Specific amplification of mt-COI gene of the invasive gastropod

CSIRO PUBLISHING

www.publish.csiro.au/journals/mfr

Marine and Freshwater Research, 2005, 56, 901–912

Specific amplification of mt-COI gene of the invasive gastropod Maoricolpus roseus in planktonic samples reveals a free-living larval life-history stage Rasanthi M. GunasekeraA , Jawahar G. PatilA,B , Felicity R. McEnnultyA and Nicholas J. BaxA A CSIRO

Marine and Atmospheric Research, GPO Box 1538 Hobart, Tas. 7001, Australia. B Corresponding author. Email: [email protected]

Abstract. The New Zealand screwshell Maoricolpus roseus was unintentionally introduced to south-eastern Tasmania in the 1920s. It has colonised more habitat than any other high-impact benthic marine pest in Australia and its wide temperature and depth tolerance makes further spread likely. We developed three sets of genetic probes, each targeting a unique region in the mitochondrial COI locus, for the rapid detection of this species in mixed plankton samples. In particular, we wanted to know whether this species has a planktonic life-history stage that could lead to its dispersal in ships’ ballast water. All probe sets were tested against as many closely related species as could be obtained and the reaction conditions were optimised for maximum sensitivity and specificity of M. roseus. Plankton samples collected in the Derwent Estuary between August 2003 and June 2004 were tested with the probes using a nested polymerase chain reaction. Maoricolpus roseus was detected in the plankton samples especially in the spring–summer period. The presence of M. roseus in the plankton and water available for ships’ ballast indicates that the risk of this species being spread by shipping needs to be managed. Extra keywords: ballast water management, DNA, gene probe, invasive species, marine pest, screwshell, species identification.

Introduction More than 130 invasive marine species have been identified in Australian waters, the invasion status of a further 300 identified species is uncertain, and many invasive species are yet to be identified (Hayes et al. 2004b). Meanwhile, more invasive marine species are arriving and establishing—with an estimated three or more new species establishing every year in Victoria’s Port Philip Bay alone (Hewitt et al. 2004). Shipping ports have been a main entry point for invasive species and water picked up in international ports to ballast commercial vessels is seen as a major vector when the water is discharged into an Australian port. Of 1593 marine species identified as having an invasive history worldwide, ballast water was a vector for at least 623 (Hayes et al. 2004b). At any one time, ballast water may transport more than 10 000 species between marine bioregions worldwide (Carlton 1999). Australia reduced the risk of further ballast water mediated marine invasions by introducing a ballast water management plan in July 2001, requiring that ships carrying high-risk internationally sourced ballast water undertake ballast water management—typically the exchange of high-risk coastal ballast water for low-risk open-ocean ballast water. Building on this success, a national system to reduce the movement of established invasive marine species around Australia is being developed (IGA 2004). Again, ballast water is considered a © CSIRO 2005

major vector for the continuing spread of established invasive species and ballast water management will be required for voyages at risk of spreading invasive species to new areas. Invasive species with a planktonic larval stage in their life cycle can be easily transported in ballast water and spread to new areas. A ballast water management plan is required, particularly for those invasive species that represent significant economic and/or environmental threats to Australia. A list of species has been proposed (Hayes et al. 2004b); however, this list does not include Maoricolpus roseus (Quoy & Gaimard, 1834) (family Turritellidae), a gastropod introduced from New Zealand, because there was no evidence of a pelagic larval stage in its life history. It is known that closely related species release crawling larvae. Unlike many invasive marine species, M. roseus is not restricted to shallow and frequently disturbed environments, such as port environments. In its native New Zealand, it is found on all substrata, from soft sediments to rocky habitats, living in crevices on rock walls and in sheltered pockets on more exposed reefs from low-water to ∼200 m depth on the continental shelf (Scott 1997). Wide latitudinal and depth distribution of M. roseus in New Zealand indicates its potential to spread widely through the Australian marine environment, impacting both environmental and economic values. Dense beds of this burrowing filter feeder (densities have 10.1071/MF05045

1323-1650/05/060901

902

Marine and Freshwater Research

R. M. Gunasekera et al.

Sydney Adelaide

CANBERRA

Melbourne 200 m depth contour

N Hobart 0

200

400

Kilometers

Fig. 1. Current known distribution (in black) of Maoricolpus roseus in Australian waters (based on Bax et al. 2003).

exceeded 1000 m−2 ) impact Australian native species such as scallops, with which they cohabit, and native turritellids such as Gazameda gunnii, which has been steadily declining in numbers concurrent with the increase in M. roseus (Bax et al. 2003). Maoricolpus roseus first arrived in Australia in southeastern Tasmania in the 1920s and has since spread out to the 80-m depth contour off the eastern Victorian and New South Wales coasts and is found as far north as Botany Bay (Bax and Williams 2001; Bax et al. 2003) (Fig. 1). It has yet to move west of Tasmania to the Great Australian Bight and a crucial aspect of its management will be to reduce the risk of this further spread. If M. roseus has planktonic larvae that could be transported in ballast water, then one of the primary management tools would be to manage the ballast water of ships moving from east to west at times that M. roseus larvae are in the water column. Specialist training is needed to identify veliger larvae of M. roseus from other gastropods in the superfamily Cerithioidea found in Australian waters. In this paper, we present the development of three sets of PCR probes for the specific amplification of the M. roseus mitochondrial cytochrome oxidase I (COI) (mt-COI ) gene. Using two sets of these probes, we test a one-year series of plankton samples collected in the Derwent Estuary and show that M. roseus does appear in the plankton and would therefore be susceptible to ballast water transport. Materials and methods Taxonomy and reproduction Maoricolpus roseus is a large, solid gastropod with a broadly conical spire, growing to 87 mm in length and 25 mm in width and is brownish

