Sporadic methicillin resistance in community acquired ...

THE NEW MICROBIOLOGICA, 28, 327-336, 2005

Sporadic methicillin resistance in community acquired Staphylococcus aureus in Mozambique Daniela Ceccarelli1, José Mondlane2, Marco Sale3, Anna M. Salvia1, Elena Folgosa2, Piero Cappuccinelli3, Mauro M. Colombo1 1 Dipartimento di Biologia Cellulare e Sviluppo, Università di Roma, La Sapienza; Department of Microbiology, Faculty of Medicine, University E. Mondlane, Mozambique; 3 Dipartimento di Scienze Biomediche, Facoltà di Medicina, Università di Sassari

2

SUMMARY This study reports the drug resistance and clonal relationship of 24 Staphylococcus aureus community acquired isolates from patients attending Maputo Central Hospital, Mozambique, during one year (2002-2003). All the isolates produced ß-lactamase, six strains were resistant to tetracycline alone, three were resistant to erythromycin alone and one was resistant to trimethoprim-sulfamethoxazole; 11 were susceptible to all other drugs tested. Only one strain showed a multiple resistance pattern, including methicillin resistance. To investigate the clonal relationships we applied the ERIC AP-PCR and the SmaI PFGE RFLP methods. Overlapping drug resistances with these two molecular profiles, no significant correlation was obtained. The emergence of methicillin resistance in a multiple resistant strain is of great concern for resistance spreading surveillance in Mozambique. KEY WORDS - AP-PCR, PFGE RFLP, resistance, methicillin, Staphylococcus aureus, Mozambique. Received June 10, 2005

INTRODUCTION In some developing countries Staphylococcus aureus is the main cause of tropical pyomyositis that accounts for 1 to 4% of all hospital admissions and is increasingly documented in HIV infected persons. Multiresistance to drugs is an additional factor complicating treatment and it is well established that the rapid identification and antimicrobial susceptibility testing have an impact on the clinical outcome of severe infections. (Bergeron and Ouellette, 1998). Infections due to resistant S. aureus are associated with high mortality, morbidity and economic

Corresponding author Mauro Colombo Dip. Biologia Cellulare e Sviluppo Università di Roma, La Sapienza Roma e-mail: [email protected]

Accepted September 5, 2005

burden but few papers (Mahdi et al., 2000, Okesola et al., 1999) tackling this emerging problem have been published from developing countries. Today nearly all isolates worldwide are resistant to penicillin through production of ß-lactamases (Dyke and Gregory, 1997). Oxacillin-resistant S. aureus (ORSA), more commonly referred to as methicillin-resistant S. aureus (MRSA), emerged rapidly after introduction of this antibiotic. The primary route of spread of the MRSA strains was soon shown (van Belkum and Verbrugh, 2001) to be through clonal dissemination and at present, more than 50% of hospital-associated (HA) S. aureus isolates are resistant to all ß-lactam antibiotics (including methicillin and oxacillin). Methicillin resistance is caused by a specific penicillin binding protein (PBP2’) coded by mecA inducible gene, localized within a chromosomal mobile cassette designated SCCmec (de Sousa and de Lencastre, 2004.). Due to the emerging drug resistance, vancomycin is

328

D. Ceccarelli, J. Mondlane, M. Sale, A.M. Salvia, E. Folgosa, P. Cappuccinelli, M.M. Colombo

now widely utilized in therapy, at least in developed countries and the first report of vanA-mediated vancomycin-resistant S. aureus was recently published (Centers for Disease Control and Prevention, 2002). The incidence of community-acquired MRSA (CA-MRSA) strains has been also reported (Naimi et al., 2001). In contrast to HA-MRSA, these strains are commonly susceptible to the majority of othernon-ß-lactam antistaphylococcal antibiotics and have a common pulsed-field gel electrophoresis (PFGE) pattern (Fey et al., 2003). In any case, S. aureus clinical strains are frequently resistant to a variety of drugs such as tetracyclines, aminoglycosides, macrolides, lincosamides and others. PCR detection of resistance to drug genes is now widely applied to investigate the genotypic pattern of susceptibility to drugs of bacterial isolates (Cockerill, 1999, Strommenger et al., 2003). Assessment of the antimicrobial resistance genetic profile related to the clonal origin of clinical strains is extremely important in epidemiological studies and resistance surveillance. The genetic relatedness of S. aureus strains may be assessed by different molecular typing methods including, among others, pulsed-field gel electrophoresis (PFGE) of macrorestriction fragments (Ip et al., 2003, Murchan et al., 2003), arbitrarily primed PCR (AP-PCR) (Kondoh et al., 2002) phage typing, ribotyping, etc. However when these procedures are compared to set clonal relationships of isolates, strains are sometimes grouped differently according to the method used, therefore results should be carefully analyzed to achieve a reliable mapping. In this study we determine drug resistances and molecular typing of 24 community acquired S. aureus strains, isolated from patients with acute tropical pyomyositis, treated at the Surgical Service of Maputo Central Hospital, Mozambique, from 2002 to 2003.

