Sprouting angiogenesis is regulated by ... - The FASEB Journal

The FASEB Journal article fj.201500122R. Published online March 3, 2016. THE

JOURNAL

• RESEARCH •

www.fasebj.org

Sprouting angiogenesis is regulated by shedding of the C-type lectin family 14, member A (CLEC14A) ectodomain, catalyzed by rhomboid-like 2 protein (RHBDL2) Peter J. Noy, Rajeeb K. Swain,1 Kabir Khan, Puja Lodhia, and Roy Bicknell2 Angiogenesis Laboratory, Institutes for Cardiovascular Sciences and Biomedical Research, College of Medical and Dental Sciences, University of Birmingham, Birmingham, United Kingdom

C-type lectin family 14, member A (CLEC14A), is a single-pass transmembrane glycoprotein that is overexpressed in tumor endothelial cells, and it promotes sprouting angiogenesis and modulates endothelial function via interactions with extracellular matrix proteins. Here, we show that CLEC14A is cleaved by rhomboidlike protein 2 (RHBDL2), one of 3 catalytic mammalian rhomboid-like (RHBDL) proteases, but that it is not cleaved by RHBDL1 or -3. Site-directed mutagenesis identified the precise site at which RHBDL2 cleaves CLEC14A, and targeted, small interfering RNAs that knockdown endogenous CLEC14A and RHBDL2 in human endothelial cells validated the specificity of CLEC14A shedding by RHBDL2. Loss of endogenous cleaved CLEC14A increased endothelial migration 2-fold, whereas that addition of recombinant cleaved CLEC14A inhibited the sprouting of human and murine endothelial cells 3-fold in several in vitro models. We assessed the in vivo role of cleaved CLEC14A in angiogenesis by using the rodent subcutaneous sponge implant model, and we found that CLEC14A protein inhibited vascular density by >50%. Finally, we show that cleaved CLEC14A binds to sprouting endothelial tip cells. Our data show that the ectodomain of CLEC14A regulates sprouting angiogenesis and suggests a role for RHBDL2 in endothelial function.—Noy, P. J., Swain, R. K., Khan, K., Lodhia, P., Bicknell, R. Sprouting angiogenesis is regulated by shedding of the C-type lectin family 14, member A (CLEC14A) ectodomain, catalyzed by rhomboidlike 2 protein (RHBDL2). FASEB J. 30, 000–000 (2016). www.fasebj.org

ABSTRACT:

KEY WORDS:

anti-angiogenic therapy

•

rhomboid substrates

Angiogenesis is a process that is critical for embryonic development, reproduction, and during healing. Physiologic angiogenesis is a tightly regulated event that balances pro- and anti-angiogenic signals, but these signals become skewed during disease. Dysregulated angiogenesis plays an important role in several diseases, in particular, in cancer progression but also during atherosclerosis, diabetic retinopathy, psoriasis, and arthritis (1). It is essential for future therapeutic targeting that we understand the molecular mechanisms that underlie angiogenesis (2). ABBREVIATIONS: CLEC14A, C-type lectin family 14, member A; CM, cul-

tured media; CTLD, C-type lectin domain; CYTO, cytoplasmic domain; ECD, extracellular domain; EGF, epidermal growth factor; EGFL, epidermal growth factor–like domain; GFP, green fluorescent protein; HA, hemagglutinin; HRP, horseradish peroxidase; ML1, mucin-like domain C-terminal half; ML2, mucin-like domain N-terminal half; MMRN2, multimerin-2; qPCR, quantitative PCR; RHBDL, rhomboid-like; RHBDL2, rhomboid-like 2 protein; siRNA, small interfering RNA; SL, sushi-like domain; WC, whole cell 1 2

Current affiliation: Institute for Life Sciences, Bhubaneswar, India. Correspondence: Angiogenesis Laboratory, Institute for Biomedical Research, The Medical School, University of Birmingham, Edgbaston, Birmingham B15 2TT, United Kingdom. E-mail: [email protected]

doi: 10.1096/fj.201500122R

0892-6638/16/0030-0001 © FASEB

•

multimerin 2

•

mmrn2

C-type lectin family 14, member A (CLEC14A) was identified as a tumor endothelial marker, with high expression on vessels across multiple tumor types (3). Subsequent studies have shown that CLEC14A regulates endothelial cell function, with roles in endothelial cell migration, tube formation, and the control of sprouting angiogenesis in vitro and in vivo (3–6). Recent work has identified interactions with the extracellular matrix via multimerin-2 (MMRN2), and this interaction can be targeted and blocked with specific antibodies to inhibit sprouting angiogenesis and tumor growth (7). CLEC14A is 1 of 4 members of the C-type lectin-like domain family 14, the others being thrombomodulin, CD93, and endosialin/ CD248 (8). Two of the four, thrombomodulin and CD93, are known to shed their extracellular domain (ECD). Soluble ECDs can be detected in patient serum or plasma and are associated with inflammation and coronary artery disease in CD93, or are elevated in patients with colorectal, pancreatic, or bladder cancer in thrombomodulin (9–12). The functional role of the soluble ECDs of thrombomodulin and CD93 have been examined in in vitro and in vivo angiogenic assays. These studies show that the 1