in colour (Powell 1979). The species is divided into two subspecies: M. roseus roseus and M. roseus manukauensis (Powell 1931). Maoricolpus roseus manukauensis is consistently narrower than the typical M. roseus roseus and its distribution is restricted to the Manukau, Raglan and Kawhia Harbours in New Zealand, whereas M. roseus roseus is found around most of New Zealand (Powell 1979). The Australian specimens were determined to be M. roseus roseus by Greenhill (1965), who compared the dimensions of the Tasmanian specimens with those given in descriptions for the two subspecies by Powell (1931). For simplicity, this subspecies will be referred to as M. roseus for the remainder of this paper. Sexes are separate, with a 50 : 50 ratio (Bax et al. 2003). Both direct and indirect development occur in the Turritellidae. It is known that fertilised embryos are held in egg capsules within the female’s mantle cavity. These develop into trochophore larvae and then into actively swimming veliger larvae within the egg capsules (Pilkington 1974). Whether these veligers are released into the plankton for a period before settlement (indirect development) or whether they immediately settle out as benthic juveniles (direct development) was unknown at the start of this project. Sample collection Adult individuals of M. roseus and native turritellid species were either collected from the wild or obtained from preserved laboratory or museum collections. Fresh tissue was either immediately subjected to DNA extraction, or frozen and stored at −20◦ C or −80◦ C. The museum samples typically came preserved in 95% ethanol. Samples from various locations in Australia and New Zealand, including the subspecies M. roseus manukauensis, were also obtained (Table 1). Despite extensive attempts to obtain samples of native turritellids, we managed to obtain only five native species (Table 1). Samples of Gazameda gunni were obtained from Nubeena in south-east Tasmania by remote grab on board RV Explorer and off south-eastern Victoria using a benthic sled towed by the National Facility RV Southern Surveyor (Williams 2004). Two specimens of Gazameda iredalei were collected by a diver from South Australia, as were the three samples of Turritella terebra from the Northern Territory. Gazameda tasmanica and Colpospira australis were obtained from the Tasmanian Museum and Art Gallery collection (Table 1). Samples of M. roseus from Tasmanian and New South Wales waters were collected by divers or by remote sampling devices on the larger research vessels owned by the Tasmanian Aquaculture and Fisheries Institute (TAFI). DNA extraction, sequencing and analysis All genomic DNA extractions from fresh or frozen samples were performed on 10–50 mg of tissue using the hexadecyltrimethyl ammonium bromide (CTAB) protocol (Doyle and Doyle 1987) or DNeasy tissue kit (QIAGEN, Hilden, Germany) following supplier’s instructions. Tissue samples obtained from museum collections were dissected and rinsed several times in distilled water and then re-hydrated twice for 10 min before DNA extraction. Amplification and sequencing of the mitochondrial cytochrome oxidase subunit I (COI ) was carried out using the universal primers LCO1490 and HCO2198 (Folmer et al. 1994; Table 2). A separate PCR reaction was carried out on all samples using universal nuclear 18S rDNA primers (Table 2; NSF1179 and NSR1642) to confirm suitability of each sample for PCR. Standard PCR reactions were done in a 25 µL volume containing 0.2 µm of each primer, 0.2 mm dNTPs, 2 mm MgCl2 , 1× AmpliTaq Gold buffer and 0.625 units AmpliTaq Gold (Applied Biosystems, Foster City, CA). Thermal cycling conditions were: 94◦ C for 9 min then 35 cycles (94◦ C for 30 s, 54◦ C for 30 s and 72◦ C for 1 min) followed by 72◦ C for 5 min. Aerosol-resistant pipette tips were used with all PCR solutions and negative control reactions were performed with each PCR cocktail.

Molecular detection of the New Zealand screwshell


903

Table 1. Samples obtained for DNA extraction Species

n

Locality/source

Sample code

Maoricolpus roseus M. roseus M. roseus M. roseus M. roseus M. roseus M. roseus M. roseus manukauensis Turritella terebra Gazameda iredalei Gazameda gunnii G. gunnii Gazameda tasmanica Colpospira australis

16 12 10 8 5 10 6 6 3 2 5 13 3 1

Pirates Bay, Tasmania, Australia; A. Reid Dennes Point, Tasmania, Australia; A. Reid Triabunna, Tasmania, Australia; F. McEnnulty Bass Strait #1, Australia; A. Reid Bass Strait #2, Australia; A. Reid Nubeena, Tasmania, Australia; F. McEnnulty Bucklands Beach, New Zealand; M. Morley Manukau Harbour, New Zealand; M. Morley Darwin, N. Territory, Australia; R. Willan Yorke Peninsula, South Australia; K. Gowlett-Holmes Nubeena, Tasmania, Australia; F. McEnnulty Disaster Bay, New South Wales, Australia; A. Williams Burnie, Tasmania, Australia; L. Turner 11 nM SSE off Montagu Island, New South Wales, Australia; L. Turner

Mr_PB Mr_DP Mr_TB Mr_BS1 Mr_BS2 Mr_NB Mr_BB Mrm_MH Tt_DR Gi_YP Gg_NB Gg_DB Gt_BN Ca_MI

Table 2. Sequences of primers used Name

Gene

Sequence (5 –3 )

Application

Reference

LCO 1490(F) HCO 2198(R) NSF 1179

mt-COI mt-COI 18S rDNA

GGTCAACAAATCATAAAGATATTGG TAAACTTCAGGGTGACCAAAAATCA AATTTGACTCAACACGGG

Folmer et al. 1994 Folmer et al. 1994 Wuyts et al. 2001

NSR1642

18S rDNA

GCGACGGGCGGTGTGTAC

CMRSF1

mt-COI

TTCTCTCTGCATTTAGCTGGTGTTTCTTCA

CMRSF4

mt-COI

GTGCTGAGCTTGGACAGCCAGGTGCGTTGC

CMRSR2

mt-COI

TGCTAGCACAGGAAGCGAAAGTAGTAACAA

CMRSR3

mt-COI

CACCCAGTCCCTACCCCTCTTTCTACAGCA

CMRSR4

mt-COI

ACAGCAGCTGAAGAAAGGAGAAGTAGAAGA

PCR—Universal PCR—Universal PCR—Universal Positive control PCR—Universal Positive control PCR and sequencing M. roseus-specific PCR and sequencing M. roseus-specific PCR and sequencing M. roseus-specific PCR and sequencing M. roseus-specific PCR and sequencing M. roseus-specific

PCR products were purified using the QIAquick PCR purification kit (QIAGEN). Reactions for sequencing the COI region were carried out on both strands, using the original amplification primers, with the ABI Big Dye dideoxy terminator cycle sequencing kit (Applied Biosystems). Electrophoresis was carried out on an ABI-377 or ABI-3100 automated DNA sequencer (Applied Biosystems) and sequence data were edited with Sequence Navigator software (Applied Biosystems). Sequence data were aligned using CLUSTAL_X (Thompson et al. 1997). These sequences, along with additional sequences from GenBank (www.ncbi.nlm.nih.gov/Genbank/index.html, verified August 2005), were used to assess the level of COI variation within M. roseus and between this species and other species of the family Turritellidae and the superfamily Cerithoidea. Additional sequence analysis was carried out using the software DNASTAR and a phylogenetic tree of M. roseus from different geographical regions and some closely related species was constructed using the neighbour joining method. The robustness of the data was assessed by implementing bootstrap analysis with 1000 replicates.

