.

HEARES 3369 3-3-00 Cyaan Magenta Geel Zwart