epidermal growth factor (EGF)–like domains (EGFLs) of thrombomodulin have strong proangiogenic properties but are anti-angiogenic when the C-type lectin domain (CTLD) is present (13, 14). In contrast, the ECD of CD93 has been shown to promote endothelial proliferation and migration but also has roles in monocyte differentiation (15, 16). Rhomboid was first discovered in Drosophila, in which gene knockout gave rise to head skeleton abnormalities (17). Rhomboid is a proteolytic enzyme embedded within the plasma membrane. There are 3 rhomboid-like orthologs in man (RHBDL1, -2, and -3) that by homology appear to have proteolytic active sites, and 2 other catalytically inactive rhomboid family members (RHBDF1 and -2) also exist in man. In Drosophila, rhomboid cleaves EGF and is an essential component of EGF receptor developmental signaling. Surprisingly, at the time of the discovery of rhomboid, this function in mammals was known to be performed by A Disintegrin and Metalloprotease metalloproteases (18). Subsequent work has confirmed that RHBDL2 also cleaves EGF in mammals (19), although this maybe redundant with A Disintegrin and Metalloprotease shedding (20). To date, few unique substrates have been identified for vertebrate rhomboids. Though a notable exception is the shedding of the ECD of thrombomodulin, a known homolog of CLEC14A, by RHBDL2 (21). In view of the close sequence homology between thrombomodulin and CLEC14A, we examined whether CLEC14A is also a rhomboid substrate. Here, we show that, like thrombomodulin, CLEC14A is proteolytically cleaved by RHBDL2 but not by RHBDL1 or -3. We also examine the functional consequences of RHBDL2-mediated shedding of CLEC14A and show that the CLEC14A ectodomain has a potent role in the regulation of sprouting angiogenesis. MATERIALS AND METHODS Reagents The following primary antibodies were used for Western blotting and immunoprecipitation: sheep polyclonal anti-human CLEC14A (R&D Systems, Minneapolis, MN, USA), mouse monoclonal anti-hemagglutinin (HA; CRUK, cl. 12CA5), mouse monoclonal anti–green fluorescent protein (GFP; CRUK, cl. 3E1), mouse monoclonal anti-tubulin (NeoMarkers, cl. DM1A), mouse monoclonal anti-myc (NEB, cl. 9E10), and goat polyclonal anti-Fc conjugated to horseradish peroxidase (HRP; Sigma-Aldrich, St. Louis, MO, USA); as well as the following secondary antibodies: goat polyclonal anti-mouse IgG conjugated to HRP (Dako, Carpinteria, CA, USA) and donkey polyclonal anti-sheep IgG conjugated to HRP (R&D Systems). For immunofluorescence, we used the following primary antibodies: BS-1 lectin (isolectin-B4) conjugated to tetramethylrhodamine (Sigma-Aldrich) and goat polyclonal anti-Fc conjugated to FITC (Sigma-Aldrich). For flow cytometry, we used the following primary antibodies: mouse monoclonal anti-HA tag (CRUK, cl. 12CA5), and for secondary antibodies, goat polyclonal anti-mouse IgG conjugated to Alexa Fluor 488 (Invitrogen, Carlsbad, CA, USA). Plasmids pCS2 HA-hCLEC14A (3) was used as a template to generate the CLEC14A domain deletions. Domain-deletion PCR (22) was 2