Wuyts et al. 2001 This study This study This study This study This study

the primer sites were analysed for secondary structures and selfcomplementarity using OLIGO (Rychlik 1996). Each of the identified oligonucleotides was checked for uniqueness against the COI sequences in GenBank. Three primer pairs (CMRSF1/CMRSR2; CMRSF4/CMRSR3 and CMRSF4/CMRSR4) considered to be ‘M. roseus-specific’were synthesised and tested on M. roseus, M. roseus manukauensis and other species of Turritellidae (Table 2). PCR reactions specific to M. roseus were carried out in a 25 µL volume containing 0.2 µm of each primer, 0.2 mm dNTPs, 2 mm MgCl2 , 1× AmpliTaq Gold buffer and 0.625 units AmpliTaq Gold (Applied Biosystems). Thermal cycling conditions for the specific primers were as follows: 94◦ C for 9 min then 35 cycles (94◦ C for 30 s, 61◦ C for 30 s and 72◦ C for 30 s) followed by 72◦ C for 5 min. All three primer combinations were tested. The products of the M. roseus-specific PCR and the 18S positive control PCR corresponding to each of the samples were either mixed or run separately on a 1.8% agarose gel. All gels were stained with ethidium bromide, exposed under UV light and documented with a Nikon Coolpix digital camera (Nikon, Tokyo).

‘Maoricolpus roseus-specific’ primer design Regions of 30 base pairs (bp) that varied between species ofTurritellidae, but were conserved and unique to M. roseus were identified in the ∼660 bp region of the mt-COI locus. Following initial identification,

Detection of larval Maoricolpus roseus Egg capsules containing veliger larvae of M. roseus were removed under a compound microscope from the mantle cavity of frozen samples

904



Table 3. Species of Turritellidae tested for amplification of the mitochondrial COI (universal primer pairs HCO-F/LCO-R), nuclear 18S rDNA internal control (universal primer pairs NSF1179/NSR1642) and Maoricolpus roseus-specific primers pairs (CMRSF1/CMRSR2; CMRSF4/CMRSR3; CMRSF4/CMRSR4) All the three M. roseus-specific primer pairs yielded identical results Species

Sample code

n

18S rDNA control PCR

Universal COI locus

M. roseus-specific PCR results (61◦ C)

GenBank accession no.

M. roseus M. roseus M. roseus M. roseus M. roseus M. roseus M. roseus M. r. manukauensis T. terebra G. iredalei G. gunnii G. gunnii G. tasmanica C. australis

Mr_PB Mr_DP Mr_TB Mr_BS1 Mr_BS2 Mr_NB Mr_BB Mrm_MH Tt_DR Gi_YP Gg_NB Gg_DB Gt_BN Ca_MI

4 4 4 4 4 4 4 4 2 2 3 3 3 1

+ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve −ve

+ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve −ve −ve

+ve +ve +ve +ve +ve +ve +ve +ve −ve −ve −ve −ve – –

AY953968 AY953969 AY953970 AY953971 AY953972 AY953973 AY953974 AY953975 AY953976 AY953977 AY953978 AY953979 – –

collected from Lords Bluff, Triabunna on 24 January 2001. The sizes of the egg capsules and veligers were measured and numbers per egg capsule were estimated. To test the sensitivity of the developed M. roseus probes, these egg capsules were then transferred directly to PCR tubes (1, 2 or 5 egg capsules per tube) and 10 µL sterile Milli-Q water (Millipore Corporation, Billerica, MA) was added. The samples were snap frozen twice at −80◦ C and thawed at 37◦ C to disrupt the cells. The PCR cocktail (as above) was then added directly to the tubes and PCR amplification was carried out using CMRSF1 and CMRSR2 primers. Detection of Maoricolpus roseus in plankton samples To determine if the probes would effectively detect M. roseus in environmental samples, the probes were tested against genomic DNA extracted from plankton samples collected from the Derwent River estuary between August 2003 and June 2004 (Hayes et al. 2004a). In brief, three 5-min samples were collected with an electric mono pump (CP 25; Melbourne) and sieved through a 100-µm mesh plankton net. Since veliger larvae have been observed in egg capsules at a size of 400 µm (Pilkington 1974), this size mesh deemed to be sufficient to collect any larvae if present in the plankton. The mono pump was calibrated at 1–2 m head, delivering 31 L per minute (range of 30–31.6 L per minute). The total volume of water sampled for each plankton sample was ∼155 L. All samples were fixed in SET buffered (0.375 m NaCl, 2.5 mm EDTA, 40 mm TRIS-HCl, pH 7.8) 80% ethanol. The plankton samples were collected from two locations: the Royal Yacht Club and the Domain slipways in the Derwent River estuary. At least one sample was taken every month except January 2004, when no samples were taken. Plankton samples were concentrated by vacuum filtration through a 5-µm-pore-sized hydrophilic Durapore Filter (Millipore). The residue was allowed to air dry briefly, transferred to a 2 mL tube and DNA was extracted using the DNeasy Plant mini Kit (QIAGEN) following supplier’s instructions. DNA was retrieved in 200 µL elution buffer and stored at 4◦ C. A two-step nested PCR was used for plankton samples to enhance the sensitivity of the test. Primary enrichment PCR was conducted using the universal primer pair LCO1490 and HCO2198 (Table 2). PCR conditions were the same as the standard PCR described previously (in section DNA extraction, sequencing and analysis). The secondary M. roseusspecific PCR was carried out using the primer pairs CMRSF1/CMRSR2

and CMRSF4/CMRSR3 as described above with 1/25 the volume of the primary reaction as template. All positive samples were sequenced for further conformation. A separate PCR reaction was carried out on all plankton samples using universal 18S rDNA primers (Table 2) to confirm suitability of each sample for PCR.

Results DNA extraction and PCR amplification The samples from which DNA was extracted are listed in Table 3. It was possible to amplify regions of both the nuclear 18S rDNA and mitochondrial COI locus from most of the M. roseus samples. No amplification was possible from some M. roseus samples collected from New Zealand, which could be due to degradation of the DNA templates. We successfully amplified both 18S rDNA and mt-COI locus from M. roseus manukauensis, G. iredalei, G. gunnii and Turritella terebra samples. It was possible to amplify only the 18S rDNA loci from G. tasmanica and no amplification was possible from Colpospira (Ctenocolpus) australis (Table 3). There are two possible reasons for these results: (1) the chosen primer pairs were inadequate to amplify the loci; or (2) the template DNA was degraded. The latter is the most probable cause because these samples had been preserved in ethanol for over nine years. Sequence analysis Clustal alignment of the partial mt-COI sequence data (nucleotides) of M. roseus obtained from several geographic regions revealed that the COI region is highly conserved within the species. All the individuals we sequenced from different locations within Australia were identical. However, there were seven mismatches between the sequences of M. roseus in Australia and M. roseus from Bucklands Beach,



Mr_DP Mr_BS2 97 Mr_BS1

Mr_NB 41 100

Mr_TB Mr_PB Mr_BB Mrm_MH

20

SI AY296831 Tt_DR

58

Tsp AF550505 Gi_YP Gg_NB

98 100

Gg_DB Zs AY296834 Cg (TAS)

Fig. 2. A phylogenetic tree of Maoricolpus roseus from different geographical regions and some closely related species. Details of most of the sample codes are given in Table 1. Remaining sample codes are Tsp – Turitella sp.; Sl – Strombus luhuanus; Zs – Zeacumantus subcarinatus; Cg – Crassostrea gigas.