MATERIAL AND METHODS Maputo Central Hospital is the main referral hospital in Mozambique. Its Surgery Service is the largest in the country and cres for patients mainly from Maputo Province. Symptomatic patients with pyomyosits and abscess are usually cared

for and treated as day cases. Patients included in this study had not received antibiotics before they presented at the hospital for surgical drainage, at least in the last 30 days and they referred not having had contact with a healthcare institution during the last year. From March 2002 to February 2003, pus samples of non fistulized abscess were randomly collected and sent to the Microbiology Service of Faculty of Medicine. The samples were cultured for pyogenic organisms, isolation and identification was done by standard biochemical methods. Preliminary drug resistance testing was performed by Kirby Bauer disk diffusion method. A group of 24 strains identified as community acquired S. aureus were then processed for determination of minimum inhibitory concentration (MIC, by the breakpoint method), ampicillin-sulbactam (SAM), cephalothin (CEF), ciprofloxacin (CIP), clindamycin (CLI), erythromycin (ERY), fusidic acid (FUA), gentamicin (GEN), nitrofurantoin (NIT), norfloxacin (NOR), oxacillin (OXA) (methicillin), fosfomycin (FOF), rifampin (RIF), teicoplanin (TEC), tetracycline (TET), trimethoprim-sulfamethoxazole (SXT), vancomycin (VAN) and production of ß-lactamase by automatic testing system BIO-MERIEUX VITEK. All the isolates were examined for the identity and the distribution of methicillin (oxacillin), tetracycline and erythromycin resistant genes by PCR-based detection. Bacterial strains were cultured in Luria-Bertani Broth (Tryptone 10g, Yeast extract 5g, NaCl 5g, pH 7-7.2), and DNA was extracted as suggested by Ausbel et al. (1990). Specific fragments of mecA (encoding methicillin resistance), erm(A) and erm(C) (macrolide-lincosamide-streptogramin B resistance) genes were amplified by multiplex PCR as described by Strommenger et al. (2003) and primer sequences are listed in Table 1. Amplifications were carried out in a 100-µl volume comprising approximately 40 ng of template DNA, 10 pmol of each of the primers, with a final concentration of 0.4 mM each deoxyribonucleoside triphosphate, and 5 U of Taq DNA polymerase (Promega USA) in 1x PCR buffer supplied by the manufacturer; the MgCl2 final concentration in the PCR mixture was adjusted to 4 mM. Cycling conditions: initial denaturation at 94°C for 3 min was followed by 30 cycles of amplifi-

Methicillin resistance in CA S. aureus in Mozambique

329

TABLE 1 - Genes detected by PCR and primers used in this study. Primer pair

Sequence (5’3’)

mecA 1

AAAATCGATGGTAAAGGTTGGC

mecA 2

AGTTCTGCAGTACCGGATTTGC

ermA 1

AAGCGGTAAACCCCTCTGA

ermA 2

TTCGCAAATCCCTTCTCAAC

ermC 1

AATCGTCAATTCCTGCATGT

ermC 2

TAATCGTGGAATACGGGTTTG

tetK 1

TCGATAGGAACAGCAGTA

tetK 2

CAGCAGATCCTACTCCTT

tetM 1

GTGGACAAAGGTACAACGAG

tetM 2

CGGTAAAGTTCGTCACACAC

ERIC2

AAGTAAGTGACTGGGGTGAGCG

Target gene

Amplicon size (bp)

Accession no.