Vol. 30

June 2016

used to delete the CTLD, sushi-like domain (SL), EGFL, mucinlike domain C-terminal half (ML1), mucin-like domain N-terminal half (ML2), and cytoplasmic domain (CYTO). After PCR amplification of plasmid DNA, the template DNA was digested with Dpn1. The following primers were used (with their reverse complement primer): CTLD: 59-GCCGACCGTGCTGGCTGCTACCAGTTTGAGGTCTTG-39; SL: 59-AACGGCTACCTGTGCAAGTGCCCCGGGAGGTACCTC-39; EGFL: 59GGCGATGTGTTGTGTCCCACCAGTGGGGAAGGACAG-39; ML1: 59GACGGCCGCTCTTGTGTGGAGATTCCTCGATGGGGA-39; ML2: 59-TCAGTAACATCTATTCCTTTCATATTTGTGAGCACA-39; and CYTO: 59-GTACTGGGGCTTGTCAAGTAGGAATTCAAGGCCTCT-39. pCS2 HA-hCLEC14A SS395,396DD and pCS2 HA-hCLEC14A IS370,373DD was generated by site-directed mutagenesis with the following primers (with their reverse complement primer): SS395,396DD: 59-CACTCCTCAGGCTTTCGACTCCGACGATGCCGTGGTCTTCATATTTGTG-39; and IS370,373DD: 59-CCTTCAAGCCGAGTCAAAGGCCACTGACACCCCAGATGGGAGCGTGATTT-39. For pEGFPn1 HA-hCLEC14A, first pEGFPn1 hCLEC14A was generated by PCR from a hCLEC14A IMAGE clone (Origene, Rockville, MD, USA), EcoR1 sites were introduced at the 59 and 39 ends of the fragment and cloned into this site in the pEGFP-n1 plasmid (Clontech, Mountain View, CA, USA) to make the C-terminally EGFP-tagged construct. Then EcoN1 and PshA1 digest fragments of pCS2 HAhCLEC14A and pEGFPn1 hCLEC14A were used to insert the N-terminal HA tag fragment of CLEC14A into the pEGFPn1 hCLEC14A backbone vector. RHBDL constructs were a gift from Prof. Freeman (University of Oxford) and have been previously described (21, 23). pcDNA3.1 Myc-RHBDL2 was cloned from keratinocyte cDNA with HindIII and XbaI restriction sites introduced at the 59 and 39 ends of the fragment, respectively, before cloning into the pcDNA3.1 Myc-His vector. For protein production, lentiviral plasmids psPAX2 (lentiviral packaging; Addgene, Cambridge, MA, USA), pMD2G (Envelope plasmid; Addgene), and pWPI hCLEC14A-ECD-Fc (lentiviral mammalian expression plasmid containing IRES-EGFP; Addgene) or pWPI mCLEC14A-ECD-Fc were used. In brief, pWPI hCLEC14A-Fc and mCLEC14A-Fc were generated by initial PCR subcloning from a clec14a IMAGE clone (Origene) into pcDNA3hFc plasmid to fuse to a human Fc tag. A further round of PCR subcloning was performed to transfer the CLEC14A-Fc fusion into pWPI (7).

Cell culture HUVEC cells were isolated as previously described (3). Umbilical cords were sourced from Birmingham Women’s Health Care NHS Trust and obtained with mothers’ consent. Functional HUVEC assays were performed between passages 1 and 4 and were cultured in M199 complete medium (cM199) that contained 10% fetal calf serum (PAA Laboratories, Pittsburgh, PA, USA), 1% bovine brain extract (24), 90 mg/ml heparin, and 4 mM L-glutamine, 100 U/ml penicillin, and 100 mg/ml streptomycin (Invitrogen), and were seeded on plates coated in 0.1% type 1 gelatin from porcine skin. HEK293T cells were cultured in DMEM (SigmaAldrich) complete medium that contained 10% fetal calf serum (PAA Laboratories), 4 mM L-glutamine, 100 U/ml penicillin, and 100 mg/ml streptomycin (Invitrogen). Small interfering RNA (siRNA) transfections in HUVEC were performed as previously described (3). In addition to the clec14a siRNA duplexes, the following were used: rhbdl2 siRNA 1: 59GAGGAAGCCTGGAGGTTTA39; and rhbdl2 siRNA 2: 59CGAAAAGTCCCGAGGAACA39. Control and custom siRNA duplexes were purchased from Eurogentec (Liege, Belgium). For lentivirus production and exogenous expression studies, plasmids were incubated in OptiMem (Invitrogen) with

The FASEB Journal x www.fasebj.org

NOY ET AL.