New Zealand. Also, six mismatches were found between M. roseus manukauensis and M. roseus from Australia. Bootstrapping of 1000 neighbour joining trees produced a majority consensus neighbour joining tree (Fig. 2) that indicates the absence of different populations among the M. roseus in Australia because all the Australian samples clustered into a single group. The New Zealand sample of M. roseus (Mr_BB) and M. roseus manukauensis (Mrm_MH) segregated into two close sister-groups (Fig. 2). When sequences corresponding to the mt-COI region of M. roseus and other species of Turritellidae were aligned, it was possible to identify short sequences that were unique for M. roseus to serve as target-specific PCR primers. Alignment of the three specific primer-binding regions, CMRSF1/CMRSR2, CMRSF4/CMRSR3 and CMRSF4/ CMRSR4, from different species of Turritellidae, especially those native to Australia, is shown in Tables 4, 5, 6 respectively. Each of the primer pairs constituted a total sequence region of 60 bp in length. Over this primer region, the target sequence shows a minimum 10 nucleotide differences between M. roseus and the remaining species analysed. However, there was only one nucleotide difference between M. roseus (Australia) and M. roseus manukauensis in all three primer combinations. The relatively high sequence difference (16–31%) at the primer-binding site between Maoricolpus and the other native Turritellidae implies that there was a good possibility of developing species-specific PCR assays at all three primer loci.

905

Specificity of the PCR assay The specificity of the predicted M. roseus-specific primers was empirically tested by PCR amplification of genomic DNA of 42 samples representing five other turritellid species (Table 3). Separate amplifications of all three potential M. roseus-specific primer pairs (gene probes) were carried out and all of them gave similar results. As summarised in Table 3, only the M. roseus samples amplified the target sequence. Representative PCR results following amplification of DNA from different species of turritellid using the three different primer pairs are presented in Fig. 3a,b,c respectively. All samples of M. roseus and M. roseus manukauensis were successfully amplified by the three sets of primers: CMRSF1/CMRSR2 (113 bp), CMRSF4/CMRSR4 (181 bp) and CMRSF4/CMRSR3 (205 bp), irrespective of their geographical origin (Fig. 3; lanes 9–14 and Table 3). In contrast, none of the Gazameda iredalei (Fig. 3; lanes 1–2), G. gunnii—Nubeena (Fig. 3; lanes 3–4), G. gunnii—Disaster Bay (Fig. 3; lanes 5–6) and Turritella terebra (Fig. 3; lanes 7– 8) returned PCR positive for the M. roseus-specific primers. In a concurrent PCR amplification test, a universal primer pair targeted at the 18S rDNA generated an expected fragment size of ∼460 bp (Fig. 3; lanes 1–14, top band and Table 3) from all the samples, indicating that an adequate quantity and quality of template DNA was supplied in each PCR reaction. Detection of larval Maoricolpus roseus The veligers ranged from 0.1 to 0.2 mm in length and there was an average of 45 veligers per egg capsule. It was possible to amplify M. roseus-specific mt-COI amplicon using the isolated egg capsules as templates, without the need to extract the DNA. The accuracy was 100%, even when one egg capsule was used as template (∼45 larvae). Unfortunately, it was physically impossible to isolate and test the probes on individual larvae using frozen samples because most of them tended to rupture and burst open on dissection of the egg capsules. This would not have been a problem when dealing with live specimens, but live-brooding females were unavailable in the wild at this time period in the study. Detection of Maoricolpus roseus in plankton samples A total of 90 (30 sampling points of three replicates) plankton samples was analysed using the primer pairs CMRSF1/ CMRSR2 and CMRSF4/CMRSR3. Details of the samples processed are presented in Table 7. The results indicate that the M. roseus larvae were present in the water column in the Derwent Estuary primarily in the austral summer months (late October through to April), with two additional occurrences in June and August. The results from the two gene probes employed were identical, and subsequent sequencing of the products confirmed the identity of the signals to be that of M. roseus. On the basis of this we can conclude that M. roseus does have a planktonic larval phase.

906



Table 4. Maoricolpus roseus-specific PCR primers, CMRSF1 and CMRSR2, aligned with corresponding sequence from other native species of Turritellidae A dot indicates the nucleotide is the same as in the top sequence Species Mr_DP Mr_BS1 Mr_BS2 Mr_NB Mr_PB Mr_TB Mr_BB Mrm_MH Gg_DB Gg_NB Gi_YP Tt_DR

n

CMRSF1 →

← CMRSR2

3 3 3 3 3 3 3 3 3 3 2 2

5 TTCTCTCTGCATTTAGCTGGTGTTTCTTCA

TGCTAGCACAGGAAGCGAAAGTAGTAACAA3 .............................. .............................. .............................. .............................. .............................. .............................. .............................. A.....T.....T..A..G..A..G.GA.G A.....T.....T..A..G..A..G.GA.G A...........G..G..G..A..A.GG.G C..A..A..T.....G.....A.....T..

.............................. .............................. .............................. .............................. .............................. ........A..................... ........A..................... ..T..AT.A........A....CA..A..T ..T..AT.A........A....CA..A..T ..T..AT.A..C.....G..G.CA..C..T ..T.....C....................T

Table 5. Maoricolpus roseus-specific PCR primers, CMRSF4 and CMRSR3, aligned with corresponding sequence from other native species of Turritellidae A dot indicates the nucleotide is the same as in the top sequence Species Mr_DP Mr_BS1 Mr_BS2 Mr_NB Mr_PB Mr_TB Mr_BB Mrm_MH Gg_DB Gg_NB Gi_YP Tt_DR

n

CMRSF4 →

← CMRSR3

3 3 3 3 3 3 3 3 3 3 2 2

5 GTGCTGAGCTTGGACAGCCAGGTGCGTTGC

CACCCAGTCCCTACCCCTCTTTCTACAGCA3 .............................. .............................. .............................. .............................. .............................. .............................. .............................G ..T.....T...G.G..C........G..T ..T.....T...G.G..C........G..T ...........CG................T ..T..T..T.....T..C.....A.....T

.............................. .............................. .............................. .............................. .............................. .............................. .............................. .G.....A...........C..G..AC.TT .G.....A...........C..G..AC.TT .G.....A..C........C..G..TC.CT .G...........T.....T..G..A...T