Primer position

mecA

532

Y00688

1282-1303

Y00688

1814-1793

X03216

5074-5056

X03216

4885-4904

V01278

2068-2088

V01278

2365-2345

S67449

187-204

S67449

354-338

X90939

2203-2222

X90939

2608-2589

erm(A)

erm(C)

tetK

299

169

tetM

ERIC

cation with 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s and an additional cycle at 72°C for 5 min. Resistance genes to tetracycline tetK and tetM were detected by multiplex PCR as described by Ng et al. (2001) and primer sequences are listed in Table 1. Amplifications were carried out in a 100-µl volume comprising approximately 40 ng of template DNA, 125 pmol of each of the tetK primers and 50 pmol of each of the tetM primers, with a final concentration of 0.2 mM each deoxyribonucleoside triphosphate, and 5 U of Taq DNA polymerase (Promega USA) in 1x PCR buffer supplied by the manufacturer. Cycling conditions: initial denaturation at 94°C for 5 min was followed by 35 cycles of amplification with 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 1 min and 30 s and an additional cycle at 72°C for 5 min. Appropriate positive and negative S. aureus control strains were from our collection. All PCR and multiplex PCR reactions were carried out in a M. J. Research, Inc. DNA Thermal Cycler and electrophoresis of amplicons was made in 1% agarose (Biorad) gels and run in 1X Tris-Acetate-EDTA (TAE). Typing of the 22 isolates was performed by AP-

190

406

variable sequences

D83536

PCR applying ERIC primer, and PFGE of SmaI macrorestriction fragments. ERIC2 primer, described in Table 1, was utilized for AP-PCR as described by van Belkum et al. (1995) Cycling conditions: initial denaturation at 95°C for 3 min was followed by 35 cycles of amplification with 95°C for 1 min, annealing at 25°C for 1 min, extension at 72°C for 1 min and an additional cycle at 72°C for 5 min. AP-PCR reactions were carried out in a HYBAID DNA Thermal Cycler and electrophoresis of amplicons was made in 1.5% agarose (Biorad) gels and run in 0,5X Tris-Borate-EDTA (TBE). M.W. marker was 1 kb Plus Ladder, SIGMA. Bacteria for PFGE DNA analysis were cultured in nutrient broth overnight up to 0.3 Mc Farland unit at 580 nM, 5ml were pelleted, washed and resuspended in 0.5 ml of PET IV (Tris-HCL 10 mM, Nacl 1M, EDTA 50 mM). The bacterial suspension was mixed with an equal volume of a 2.5% low-melting-point agarose (Bio-Rad) and poured into the block molds. Blocks were suspended in lysis buffer (containing lysozyme 1 mg/ml and lysostaphin 100 µg/ml) for 2 h at 37°C. After removing the lysis buffer, blocks were resuspended in ESP (EDTA 0.5 M, sodium lauroyl sarcosine 1 mg/ml, containing

330


proteinase K 1 mg/ml) solution, at 56°C overnight. ESP solution was replaced by Tris EDTA (TE) buffer supplemented with PMSF (phenylmethylsulfonylfluoride) at 15 µl/ml and incubated at room temperature for 30 min; this washing step was repeated twice and replaced with fresh TE for storage of plugs at 4°C (Mathusek, 1996). Restriction digestions of plugs were made in the manufacturer’s recommended restriction buffer and 20 U of SmaI enzyme (Gibco). The digested DNA was electrophoresed in a 1% agarose with a CHEF-III (Bio-Rad) apparatus h at 180 V with two steps of switching times for 11 h each: 1st step ramped from 7 to 12 s and 2nd ramped from 20 to 40 s. M.W. marker was 50-1000 kb lambda concatemer, SIGMA.

RESULTS This study of resistance to drugs included 24 isolates of community acquired Staphylococcus aureus (CA-SA). Preliminary drug susceptibility testing, by Kirby Bauer technique, was for drugs used in post surgical antibiotic therapy. Then, to better define the antibiotic resistance profiles, each strain was submitted to MIC determination and results are reported in Table 2. All the isolates produced β-lactamase (100%) and 11 (46%) were susceptible to all the drugs tested, including two sibling clones, SAM 62a and b, isolated from different samples in the same patient. None of the isolates were resistant to ciprofloxacin, clindamycin, fosfomycin, fusidic acid, nitrofurantoin, norfloxacin, teicoplanin or vancomycin. Eight strains were resistant to tetracycline (33%), four were resistant to erythromycin (16%) and one (SAM76) was resistant to trimethoprim-sulfamethoxazole (4%). Only one strain SAM7 showed resistance to methicillin (oxacillin) and was also resistant to other drugs: ampicillin-sulbactam, cephalothin, erythromycin, gentamicin, methicillin, rifampin, tetracycline, trimethoprim-sulfamethoxazole. In three patients two samples were collected from different sites: one patient gave identical isolates (SAM62a and b); two other patients gave both susceptible and resistant clones to tetracycline (SAM58a and b) and trimethoprim-sulfamethoxazole (SAM76a and b) respectively.