polyethylenimine (36 mg/ml) at a 1:4 ratio for 10 min at room temperature before being added to HEK293T cells in complete DMEM. Lentiviral plasmids were transfected in a ratio of 1:2.5: 3.3 for pMD2G:psPAX2:pWPI. For experiments examining the cultured media (CM) fraction, 24 h after transfection, OptiMem that was supplemented with 4 mM L-glutamine, 100 U/ml penicillin, and 100 mg/ml streptomycin (Invitrogen) was added to the cells. CM was removed after an additional 24 h and concentrated (1:10) by acetone precipitation. Western blotting, immunoprecipitation, flow cytometry, and immunofluorescence staining Whole-cell (WC) protein lysates and coimmunoprecipitation experiments were performed as previously described (25), with the exception that protein for immunoprecipitations was extracted from 2 3 107 HEK293T cells. Standard protocols were used for Western blotting and SDS-PAGE. Primary antibodies were used as indicated in the text and figure legends with corresponding HRP-conjugated secondary antibodies. Densitometric analysis was performed by using ImageJ (National Institutes of Health, Bethesda, MD, USA). Averaged values from $2 exposures per experiment were used for quantitation. For flow cytometry, cells were prepared and stained, and data were collected as previously described (7). Immunofluorescence staining was performed as previously described (3). Images were taken by using an Axioskop2 microscope and AxioVision SE64 Rel4.8 software (Zeiss, Cambridge, United Kingdom). Quantitative PCR cDNA was prepared by using the High-Capacity cDNA Archive kit from Applied Biosystems (Foster City, CA, USA), from 1 mg of total extracted RNA. Quantitative PCR (qPCR) reactions were performed with Express qPCR supermix (Invitrogen) on a Corbett Rotor-Gene 6000 (Qiagen, Valencia, CA, USA) thermocycler. Primers for human clec14a and flotillin-2 were prepared as previously described (3). Primers used for rhbdl2 were as follows: forward: 59GGAGGAAGCCTGGAGGTTTAT39; reverse: 59AAAGATTCCCCAAGATGTGCT39. Relative expression ratios were calculated according to the efficiency adjusted mathematical model (26).

that was supplemented as described in the text and figure legends was added at 0 h. Images were taken at 0, 16, 18, and 24 h with a Leica DM IL microscope (Leica, Milton Keynes, United Kingdom) with a USB 2.0 2M Xli digital camera (XL Imaging, Carrollton, TX, USA) at 310 magnification. Analysis points were excluded if the wound area exceeded 5% of the mean. Images were analyzed by using ImageJ, and the percentage wound closure was calculated relative to the experimental control.

HUVEC spheroid sprouting assay, aortic ring assay, and murine subcutaneous sponge angiogenesis assay Generation of HUVEC spheroids and the induction of endothelial sprouting in a collagen gel was performed as previously described (7). To quantify sprout growth, the number of sprouts were counted and cumulative and maximal sprout lengths were assessed. Aortic rings were prepared as previously described (7), with the exception that CM was supplemented with 20 mg/ml mCLEC14A-Fc or with an equimolar ratio of human Fc. Rings with no endothelial outgrowth were excluded from analysis. Tube/sprout outgrowth, maximal endothelial migration, and total endothelial outgrowth were quantitated. The murine subcutaneous sponge angiogenesis assay was performed as previously described (7). Vessel counts were assessed in 5 fields per section per sponge.

Mice C57BL/6 mice were housed at the Birmingham Biomedical Services Unit (Birmingham, United Kingdom). Animal work was performed under British Home Office project license 40/ 3339 held by R.B.

RESULTS CLEC14A is shed from endothelial cells by RHBDL2

Scratch–wound migration assays were performed on confluent monolayers of HUVECs. Wounds were scratched with 20 ml Gilson pipetman tips (Starlab Group, Milton Keynes, United Kingdom) in a 3 3 3 grid, with 9 points of analysis. Fresh cM199

To examine whether CLEC14A is shed from cells, we isolated soluble proteins that were released from primary endothelial cells (HUVEC) and an epithelial cell line (HeLa) that does not express CLEC14A as controls. Soluble proteins from CM were analyzed by Western blot and stained with CLEC14A antisera. Soluble CLEC14A was detected in the HUVEC CM but not in the HeLa CM (Fig. 1A). Analysis of the WC lysates confirmed the expression of CLEC14A in HUVEC, with a band ;90 kDa, but CLEC14A was absent from the epithelial cell line (Fig. 1A). Because thrombomodulin, the best-characterized member of the C-type lectin family 14, is cleaved by RHBDL2 (21), we investigated whether CLEC14A is also cleaved by a rhomboid family member. For this, each of the proteolytically active human rhomboids were coexpressed with HA-tagged CLEC14A. HEK293T cells were used as a result of the lack of endogenous CLEC14A expression. Soluble CLEC14A was only detected in extracts from cells that coexpressed RHBDL2 and CLEC14A, and no corresponding band was seen in extracts from cells that coexpressed either RHBDL1 or -3 with CLEC14A (Fig. 1B). Membrane-bound CLEC14A, which corresponded to a band ;105 kDa as a result of the extracellular HA-tag, was

CLEC14A ECTODOMAIN REGULATES SPROUTING ANGIOGENESIS

3

CLEC14A-ECD-Fc protein purification CM that contained lentivirus was added to HEK293T cells for 24 h. GFP-positive cells were isolated by cell sorting and grown in OptiMem. CM that contained human or murine CLEC14A-ECDFc was collected and flowed over a HiTrap protein A HP column (GE Healthcare, Amersham, United Kingdom). Protein was eluted by using a 0–100% gradient of 100 mM sodium citrate (pH 3) and neutralized with 1 M Tris base. Fractions were assessed for protein purity and specificity by separating the eluted proteins on an SDS-PAG before staining with coomassie or Western blotting. Fractions that contained similar concentrations of protein were combined and dialyzed in PBS before use in functional assays. Scratch wound migration assays