Table 6. Maoricolpus roseus-specific PCR primers, CMRSF4 and CMRSR4, aligned with corresponding sequence from other native species of Turritelidae A dot indicates the nucleotide is the same as in the top sequence Species Mr_DP Mr_BS1 Mr_BS2 Mr_NB Mr_PB Mr_TB Mr_BB Mrm_MH Gg_DB Gg_NB Gi_YP Tt_DR

n

CMRSF4 →

← CMRSR4

3 3 3 3 3 3 3 3 3 3 2 2

5 GTGCTGAGCTTGGACAGCCAGGTGCGTTGC

ACAGCAGCTGAAGAAAGGAGAAGTAGAAGA3 .............................. .............................. .............................. .............................. .............................. .........................A.... .....G........................ ..G..T.....G..T..T.AT.A..AC.A. ..G..T.....G..T..T.AT.A..AC.A. .....T.....G..T.AC.AT....A...G .....T...........T.A...C.AT.AG

.............................. .............................. .............................. .............................. .............................. .............................. .............................. .G.....A...........C..G..AC.TT .G.....A...........C..G..AC.TT .G.....A..C........C..G..TC.CT .G...........T.....T..G..A...T



907

18S

COI

18S COI

18S COI

Fig. 3. Representative gel photographs showing ‘M. roseus-specific’ PCR products separated on a 1.8% agarose gel. (a) Primers CMRSF1 & CMRSR2, (b) primers CMRSF4 & CMRSR4 and (c) primers CMRSF4 & CMRSR3 represents amplifications of three potential M. roseusspecific primer pairs. The upper band is the positive internal control reaction (18S, arrowhead) and the lower band is the diagnostic M. roseus-specific (COI, arrowhead). Lane M, standard size markers (2-log DNA ladder, New England Biolabs, Beverly, MA); lanes 1–2, Gi_YP; lanes 3–4, Gg_NB; lanes 5–6, Gg_DB; lanes 7–8, Tt_DR; lanes 9–10, Mrm_MH; lanes 11–12, Mr_BB; lane 13, Mr_DP; lane 14, Mr_NB; lane 15, negative control.

Discussion Development of a specific probe We used a combination of genetic sequence comparison and empirical testing to develop M. roseus-specific PCR primers targeted at the mt-COI locus. These primers can be used to detect and identify M. roseus larvae dissected from the egg capsules or in unsorted plankton samples. The feasibility of

specific PCR amplification as a rapid means for detection and or quantification of larvae has been previously demonstrated for the seastar Asterias amurensis (Deagle et al. 2003) and the bivalve Crassostrea gigas (Patil et al. 2005b) based on the mt-COI locus. It is well known that bivalve molluscs (Patil et al. 2005b, Hare et al. 2000 and references therein) exhibit high sequence

908



Table 7. Gene probe results for plankton samples collected from Derwent River estuary, Hobart Samples were collected at the Royal Yacht Club or the Domain slipways. All the positive samples were sequenced and confirmed positive for Maoricolpus roseus Sampling date

Location

12/08/03 15/08/03 08/09/03 23/09/03 25/09/03 01/10/03 06/10/03 22/10/03 24/10/03 03/11/03 04/11/03 12/11/03 19/11/03 21/11/03 24/11/03 08/12/03 02/02/04 03/02/04 10/02/04 25/02/04 01/03/04 03/03/04 18/03/04 02/04/04 23/04/04 28/04/04 30/05/04 10/05/04 20/05/04 11/06/04

Royal Yacht Club Royal Yacht Club Royal Yacht Club Royal Yacht Club Royal Yacht Club Royal Yacht Club Royal Yacht Club Royal Yacht Club Royal Yacht Club Domain Domain Royal Yacht Club Domain Royal Yacht Club Royal Yacht Club Domain Domain Domain Domain Royal Yacht Club Royal Yacht Club Domain Domain Royal Yacht Club Domain Royal Yacht Club Domain Domain Domain Domain

18S rDNA control PCR

CMRSF1/CMRSR2

CMRSF4/CMRSR3

+ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve +ve

−ve +ve −ve −ve −ve −ve −ve −ve +ve −ve −ve +ve +ve −ve −ve −ve +ve −ve +ve −ve −ve +ve +ve +ve +ve −ve +ve −ve −ve +ve

−ve +ve −ve −ve −ve −ve −ve −ve +ve −ve −ve +ve +ve −ve −ve −ve +ve −ve +ve −ve −ve +ve +ve +ve +ve −ve +ve −ve −ve +ve

variation at the mt-COI locus, permitting the design of species-specific probes. Similarly in this study, the high sequence variation observed at the mt-COI locus among the members of the family Turritellidae led to PCR primers that appear to be specific for M. roseus. This sequence variation was particularly evident in all the three primer pairs chosen (Tables 4, 5, 6), making it possible to design not one but three gene probes for specific detection of M. roseus. This availability of multiple gene probes for specific detection assists with cross verification and validation of results. All three gene probes consist of two species-specific primers each. The use of two species-specific primers as probes provides better discrimination than one conserved primer with an opposing species-specific primer (Rocha-Olivares 1998), as has been previously demonstrated in two other species of molluscs (Hare et al. 2000; Patil et al. 2005b). Furthermore, the large interspecific sequence diversity at all six primer binding sites (Tables 4, 5, 6) suggests that it might be possible to design species-specific probes for other turritellids. The three PCR assays developed in this study successfully amplified the target DNA in the 32 M. roseus samples analysed, despite their geographic diversity (six sampling

sites in Australia and two in New Zealand). However, these samples did not provide a broad coverage of New Zealand or mainland Australia. Therefore, we cannot completely rule out the possibility of intraspecific polymorphism at the primer sites that might preclude amplification in some samples, producing a false negative result. Genetic characterisation of the mt-COI locus of M. roseus throughout its natural range in New Zealand as well as its de novo range, where it has been introduced, would be required to test the possibility of false negative results. However, such false negative results are unlikely because even the subspecies M. roseus manukauensis was successfully amplified by all the three probe sets, despite exhibiting a single base pair polymorphism at all the probe sites. Moreover, the COI locus seems to have low levels of intraspecific polymorphism in marine molluscs (Hare et al. 2000 and references therein and Patil et al. 2005b).Therefore, the probes should be useful to detect future threats of invasion by M. roseus manukauensis, although its distinction from M. roseus will require further confirmation (e.g. sequencing). No false positives were obtained for the M. roseus probes when tested on other species of turritellids, including the