According to the resistance profile three main groups of strains were identified: susceptible to drugs (S), resistant to tetracycline (T), resistant to erythromycin (E). Two isolates shown a unique profile (U) (Table 2). The identity of the resistance genes, and their correlation with resistance expression were investigated in all the isolates, to better characterize the resistance profile. PCR testing was applied for the detection of erythromycin, tetracycline and methicillin resistant genes, respectively: ermA and ermC, tetK and tetM, and mecA; we restricted the molecular screening to these genes since they are reported to be prevalent in S. aureus. The results of this screening are shown in Figure 1 (10 representative isolates) and Table 2. The group T (tetracycline resistant strains) possessed the tetK active efflux gene; the multiple resistant strain SAM7 was characterized by the presence of the tetM ribosomal protection gene, the ermC rRNA methylase gene and the mecA. All isolates of group E (erythromycin resistant) harbored ermC gene. Repeated mating experiments (data not shown) with representative strains of different resistance profiles, including SAM7, gave no results and we concluded that no conjugative plasmids are associated with these. Clonal relationship is of great concern for epidemiological studies, therefore genomic typing was performed for 22 isolates out of 24. Since literature reports the need to overlap different molecular profiles to ascertain a reliable typing, we utilized the ERIC AP-PCR and the SmaI PFGE RFLP methods, for their effective and easy application. Results are shown in figures 2 and 3 and table 2. The AP-PCR method identified two groups named 1 (14 isolates) and 2 (5 isolates), characterized by specific conserved profiles. Among group 2, the strain SAM6 showed the substitution of the conserved 400 bp fragment with a 500 bp fragment (Fig. 2, lane 4). AP-PCR also defined three unique profiles and SAM58b isolate (Fig. 2, lane 13) showed minor alterations of the 350 and 260 bp fragments compared with tetracycline resistant SAM58a isolate (Fig. 2, lane 12). The PFGE RFLP method revealed nine unique profiles and three groups named A (6 isolates), B (3 isolates), and C (3 isolates). Group B included three susceptible strains and its RFLP com-


331

TABLE 2 - Resistance profile, PCR detected resistant genes and molecular group typing of S. aureus isolates under study. Strain

Resistance profile

MIC (mg/l)

Resistant gene

SAM2

Resistance groupc

E-AP-PCR group

PFGE group

S

U

U

SAM3

TET

16

tetK

T

2

C

SAM4

ERY

8

ermC

E

1

A

SAM6

ERY

8

ermC

E

2

A

SAM7

AMP

32

U

1

U

CEF

32

ERY

8

GEN

16

OXA

8

RIF

4

TET

16

SXT

160

SAM 9

ERY

8

ermC

E

ND

ND

SAM11

TET

16

tetK

T

1

A

SAM12

TET

16

tetK

T

1

A

SAM15

S

1

A

SAM18

S

2

U

SAM19

S

1

A

SAM23

S

1

B

T

U

U

S

U

U

T

2

C

SAM62a

S

1

U

SAM62bb

S

1

U

T

1

U

U

1

U

SAM76ba

S

1

U

SAM77

S

1

B

SAM78

S

1

B

SAM79

S

2

C

T

ND

ND

SAM58a

TET

16

ermC

mecA

tetM

tetK

SAM58ba SAM61

TET

16

SAM63

TET

16

SAM76a

SXT

160

SAM80

TET

16

tetK

tetK

tetK

Susceptible clone. bSibling clone. cE: erythromycin; S: susceptible; T: tetracycline; U: unique ND: not determined. AMP, ampicillin; CEF, cephalothin; ERY, erythromycin; GEN, gentamicin; OXA, oxacillin; RIF, rifampin; SXT, trimethoprim-sulfamethoxazole; TET, tetracycline a


332

A

B

This was also confirmed by the susceptible variant of SAM 76: its molecular type, 1/U, was identical to the corresponding resistant clone type. Matching AP-PCR and PFGE RFLP typing, three major groups were revealed: 1A (5 isolates), 1B (3 isolates) and 2C (3 isolates). SAM7 methicillin resistant isolate and SAM76 cotrimoxazole resistant isolate belonged to the AP-PCR group 1 and showed unique PFGE profiles.