U H

kDa

100 blot: CLEC14A

70 55 CM

C

R L1 R L2 R L3

kDa

-

B VE C H EL A

A

CLEC14A blot: -HA

70

kDa 100

CLEC14A blot: -HA

70 CM

CM

Ponceau S Ponceau S

Ponceau S

blot: -CLEC14A

100 100

blot: -CLEC14A

WC 70 55

blot: -CLEC14A

100 WC

blot: -Tubulin

70 WC 35

70 blot: -Tubulin

55 +

+

+

25

HA-CLEC14A

blot: -Tubulin

55 -

+

+++

+

+

+

Myc-RL2 HA-CLEC14A

R

L2

O

blot: -CLEC14A

70 55

CM Ponceau S

R

kDa

CLEC14A blot: -HA

70

C

100

N

R

-

kDa

-K D L2 1 -K D C 14 2 A -K C 1 4 D1 A -K D 2

E L2 R m L2 ut

D

+

RHDBL2 blot: -Myc

CM Ponceau S

blot: -CLEC14A

100 WC

WC 55

blot: -CLEC14A

100 70 55

70

blot: -Tubulin

blot: -Tubulin RHDBL2 blot: -Myc

D

14 C

14

A

D

L2

C

-K

D -K L2

R

R

O

N O

Fold change (mRNA)

0

KD

0

0

KD

50

C

1.0

C

100 0

N

Percentage cleavage

O N R L2 K D C 14 A K D

1.5

-K

2

1

G 1

F

2

HA-CLEC14A

D

+

-K

+

A

+

CLEC14A 0.5 0 1.5 1.0 0.5

RHBDL2

0

Figure 1. CLEC14A is cleaved by RHBDL2. A) CM and WC protein extracts from HUVECs and HeLa cells were analyzed by Western blot for CLEC14A. CM and WC blots were probed with an anti-CLEC14A antisera (top). Ponceau S stain and an antitubulin antibody (bottom) were used as loading controls. All Western blots shown are representative of $3 experiments. B) HEK293T cells expressing HA-CLEC14A with RHBDL1 (RL1), RHBDL2 (RL2), RHBDL3 (RL3) or an empty vector (2). Blots were probed as in (A) with the exception that CLEC14A was detected with anti-HA antibody (top). In WC lysates, the unglycosylated form of CLEC14A was detected at ;70 kDa in addition to the membrane-bound form at ;105 kDa. Membrane-bound (continued on next page)

4

Vol. 30

June 2016


NOY ET AL.

also slightly reduced in samples that coexpressed RHBDL2. Finally, coexpressing increasing concentrations of RHBDL2 with CLEC14A produced a dose-dependent increase in the shedding of CLEC14A (Fig. 1C). The mutation of the key serine residue within the catalytic pocket of RHBDL2 to an alanine renders the protease inactive (27). To further confirm the specificity of the RHBDL2 cleavage of CLEC14A, CLEC14A was coexpressed with RHBDL2 or this inactive mutant. Again, CLEC14A shedding was observed in protein extracts taken from cells that coexpressed the active form of RHBDL2, but shedding was absent in extracts from cells that expressed the RHBDL2 mutant (Fig. 1D). Taken together, these data confirm that the proteolytic activity of RHBDL2 can release the ECD of CLEC14A. CLEC14A is an endothelial restricted gene (3, 5); therefore, to determine whether endogenous RHBDL2 is responsible for the extracellular shedding of CLEC14A, HUVECs were treated with siRNAs that targeted rhbdl2 or clec14a. CM and WC protein fractions from these cells were probed for the presence of soluble and full-length CLEC14A protein. As expected, CLEC14A was reduced in both the CM and WC extracts from CLEC14A knockdown cells compared with control siRNA-treated cells (Fig. 1E). Importantly, the cleaved CLEC14A band was also reduced in the CM from RHBDL2 knockdown cells, but expression of full-length CLEC14A was unchanged from control levels (Fig. 1E). Quantification of the cleaved CLEC14A band across 3 independent experiments and 2 duplexes for each targeted gene showed a 50% reduction of soluble CLEC14A from RHBDL2 knockdown cells and a 60% decrease from CLEC14A knockdown cells compared with control cells (Fig. 1F). Knockdown of rhbdl2 or clec14a gene expression was confirmed by qPCR analysis (Fig. 1G). These data confirm that CLEC14A is cleaved by RHBDL2 in endothelial cells. Identification of the CLEC14A domains required for shedding We next sought to identify the RHBDL2 cleavage site in CLEC14A. Rhomboid proteases have been hypothesized to cleave either within the transmembrane domain, proximal to the membrane, or at distal extracellular locations (28). To identify the extracellular region of CLEC14A that is cleaved by RHBDL2, RHBDL2 was coexpressed with CLEC14A or with mutants that lacked an extracellular region or CYTO of CLEC14A (Fig. 2A). Mutants of CLEC14A that lacked the EGFL domain or the transmembrane distal region of ML1 had no effect on CLEC14A