native and threatened screwshell G. gunnii (Fig. 3a–c, lanes 3–6), implying that the probes are species-specific. Primer specificity in PCR is mostly conferred by the last few nucleotides at the 3 end of oligonucleotide, so even a single unique nucleotide can be used to direct species-specific PCR (Newton et al. 1989; Bottema et al. 1993). The M. roseusspecific probes used here had in excess of 10 base pair mismatches with the corresponding sequence from other sequenced native turritellids, suggesting the probes should be specific to M. roseus. We consider the primers to be speciesspecific at least for Australia, not because they have been tested on all potential congeners, but because they exhibit significant sequence divergence, particularly from those of native turritellids analysed. The primers may be speciesspecific outside of this geographic region, but further study would be needed to verify this possibility. If the primers were used for screening environmental samples, it would be prudent to confirm the identity of a subset of positive results by sequencing. Including additional turritellids to those used in this study, especially those from the geographical region where it is intended to use the probes, would be advisable to ensure the specificity of the chosen probe for M. roseus in a new area. Of particular emphasis should be tiny turritellids commonly missed in large-scale surveys. Genetic identification of microscopic organisms in environmental samples is more difficult than identifying pure or isolated samples (Patil et al. 2004). At least two reasons have been proposed to explain this difference. First, dilution of target DNA in the background of environmental DNA samples might reduce the success of amplification. Second, PCR inhibitors such as humic material in the environmental samples, could compromise the efficiency of PCR reactions. However, implementation of a nested PCR approach has successfully circumvented such limitations (Deagle et al. 2003; Patil et al. 2005a, 2005b). Detection levels achieved using purified target DNA are of little significance when dealing with mixed environmental samples and therefore, as described previously (Patil et al. 2004), we attempted to determine the number of larvae that can be consistently detected. Unfortunately, we were unable to isolate individual M. roseus larvae because fresh larvae were unavailable at the time of the sensitivity trials and frozen larvae tended to disintegrate when removed from previously frozen egg capsules. Tests were therefore conducted on whole-egg capsules, which on average contained ∼45 veliger larvae per capsule. Based on previous experience, we expect that as few as five larvae spiked into environmental/ballast water samples could be routinely detected (Patil et al. 2004). Significance in Australia When an invasive species enters a new ecosystem, it can either track the system and its complement of species, or it can modify the system in some way that affects the native


909

species (e.g. predation, smothering, habitat modification). We suggest that M. roseus has modified the unconsolidated substrates of south-east Australia in several ways. First, as a sedentary ciliary feeder (Morton and Miller 1968), the mucus and faecal products of M. roseus will consolidate the sediments it colonises and increase their bacterial load. It is expected that this will change the associated infauna and the settlement and post settlement survival of a variety of benthic organisms (C. MacLeod, TAFI, personal communication). Second, on dying, M. roseus leaves a robust shell that can form deposits of shells many layers deep. The empty shells provide homes for hermit crabs: e.g. Pagurus cooki and P. spinulimanus (Paguridae) in New Zealand (Rainer 1981) and several unidentified pagurids and a diogenid (Dardanus sp.) in Australia (Bax et al. 2003)—and can provide substrata for other introduced (and native) species. The alteration of unconsolidated sediments, the increased predation pressure on small marine invertebrates (including recently settled individuals) due to increased hermit crabs, and possible competition with other filter feeders has had the potential to impact native species. Native screwshells in Tasmania, primarily G. gunnii, as well as commercial scallop species have declined in abundance since the appearance of M. roseus (unsubstantiated comment in Allmon et al. 1994; Caton and McLoughlin 2000), and although it is not possible to ascribe the cause of these declines to M. roseus, we cannot afford to ignore the impacts of this marine invasive species that extends over an area of the continental shelf equalling the landmass of Tasmania. Maoricolpus roseus may be the most damaging marine pest existing in Australia today. Invasion history Maoricolpus roseus was first identified in Australian waters by Greenhill (1965), who also found this species in samples collected 20 years earlier in the D’Entrecasteaux Channel by a scallop fisher, Mr John Farnell (Fig. 1). Commercial scallop fishermen surveyed in 1999 reported that M. roseus was commonly dredged from this area in 1938, when they started fishing (Bax et al. 2003). The species was not recorded during extensive dredging for molluscs in the same area and elsewhere in southern Australia before 1920 (May 1923), indicating that M. roseus entered Australia in this area in the 1920s or early 1930s. It was most likely introduced to Tasmania from New Zealand, in semi-dry ballast in timber vessels, or with live oysters. Maoricolpus roseus has slowly moved northwards in Australia, with records from Schouten Passage (central east coast of Tasmania) in 1977 (specimen held by Tasmanian Museum and Art Gallery) and Babel Island in Bass Strait in 1984 (specimen held by South Australian Museum, SAM D19059; Fig. 1). By the early 1990s, M. roseus had the greatest biomass of any other benthic invertebrate at many sampling sites out to the 80-m depth contour off the eastern

910


Victorian and southern New South Wales coasts (Bax and Williams 2001). It was found in the Port of Eden in 1996 (Hewitt et al. 1997) and Botany Bay in 1999 (W. Ponder, Australian Museum, personal communication). Maoricolpus roseus now extends across the north coast of Tasmania as far west as Smithton, but has not yet been recorded on the south or west Victorian coasts (Bax et al. 2003), despite extensive surveys in Port Phillip Bay (Hewitt et al. 2004). Importantly, and with the exception of isolated records from Cox Bight, in 1987 (Margaret Richmond, Tasmanian shell collector, personal communication), Macquarie Harbour in 2001 (Adam Davies, Aquenal Pty Ltd, personal communication) and Bathurst Harbour in 2003 (Karen Gowlett-Holmes, CSIRO, personal communication), M. roseus has not spread to the west of its point of introduction. The prevailing currents across southern Australia are predominantly west to east, thus, it is unlikely that the invasion will extend westwards without an additional (anthropogenic) vector. The vectors that originally brought M. roseus toAustralia from New Zealand against the prevailing westerly currents (Garrard 1972) have disappeared, but others have arisen to take their place. One potential vector is fishing vessels, especially scallop dredgers who have regularly reported dredging up large numbers of M. roseus. Live specimens could be carried on deck between fishing grounds or between fishing grounds and home ports, before being washed over as the decks are cleaned. Another potential vector is the ballast water of commercial ships. This vector has the potential to transfer larvae of M. roseus over longer distances than fishing vessels (e.g. from eastern to western Australia), but for this vector to pose a risk, M. roseus must have a planktonic life history, the level of risk being related to the duration of plankton life and its seasonal extent. Nested PCR was used with the M. roseus-specific gene probes to examine an existing collection of monthly plankton samples collected from the Derwent Estuary for genetic analysis (Hayes et al. 2004a). The already low risk of non-specific amplification was reduced by running two independent amplifications and confirming positive results with DNA sequencing. Since the majority of DNA extractions occurred before any M. roseus-specific PCR amplification was carried out in the laboratory, there was no plausible risk of contamination for most samples. PCR results confirmed earlier observations that M. roseus is predominantly a spring– summer (Austral) spawner, generally between October and March. Bax et al. (2003) observed trochophore and veliger larvae within egg capsules brooded by females and active bi-flagellate sperm in male screwshells between November and January, but none in March. Isotopic analysis of Allmon et al. (1994) suggested (post-larval) shell whorl formation in M. roseus began in the (austral) late winter-earliest spring. However, we also obtained positive samples in June and August, suggesting that M. roseus may have a second spawning period in autumn–winter, or that low levels of spawning