DISCUSSION FIGURE 1 - PCR detection of resistant genes in a sample of isolates. (A) ermC (lane 1) and mecA (lane 2) detection in SAM7 isolate. Lane M1, 100bp DNA ladder Plus. (B) detection of tetK and tetM: lane M2 123 bp DNA ladder; lanes 1 to 8, SAM2, SAM15 (negative), SAM3, SAM11, SAM61, SAM63, SAM80 (tetK positive) and SAM7 (tetM positive), respectively.

mon profile (represented by SAM78) showed additional fragments: 400 Kb in SAM23 and 500 Kb in SAM77 respectively (see figure 3, lanes 8 and 20). Overlapping drug resistance with AP-PCR and PFGE RFLP genotyping showed no significant correlation between drug resistance groups and any specific molecular profile obtained with the two typing methods.

This is the first survey of antibiotic resistance in community acquired S. aureus infections in Mozambique and, although the number of samples is limited (n = 24), it yields interesting information on the emergence and circulation of resistance in southern Africa. Surveillance of antibiotic resistance in key microorganisms, such as S. aureus clinical isolates, should be of great concern in developing countries, where patients often suffer immunodepression and/or malnutrition and a correct antibiotic therapy is sometimes difficult to be achieved. Infection of vulnerable patients may constitute a favorable condition for the emergence of new resistance patterns in pathogenic bacterial strains. This research, conducted in a

FIGURE 2 - AP PCR profiles. Lanes 1 to 22, strains SAM2, SAM3, SAM4, SAM6, SAM7, SAM11, SAM12, SAM15, SAM18, SAM19, SAM23, SAM58a, SAM58b, SAM61, SAM62a, SAM62b, SAM63, SAM76a, SAM76b, SAM77, SAM78 and SAM79, respectively. Lane M, 1Kb plus DNA ladder. Arrow in lane 4 indicates the position of an additional 500 bp fragment in SAM6 (group 2 profile). Arrow in lane 13 indicates a banding alteration of 350 and 260 bp fragments, in susceptible SAM58b compared with SAM58a (unique profiles).


333

FIGURE 3 - PFGE RFLP. Lanes 1 to 22, strains, SAM2, SAM3, SAM4, SAM11, SAM15, SAM18, SAM19, SAM23, SAM6, SAM7, SAM12, SAM58a, SAM58b, SAM61, SAM62a, SAM62b, SAM63, SAM76a, SAM76b, SAM77, SAM78 and SAM79, respectively. Lane M Pulse Marker 50-1,000 Kb. Arrows in lane 8 and 20 indicate respectively additional 400 and 500 kb fragments in of SAM23 and SAM77 (group B profile).

group of patients with community acquired S. aureus tropical pyomyositis, shows a situation of low level concern compared with data obtained by other authors in tropical settings. In fact only resistance to penicillin is present in all the strains and this is not surprising due to the wide use of such antibiotic. In a study conducted in Zimbabwe in 1991, Mason et al. (1991) reported that penicillin resistant strains occurred more frequently in specimens from the Mozambique border areas, indicating a probable widespread resistance in that country; therefore our results, concerning the situation in Mozambique ten years later, are not unexpected. Erythromycin and to some extent tetracycline, used for treatment of this type of infections, showed 8% and 33% resistance, respectively. Higher resistance diffusion rates to these drugs are reported in several African countries, although with a certain variability and a general trend of increasing through the years (Amir et al., 1995, Tenssay, 2000, Urassa et al., 1999). Among our isolates, only one showed multiple resistance to antimicrobial agents, including methicillin: this is evidence of a situation of epidemiological transition in the area, that needs further monitoring. The emergence of methicillin-resistance in a community is of great con-

cern and basically arises in two different ways: hospital strains may be carried in a community and then spread from person to person (Salgado et al., 2003) or may spontaneously originate in the community from the acquisition of resistant genes by susceptible strains (Okuma et al., 2002). However the origin of our MRSA it is not clear. Apparently, the patient carrying the methicillin resistant strain did not report any contact with a healthcare institution during the last year, a strong risk factor for CA-MRSA, although other findings point toward the hospital origin of the isolate. Additional molecular studies on the genetics of SSCmec element (Charlebois et al., 2004) and the comparison with hospital MRSA isolates will be needed to solve this problem. MRSA have been present in South Africa since the seventies (Scragg et al., 1978) and an increasing spread in many countries has been reported; however our study did not reveal a higher incidence in Mozambique. Two mechanisms of resistance to tetracyclines have been identified in Staphylococcus spp.: (i) active efflux resulting from acquisitionof the plasmid-located genes, tetK and tetL, and (ii) ribosomal protection mediated by tetM or tetO determinants (Trzcinski et al., 2000). We found the tetK