shedding by RHBDL2 (upper band denoted with *) compared with wild-type CLEC14A (Fig. 2B, C). However, deletion of the CTLD, the sushi-like, the transmembrane proximal region of ML2, or the CYTO of CLEC14A reduces CLEC14A shedding compared with wild-type CLEC14A (Fig. 2B, C, upper band denoted with *). This suggests that multiple regions of CLEC14A are important for RHBDL2-mediated shedding of CLEC14A. To ensure that CLEC14A mutants were expressed on the cell surface and, therefore, were able to be released from the cell, cells that expressed the mutants were probed with anti-HA antibodies and analyzed by using flow cytometry. Positive staining was based on gating of isotype control stained cells. Figure 2D shows that all mutants of CLEC14A were expressed on the cell surface except the CTLD-deleted and SL-deleted mutants, which did not reach the plasma membrane. This suggests that the CTLD–SL region is important for cell-surface expression. Furthermore, the cleavage site is likely located within the transmembrane proximal region of the mucin-like domain. To further support this hypothesis, an HA N-terminally tagged, EGFP C-terminally tagged CLEC14A was coexpressed either with or without RHDBL2. In the WC lysate, the CLEC14A C-terminal fragment was ;38 kDa and the EGFP tag alone was ;27 kDa, and we can therefore infer that the remaining C-terminal fragment of CLEC14A is ;11 kDa (Fig. 2E). The transmembrane and cytoplasmic tail of CLEC14A is predicted to be 9.5 kDa. This further suggests the cleavage site is proximal to the transmembrane domain. CLEC14A interacts with RHBDL2 Despite the above data that demonstrate that the release of the CLEC14A ECD is dependent on RHBDL2 proteolytic activity, these data do not confirm that RHBDL2 directly interacts and cleaves CLEC14A. To clarify whether RHBDL2 and CLEC14A directly interact, an HA-tagged RHBDL2 S-.A mutant was coexpressed with EGFPtagged CLEC14A or with EGFP-tagged CLEC14A that lacked CYTO. CLEC14A was immunoprecipitated from WC extracts by using an anti-GFP antibody, and IgG immunoprecipitates were used as a control. Precipitates were then probed with an HA antibody to detect bound RHBDL2. A band that corresponded to RHBDL2 was observed in the GFP immunoprecipitate but was absent from the IgG control lane (Fig. 2F). We also found that RHBDL2 and CLEC14A still interact when CLEC14A lacks CYTO (Fig. 2F). Although this interaction could be through an intermediary binding partner, these data

and soluble forms of CLEC14A are slightly larger than the endogenous form because of an extracellular HA-tag. C ) HEK293T cells expressing HA-CLEC14A with 0, 50, and 500 ng of Myc-RHBDL2. Blots were probed as in (B) and the WC blot was also probed with an anti-Myc antibody to detect RHBDL2. D) HEK293T cells expressing HA-CLEC14A with RHBDL2 (RL2), RHBDL2 with the catalytic serine mutated to an alanine (RL2 mut), or an empty vector (2). Blots were probed as in (C ). E ) CM and WC protein extracts from HUVECs transfected with siRNA that targeted rhbdl2 [RL2-knockdown (KD) 1, RL2-KD2] clec14a (C14A-KD1, C14A-KD2), or a control duplex (con) were analyzed by Western blot. CM and WC blots were probed with an antiCLEC14A antibody (top). Ponceau S stain and an anti-tubulin antibody (bottom) were used as loading controls. F ) Densitometric quantification of cleaved CLEC14A from 3 independent experiments; duplexes 1 and 2 of rhbdl2 and clec14a were collated. G) RNA was extracted and cDNA was generated from the cells in (E ). qPCR analysis of gene expression for clec14a (CLEC14A) and rhbdl2 (RHBDL2) was compared with flotilin-2 as a housekeeping gene. Data were collated from 3 independent experiments. CLEC14A ECTODOMAIN REGULATES SPROUTING ANGIOGENESIS