may occur year-round in different populations. It is also possible that M. roseus may have a protracted larval existence in the absence of a suitable substratum for settlement, but this needs further investigation. Although available plankton samples were insufficient to determine the relative risk posed by larvae in the water in different months of the year, they are sufficient to establish that ships could pick up M. roseus larvae while reballasting, and that spawning may occur over a wider period than previously expected. Tracking abundance of larvae in ballast water over time would indicate over what voyage duration M. roseus could be transported and discharged in a viable condition. Planktonic larvae could explain the steady northerly spread of the screwshell from the D’Entrecasteaux Channel up the Australian east coast (Fig. 1). Several other species of New Zealand origin introduced to Tasmania were initially only found in the D’Entrecasteaux Channel region (Dartnall 1967). These species include the molluscs Ruditapes largillierti, Neilo australis and Chiton glaucus, the crustaceans Petrolisthes elongatus, Metacarcinus novaezelandiae (was Cancer novaezelandiae) and Halicarcinus innominatus, the brachiopod Calloria inconspicua (was Terebratula rubicunda) and the seastars Patirella regularis and Astrostole scabra. The crustacean and the asteroid species with a protracted planktonic larval phase have become well established and widely distributed in south-eastern Australia. The similar geographical distribution of M. roseus could suggest that this species also possesses a protracted planktonic larval phase in its lifecycle. Understanding patterns of larval dispersal is critical to addressing questions of population persistence and community dynamics (Grantham et al. 2003), particularly when dispersal can be effected by both local (natural) and longdistance (mostly anthropogenic) vectors. Our lack of knowledge of basic life histories hinders our understanding of how marine communities are structured and function. This restricts our ability to predict and manage the risk of humanmediated dispersal. Other key issues of marine conservation are affected by this lack of knowledge on larval dispersal. Marine protected areas, a currently popular conservation tool in Australia (e.g. Jordan et al. 2005) would ideally be placed in areas that act as self-sustaining sources of larvae rather than sinks (Gaines et al. 2003). Predicting the impacts of future global climate change will require a sound understanding of what limits the distribution of species. The time and effort required to collect and analyse plankton samples, as well as in some cases the lack of morphological features (or taxonomic expertise) to distinguish between larval forms of related genera, can limit studies of larval dispersal. Therefore, developing genetic techniques, such as those developed here, provide a new opportunity to understand larval dispersal. Once extracted, DNA from plankton samples can be dried and stored in a stable form for many years and, as in this study, plankton samples collected for


one purpose can be rapidly reanalysed as new questions arise. In this study, we have shown that M. roseus has a planktonic life history, possibly a protracted one, and would therefore be susceptible to movement in ships’ ballast water from temperate ports along Australia’s eastern seaboard to southern and western Australia. It is surprising, given the presence of M. roseus in the Derwent Estuary since at least the 1930s (Bax et al. 2003), that it has not already been spread to other major Australian ports such as the ports of Melbourne and Geelong in Port Phillip Bay.The seastar,Asterias amurensis, thought to have arrived in the Derwent estuary from Japan in the 1980s, had already been transported to Port Phillip Bay by 1995. Although it is possible that A. amurensis may have been transported as a hull-fouling organism rather than in ships’ ballast, a major difference between the two species is their fecundity. Maoricolpus roseus is reported to carry up to 500 late stage (400 µm length) veliger larvae (Pilkington 1974), whereas A. amurensis females are capable of producing 10–25 million eggs per year (Turner 1992). The probes developed here, together with probes developed for other Australian invasive species (Deagle et al. 2003; Patil et al. 2005a, 2005b), provide the opportunity to understand how M. roseus, and other species, are spread and how we can act to limit their future impacts. Acknowledgments It is a pleasure to acknowledge the following for providing us with samples: Karen Gowlett-Holmes and Alan Williams (CSIRO Marine Research), Anthony Reid (University of Tasmania), Liz Turner (Tasmanian Museum and Art Gallery), Richard Willan (Museum & Art Gallery of the NT) and Margaret Morley and Todd Landers (Auckland Museum). Commercial fishers Hilary Reynard, Robin Sward and Greg Richie provided information on the presence of M. roseus in scallop dredges. Alison Dann provided technical assistance. This work was funded by CSIRO Marine Research and the Natural Heritage Trust of Australia, an Australian Government initiative. The results of the work were previously reported in Development of genetic probes for rapid assessment of the impacts of marine invasive species on native biodiversity—Maoricolpus roseus. That report is an independent review prepared for the Department of the Environment and Heritage by CSIRO Marine Research. The views and opinions expressed in that publication are those of the authors and do not necessarily reflect those of the Commonwealth Government or the Minister for the Environment and Heritage. The Commonwealth does not accept responsibility for the accuracy or completeness of the contents of this article, and shall not be liable for any loss or damage that may be occasioned directly or indirectly through the use of, or reliance on, the contents of this article.