334


gene in all resistant strains except the multiresistant SAM7 isolate, that harbored the tetM gene. This finding enhances the specific resistance profile of SAM7. This is not unusual since tetK and tetM are the most frequently found resistance genes in Staphylococcus with different relative distributions in humans and animals (Roberts, 1996, Schmitz et al., 2002). All our erythromycin resistant strains harbored the erm(C) gene. This gene is not rare in resistant clinical isolates that may also possess the erm(A) gene coding for rRNA methylases. In this study no resistance to macrolides due to N6dimethylation of the adenine at position 2058 of 23S rRNA, present in the vast majority of S. aureus isolates, was found (Schmitz et al., 2002). Pulsed field electrophoresis is a method of high reproducibility and resolving power, however, it is a time consuming procedure that needs specifically trained personnel and equipment, difficult to achieve in a tropical setting (Chiou et al., 2000). More simple methods such as fingerprinting generated by PCR random amplification of polymorphic DNA or hypervariable specific regions have been used in several studies (Stranden et al., 2003), although their reproducibility and discriminative power appear to be lower than PFGE. Our results confirm a lower discrimination of the AP-PCR with only two epidemiological groups identified, in comparison with three groups and several unique profiles of PFGE. However SAM58 susceptible and resistant to tetracycline variants were revealed by AP-PCR technique only. Generally no significant correlation of drug resistance patterns with molecular genotyping was ascertained. This may be due to the limited number of isolates and to the type of samples, taken from patients coming from different areas, instead of hospital infections that generally harbor less variable strains of S. aureus. These findings suggest a population of genetically unrelated staphylococci. In addition, molecular typing and particularly PFGE gives highly reliable results when it is applied to the molecular epidemiology of MRSA, while pattern correlation with other type of antibiotic resistance appears to be more disputable (Mangeney et al., 2002). This study shows that the majority of S. aureus, isolated from community acquired infections in Mozambique, are still rather sensitive to many of the drugs employed as treatment in develop-

ing countries. However, the emergence of methicillin resistance in a multiple resistant strain is of great concern and needs further monitoring and surveillance.

ACKNOWLEDGEMENTS We thank Dr. L. Péntek, Dep. Cirurgia, Dr. I. R. Domingos, Serv. Cirurgia Pediátrica, and Maputo Central Hospital staff for assistance in patient selection and sample collection, and Dr. Rajni Gaind for useful discussions; D. Manjate and C. Rasi for technical help. This project was supported by grants from the University Program of the General Directorate for Cooperation and Development of MAE, Italy, Sardinia Regional Government and MURST-COFIN. D. Ceccarelli was supported by “Cellular and Developmental Biology” Doctorate fellowship, Dip. Biologia Cellulare e Sviluppo, Univ. Roma, La Sapienza.

REFERENCES AMIR, M., J. PAUL, B. BATCHELOR, S. KARIUKI, J. OJOO, P. WAIYAKI, AND C. GILKS. (1995). Nasopharyngeal carriage of Staphylococcus aureus and carriage of tetracycline-resistant strains associated with HIVseropositivity. Eur. J. Clin. Microbiol. Infect. Dis. 14, 34-40. AUSBEL, F.M., R. BRENT, R.E. KINGSTON, D.D. MOORE, J.G. SEIDMAN, J.A. SMITH, AND K. STRUHL. (1990). Purification and concentration of DNA from aqueous solution. In Current Protocols in Molecular Biology. Greene Publishing Associates and Wiley Interscience, New York, pp. 2.1.1-2.1.5. BERGERON, M.G., AND M. OUELLETTE. (1998). Preventing antibiotic resistance through rapid genotypic identification of bacteria and of their antibiotic resistance genes in the clinical microbiology laboratory. J. Clin. Microbiol. 36, 21692172. CENTERS FOR DISEASE CONTROL AND PREVENTION. (2002). Staphylococcus aureus resistant to vancomycin-United States. Morb. Mortal. Wkly. Rep. 51, 565-567. CHARLEBOIS, E.D., F. PERDREAU-REMINGTON, B. KREISWIRTH, D.R. BANGSBERG, D. CICCARONE, B.A. DIEP, V.L. NG, K. CHANSKY, AND H.F. CHAMBERS. (2004). Origins of community strains of methicillinresistant Staphylococcus aureus. Clin. Infect. Dis. 39, 47-54. CHIOU, C.S., H.L. WEI, AND L.C. YANG. (2000). Comparison of pulsed-field gel electrophoresis and coagulase gene restriction profile analysis tech-