5

A N

C

CLEC14A

N

C

CLEC14A CTLD

N

C

CLEC14A SL

N

C

CLEC14A EGFL

N

C

CLEC14A ML1

N

C

CLEC14A ML2

N

C

CLEC14A CYTO

HA

CTLD

SL EGFL

ML

TM CYTO

E

-

100 70

100 70

CLEC14A blot: -HA

C

kDa

kDa

LE C C 14 LE A C C14 LE A C C 14 LE A C C 14 LE A C C14 LE A C C 14 LE A C 14 A

C TL SL D

EG F M L L1 M L2 C YT O

B

*

* *

55

CM

*

*

*

CLEC14A blot: -HA

Ponceau S

*

CM

140 Ponceau S

CLEC14A blot: -GFP

55

100

WC

100 70

CLEC14A blot: -HA

70 55 35

40

WC

35

RHDBL2 blot: -Myc

25 55

RHBDL2 blot: -Myc

55

blot: -Tubulin

blot: -Tubulin

+ -

Percentage cleavage

C

HA-CLEC14A-EGFP Myc-RHBDL2

F 200 IP: GFP kDa 27

150

IgG

GFP

IgG IgG LC

100

RHBDL2 mut blot: -HA

50 0 +RHBDL2

D Cells positive for cell surface HA staining (%)

+ +

80

CLEC14A blot: - GFP

100 70

60 40

+

+

-

-

-

-

+

+

20 0

CLEC14A-EGFP CLEC14A CYTOEGFP

+ RHBDL2mut-HA

Figure 2. The cytoplasmic and region proximal to the transmembrane (TM) of CLEC14A is required for efficient shedding by RHBDL2. A) Schematic representation of HA-CLEC14A and HA-CLEC14A domain deletion constructs. B) CM and WC protein extracts from HEK293T cells expressing Myc-RHBDL2 with HA-CLEC14A or one of the domain deletion constructs in (A) or an empty vector (2) were separated on an SDS-PAG. CM and WC blots were probed with an anti-HA antibody (top). Ponceau S stain and an anti-tubulin antibody (bottom) were used as loading controls, and Myc-RHBDL2 was stained with an anti-Myc antibody (middle of WC). Representative image. C ) Quantification of RHBDL2-induced cleavage of CLEC14A from the domain deletion series [as shown in (B); *upper band] was determined by densitometric analysis of 3 independent experiments. D) (continued on next page)

6

Vol. 30

June 2016


NOY ET AL.

support the previous shedding data and the hypothesis that CLEC14A interacts at the molecular level with RHBDL2. Identification of the RHBDL2 cleavage motif within CLEC14A To investigate the function of the cleaved CLEC14A ECD, we looked to first identify the cleavage motif within CLEC14A. Strisovsky et al. (28) identified a rhomboid protease recognition motif for rhomboid substrates. By using their specificity matrix, we predicted potential cleavage sites of CLEC14A. To support these predictions, we compared the transmembrane and extracellular proximal region for sequence conservation through mammals by using the clustal alignment engine. For motif 1, the P4 and P1 position is identical throughout 9 mammalian species, and the P29 position is structurally homologous, whereas in motif 2, only the P1 position is identical and the P29 aa is structurally homologous (Fig. 3A). On the basis of the same specificity matrix, point mutations were designed to disrupt shedding (Fig. 3B, bold sequence). These point mutations were interrogated by using the overexpression system described above. Either CLEC14A, CLEC14A SS395,396DD, or CLEC14A IS370,373DD was coexpressed with RHDBL2, and the level of CLEC14A present in the CM was analyzed (Fig. 3C). CLEC14A IS370,373DD had no effect on shedding compared with wild-type CLEC14A (Fig. 3C); however, mutation of aa 395 and aa 396 to aspartic acid residues reduced shedding compared with wild-type levels (Fig. 3C). Both mutants were expressed at levels similar to those in wild-type CLEC14A, and all forms of CLEC14A were present on the cell surface (Fig. 3D). These data confirm that motif 1, within CLEC14A, is the site of proteolytic cleavage by RHBDL2. Cleaved CLEC14A ECD modulates endothelial cell migration CLEC14A modulates multiple endothelial cell functions (5). To investigate the function of the RHBDL2-cleaved CLEC14A fragment, we produced hCLEC14A-ECD-Fc protein, which contains all the ECDs of CLEC14A fused to an Fc tag (Fig. 4A). HEK293T cells were transduced with lentivirus that contained expression vectors that coded for the hCLEC14A-ECD-Fc fusion protein. These cells were grown in serum-free conditions, and the CM that contained the hCLEC14A-ECD-Fc was collected and purified over a HiTrap-protein A column. Eluted protein fractions were separated by SDS-PAGE, and parallel gels were