911

References Allmon, W. D., Jones, D., Aiello, R. L., Gowlett-Holmes, K., and Probert, P. K. (1994). Observations on the biology of Maoricolpus roseus (Quoy and Gaimard) (Prosobranchia: Turritellidae) from New Zealand and Tasmania. The Veliger 37, 267–279. Bax, N. J., and Williams, A. (2001). Seabed habitat on the southeast Australian continental shelf—context vulnerability and monitoring. Marine and Freshwater Research 52, 491–512. Bax, N. J., McEnnulty, F., and Gowlett-Holmes, F. R. (2003). Distribution and biology of the introduced gastropod Maoricolpus roseus (Quoy and Gaimard 1834) (Prosobarnchia: Turritellidae) in Australia. Centre for Research on Introduced Marine Pests.Technical Report No. 25. CSIRO Marine Research, Hobart. Bottema, C. D. K., Sarkar, G., Cassady, J. D., Li, S., Dutton, C. M., and Sommer, S. S. (1993). Polymerase chain reaction amplification of specific alleles: a general method of detection of mutations, polymorphisms, and haplotypes. Methods in Enzymology 218, 388–402. Carlton, J.T. (1999).The scale and ecological consequences of biological invasions in the world’s oceans. In ‘Invasive Species and Biodiversity Management’. (Eds O. T. Sandlund, P. J. Schei and Å. Viken.) pp. 195–212. (Kluwer Academic Publishers: Dordrecht.) Caton, A., and McLoughlin, K. (2000). Fishery Status Reports 1999. Bureau of Rural Sciences, Agriculture, Fisheries and Forestry— Australia. Canberra. Dartnall, A. J. (1967). New Zealand marine animals from Channel waters. Tasmanian Fisheries Research 1(3), 4–5. Deagle, B. E., Bax, N., Hewitt, C. L., and Patil, J. G. (2003). Development and evaluation of a PCR based test for detection of Asterias (Echinodermata: Asteroidea) larvae in mixed plankton samples from ballast water. Marine and Freshwater Research 54, 709–719. Doyle, J. J., and Doyle, J. L. (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry Bulletin 19, 11–15. Folmer, O., Black, M., Hoeh, W., Lutz, R., and Vrijenhoek, R. (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3, 294–299. Gaines, S. D., Gaylor, B., and Largier, J. L. (2003). Avoiding current oversights in marine reserve design. Ecological Applications 13(1 Supplement), S32–S46. Garrard, T. A. (1972). A revision of Australian recent and tertiary Turritellidae (Gastropoda: Mollusca). Journal of the Malacological Society of Australia 2, 267–337. Grantham, B. A., Eckert, G. L., and Shanks, A. L. (2003). Dispersal potential of marine invertebrates in diverse habitats. Ecological Applications 13(1 Supplement), S108–S116. Greenhill, J. F. (1965). New records of marine mollusca from Tasmania. Papers and Proceedings of the Royal Society of Tasmania 99, 67–69. Hare, M. P., Palumbi, S. R., and Butman, C. A. (2000). Single-step species identification of bivalve larvae using multiplex polymerase chain reaction. Marine Biology 137, 953–961. Hayes, K. R., Sutton, C., Gunasekera, R., Sliwa, C., Migus, S., McEnnulty, F., Dunstan, P., Green, M., and Patil, J. (2004a). Empirical validation: small vessel translocation of key threatening species stage I—Asterias amurensis. CSIRO Marine Research, Hobart. Hayes, K., Sliwa, C., Migus, S., McEnnulty, F., and Dunstan, P. (2004b). National priority pests: Part II Ranking ofAustralian marine pests. An independent report undertaken for the Department of Environment and Heritage by CSIRO Marine Research, Hobart. Hewitt, C. L., Gibbs, P., Campbell, M. L., Moore, K. M., and Murfet, N. B. (1997). Introduced species survey of Eden and Twofold Bay, New South Wales. A report for the New South Wales Office of

912



Marine Affairs, CRIMP Port Survey Report Series, CSIRO Division of Fisheries, Hobart. Hewitt, C. L., Campbell, M. L., Thresher, R. E., Martin, R. B., Boyd, S., et al. (2004). Introduced and cryptogenic species in Port Phillip Bay, Victoria, Australia. Marine Biology 144, 183–202. IGA (2004). Draft intergovernmental agreement on a National System for the Prevention and Management of Marine Pest Incursions, between the Australian Government; States of New South Wales, Victoria, Queensland, South Australia, Western Australia and Tasmania; and the Northern Territory of Australia. Agreed to by the Australian Transport Council (19 November 2004) and the Natural Resources Management Ministerial Council (3 December 2004). Jordan, A., Lawler, M., Halley, V., and Barrett, N. (2005). Seabed habitat mapping in the Kent group of islands and its role in marine protected area planning. Aquatic Conservation. Marine and Freshwater Ecosystems 15, 51–70. Morton, J., and Miller, M. (1968). ‘The New Zealand Sea Shore.’ (Collins: Auckland.) Newton, C. R., Graham,A., Heptinstall, L. E., Powell, S. J., Summers, C., Kalsheker, N., Smith, J. C., and Markham, A. F. (1989). Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Research 17, 2503–2516. Patil, J. G., Hayes, K. R., Gunasekera, R. M., Deagle, B. E., McEnnulty, F., Bax, N., and Hewitt, C. L. (2004). Port of Hastings National Demonstration Project—Verification of the Type II error rate of the Ballast Water Decision Support System (DSS). Final report prepared for the Environmental Protection Authority. CSIRO Marine Research, Hobart. Patil, J. G., Gunasekera, R. M., Deagle, B. E., Bax, N. J., and Blackburn, S. I. (2005a). Development and evaluation of a PCR based assay for detection of the toxic dinoflagellate, Gymnodinium catenatum in ballast water and environmental samples. Biological Invasions 7, 983–994. Patil, J. G., Gunasekera, R. M., Deagle, B. E., and Bax, N. J. (2005b). Specific detection of the Pacific oyster (Crassostrea gigas) larvae in plankton samples using nested polymerase chain reaction. Marine Biotechnology 7, 11–20.

Pilkington, M. C. (1974). The eggs and hatching stages of some New Zealand prosobranch molluscs. Journal of the Royal Society of New Zealand 4, 411–432. Powell, A. W. B. (1931). Descriptions of some new species of recent mollusca. Records of the Canterbury Museum 3, 371–376. Powell, A. W. B. (1979). ‘New Zealand Mollusca: Marine, Land and Freshwater Shells.’ (Collins: Auckland.) Rainer, S. F. (1981). Soft-bottom benthic communities in Otago Harbour and Blueskin Bay, New Zealand. New Zealand Oceanographic Institute Memoir 80, 1–18. Rocha-Olivares, A. (1998). Multiplex haplotype-specific PCR: a new approach for species identification of the early life stages of rockfishes of the species-rich genus Sebastes Cuvier. Journal of Experimental Marine Biology and Ecology 231, 279–290. Rychlik, W. (1996). ‘OLIGO, Version 5.0 for Macintosh.’ (National Biosciences, Plymouth, MN.) Scott, R. (1997). Aspects of the biology of the introduced gastropod Maoricolpus roseus. BSc Honours thesis, Institute of Antarctic and Southern Ocean Studies, University of Tasmania, Hobart. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876–4882. Turner, E. (1992). A northern Pacific seastar, Asterias amurensis, in Tasmania. AMSA Bulletin 120, 18–19. Williams, A. (2004). RV Southern Surveyor Voyage Summary SS04/2004. CSIRO Marine Research, Hobart. Wuyts, J., De Rijk, P., Van de Peer, Y., Winkelmans, T., and De Wachter, R. (2001). The European Large Subunit Ribosomal RNA database. Nucleic Acids Research 29, 175–177.

Manuscript received 11 March 2005; revised 23 May 2005; and accepted 26 May 2005.

http://www.publish.csiro.au/journals/mfr