niques in the molecular typing of Staphylococcus aureus. J. Clin. Microbiol. 38, 2186-2190. COCKERILL, F.R. 3rd. 1999. Genetic methods for assessing antimicrobial resistance. Antimicrob. Agents Chemother. 43, 199-212. DE SOUSA, M.A., AND H. DE LENCASTRE. 2004. Bridges from hospitals to the laboratory: genetic portraits of methicillin-resistant Staphylococcus aureus clones. FEMS Immunol. Med. Microbiol. 40, 101111. DYKE, K., AND P. GREGORY. (1997). Resistance to betalactam antibiotics: resistance mediated by beta-lactamases. In: K.B. Crossley and G.L. Archer (ed), The staphylococci in human disease. Churchill Livingstone, New York, 123-145. FEY, P.D., B. SAID-SALIM, M.E. RUPP, S.H. HINRICHS, D.J. BOXRUD, C.C. DAVIS, B.N. KREISWIRTH, AND P.M. SCHLIEVERT. (2003). Comparative molecular analysis of community - or hospital-acquired methicillinresistant Staphylococcus aureus. Antimicrob. Agents Chemother. 47, 196-203. IP, M., D.J. LYON, F. CHIO, M.C. ENRIGHT, AND A.F. CHENG. (2003). Characterization of isolates of methicillinresistant Staphylococcus aureus from Hong Kong by phage typing, pulsed-field gel electrophoresis, and fluorescent amplified-fragment length polymorphism analysis. J. Clin. Microbiol. 41, 49804985. KONDOH, K., D. FURUYA, A. YAGIHASHI, N. UEHARA, M. NAKAMURA, D. KOBAYASHI, N. TSUJI, AND N. WATANABE. (2002). Comparison of arbitrarily primed-polymerase chain reaction and pulse-field gel electrophoresis for characterizing methicillinresistant Staphylococcus aureus. Lett. Appl. Microbiol. 35, 62-67. MAHDI, S.E., A.O. AHMED, H. BOELENS, A. OTT, E.S. ABUGROUN, A. VAN BELKUM, E. ZIJLSTRA, H. VERBRUGH, AND A. FAHAL. (2000). An epidemiological study on the occurrence of Staphylococcus aureus in superficial abscesses of patients presenting for surgery in a teaching hospital in Khartoum, Sudan. FEMS Immunol. Med. Microbiol. 29, 155-162. MANGENEY, N., K. DROLLEE, V. CLOITRE, M. BORDES, E. FAUBERT, AND C. DUPEYRON. (2002). Comparative pulsed-field gel electrophoresis typing of gentamicin-resistant and susceptible methicillin-resistant Staphylococcus aureus strains isolated in France between 1991 and 1998. Changes in antibiotic susceptibility. J. Hosp. Infect. 51, 262-268. MASON, P.R., I. KITAI, AND S. CHIGONDE. (1991). Community acquired staphylococcal skin infections in rural areas of Zimbabwe. Cent. Afr. J. Med. 37, 56-60. MATHUSEK, M.G., M.J. BONTEN, AND M.K. HAYDEN. 1996. Rapid preparation of bacterial DNA for pulse-field gel electrophoresis. J. Clin. Microbiol. 34, 25982600.

335

MURCHAN, S., M.E. KAUFMANN, A. DEPLANO, R. DE RYCK, M. STRUELENS, C.E. ZINN, V. FUSSING, S. SALMENLINNA, J. VUOPIO-VARKILA, N. EL SOLH, C. CUNY, W. WITTE, P.T. TASSIOS, N. LEGAKIS, W. VAN LEEUWEN, A. VAN BELKUM, A. VINDEL, I. LACONCHA, J. GARAIZAR, S. HAEGGMAN, B. OLSSON-LILJEQUIST, U. RANSJO, G. COOMBES, AND B. COOKSON. (2003). Harmonization of pulsed-field gel electrophoresis for epidemiological typing of methicillin-resistant Staphylococcus aureus by consensus in 10 European centers and its use to plot the spread of related strains. J. Clin. Microbiol. 41, 1574-1585. NAIMI, T.S., K.H LEDELL, D.J. BOXRUD, A.V. GROOM, C.D. STEWARD, S.K. JOHNSON, J.M. BESSER, C. O’BOYLE, R.N. DANILA, J.E. CHEEK, M.T. OSTERHOLM, K.A. MOORE, AND K.E. SMITH. (2001). Epidemiology and clonality of community-acquired methicillinresistant Staphylococcus aureus in Minnesota, 19961998. Clin. Infect. Dis. 33, 990-996. NG, L.K., I. MARTIN, M. ALFA, AND M. MULVEY. (2001). Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes. 15, 209-215. OKESOLA, A.O., A.A. ONI, AND R.A. BAKARE. (1999). Nosocomial infections: methicillin resistant Staphylococcus aureus in wound infection in Ibadan, Nigeria. Afr. J. Med. Med. Sci. 28, 55-57. OKUMA, K., K. IWAKAWA, J.D. TURNIDGE, W.B. GRUBB, J.M. BELL, F.G. O’BRIEN, G.W. COOMBS, J.W. PEARMAN, F.C. TENOVER, M. KAPI, C. TIENSASITORN, T. ITO, AND K. HIRAMATSU. (2002). Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. J. Clin. Microbiol. 40, 4289-4294. ROBERTS, M.C. (1996). Tetracycline resistance determinants: mechanisms of action, regulation of expression, genetic mobility, and distribution. FEMS Microbiol. Rev. 19, 1-24. SALGADO, C.D., B.M. FARR, AND D.P. CALFEE. (2003). Community-acquired methicillin-resistant Staphylococcus aureus: a meta-analysis of prevalence and risk factors. Clin. Infect. Dis. 36, 131-139. SCHMITZ, F.J., J. PETRIDOU, H. JAGUSCH, N. ASTFALK, S. SCHEURING, AND S. SCHWARZ. (2002). Molecular characterization of ketolide-resistant erm(A)-carrying Staphylococcus aureus isolates selected in vitro by telithromycin, ABT-773, quinupristin and clindamycin. J. Antimicrob. Chemother. 49, 611-617. SCRAGG, J.N., P.C. APPELBAUM, AND D.A. GOVENDER. (1978). The spectrum of infection and sensitivity of organisms isolated from African and Indian children in a Durban hospital. Trans. R. Soc. Trop. Med. Hyg. 72, 325-328. STRANDEN, A., R. FREI, AND A.F. WIDMER. (2003). Molecular typing of methicillin-resistant Staphylococcus aureus: can PCR replace pulsedfield gel electrophoresis? J. Clin. Microbiol. 41, 3181-3186. STROMMENGER, B., C. KETTLITZ, G. WERNER, AND W.J.

336


WITTE. (2003). Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus. Clin. Microbiol. 41, 4089-4094. TENSSAY, Z.W. (2000). Staphylococci: frequency of isolation and antibiotic susceptibility patterns in Jimma Hospital, south-west Ethiopia. Ethiop. Med. J. 38, 175-184. TRZCINSKI, K., B.S. COOPER, W. HRYNIEWICZ, AND C.G. DOWSON. (2000). Expression of resistance to tetracyclines in strains of methicillin-resistant Staphylococcus aureus. J. Antimicrob. Chemother. 45, 763-770.

URASSA, W.K., E.A. HAULE, C. KAGOMA, AND N. LANGELAND. (1999). Antimicrobial susceptibility of Staphylococcus aureus strains at Muhimbili Medical Centre, Tanzania. East. Afr. Med. J. 76, 693695. VAN BELKUM, A., AND H. VERBRUGH. (2001). 40 years of methicillin resistant Staphylococcus aureus. BMJ. 323, 644-645. VAN BELKUM, A., J. KLUYTMANS, W. LEEUWEN, R. BAX, W. QUINT, AND E. PETERS. (1995). Multicenter evaluation of arbitrarily primed PCR for typing of Staphylococcus aureus strains. J. Clin. Microbiol. 33, 1537-1547.