stained with coomassie or analyzed by Western blot. A protein band between 100 and 140 kDa was detected on a coomassie-stained SDS-PAG and corresponded to a band detected by an anti-Fc antibody (Fig. 4B). To determine whether the cleaved fragment of CLEC14A has an effect on endothelial cell migration, hCLEC14A-ECD-Fc or human Fc protein was added to the media of wounded HUVEC monolayers. The exogenous addition of 20 mg/ml hCLEC14A-ECD-Fc to HUVEC scratch wounds produced a significant retardation in cell migration compared with control human Fc-treated cells (Fig. 4C, D; P , 0.001). To determine whether loss of endogenous cleaved CLEC14A can also affect endothelial cell migration, CM was taken from control or clec14a knockdown HUVECs and was used to treat scratch wounds in a HUVEC monolayer. The CLEC14A knockdown CM increased the area of wound closure to greater than double that observed for control CM-treated HUVECs (Fig. 4E, F). Together, these data suggest that soluble CLEC14A has a role in modulating endothelial cell migration. Cleaved CLEC14A ECD regulates sprouting angiogenesis Sprouting angiogenesis is the principle mechanism of tumor-induced endothelial cell recruitment, and CLEC14A expression has been shown to be up-regulated on tumorassociated blood vessels compared with normal vasculature (3). Therefore, to assess the role of soluble CLEC14A on sprouting angiogenesis, we used HUVEC spheroids as a model of sprouting angiogenesis. We assessed the role of soluble CLEC14A on the regulation of endothelial sprouting by treating HUVEC spheroids with 20 mg/ml hCLEC14A-ECD-Fc. Treated HUVEC spheroids reduced sprouting per spheroid (Fig. 5A, B) compared with human Fc-treated cells. In addition, the maximal sprout distance migrated from the spheroid was also inhibited in the hCLEC14A-ECD-Fc–treated cells (Fig. 5C). These data suggest that soluble CLEC14A helps to regulate endothelial migration and sprout formation. To further investigate the role of soluble CLEC14A in endothelial sprouting, aortic ring explants from C57BL6 mice were embedded into a collagen matrix and stimulated with VEGF to induce endothelial sprouting. This ex vivo approach also accounts for stromal–endothelial interactions. For this, we first purified mCLEC14A-ECD-Fc protein as described above for the human protein. Eluted mCLEC14A-ECD-Fc protein could first be observed in fraction 11, as detected by CLEC14A antisera (Fig. 5D, lower

Percentage of cells from (B) that were stained with an anti-HA antibody and analyzed by flow cytometry. Data were collated from 3 independent experiments. E ) HEK293T cells expressing HA-CLEC14A-EGFP with Myc-RHBDL2 or alone were harvested for CM and WC protein extracts. Extracts were analyzed by Western blot. CM blot was probed with an anti-HA antibody for cleaved CLEC14A (top), and ponceau S stain was used as a loading control (bottom). WC blot was probed with an anti-GFP antibody for CLEC14A (top), an anti-Myc antibody for RHBDL2 (middle), and anti-tubulin antibody was used as a loading control (bottom). Membrane-bound and C-terminal fragments of CLEC14A are ;27 kDa larger than the endogenous form because of the C-terminal EGFP tag. F) RHBDL2 binds to CLEC14A, even in the absence of the cytoplasmic tail of CLEC14A. Immunoprecipitation (IP) of CLEC14A or CLEC14A Δcytoplasmic domain and their control precipitates were separated by SDS-PAGE and blotted for RHBDL2 s-.a mutant (top) with an anti-HA antibody or CLEC14A (bottom) with an anti-CLEC14A antibody. *RHBDL2-cleaved band of CLEC14A that correlates with the endogenous cleaved band observed in HUVECs (A). §A second cleavage event within the middle of the CLEC14A ECD (A). LC, light chain. CLEC14A ECTODOMAIN REGULATES SPROUTING ANGIOGENESIS

7

Figure 3. Identification of the RHBDL2 cleavage site within the CLEC14A ECD. A) Alignment of the transmembrane domain and the proximal extracellular region of CLEC14A from 9 mammalian species. The boxes highlight predicted rhomboid cleavage motifs. P4, P1, and P29 indicate the key residues for cleavage. B) Schematic diagram of HA-CLEC14A and targeted point mutations in HA-CLEC14A, SS395,396DD, and IS370,373DD. Underlined regions are predicted rhomboid cleavage sites; bold regions are mutated amino acids; and italics are transmembrane regions. C) CM and WC protein extracts from HEK293T cells expressing Myc-RHBDL2 with HA-CLEC14A or one of the point mutation constructs in (B) or an empty vector (2) were separated by SDS-PAGE. CM and WC blots were probed with an anti-HA antibody (top). Ponceau S stain and an anti-tubulin antibody (bottom) were used as loading controls, and MycRHBDL2 was stained with an anti-Myc antibody (middle of WC). Representative image of 3 independent experiments. D) HEK293T cells expressing HA-CLEC14A or one of the point mutations in (B) or an empty vector (2) were stained with an anti-HA antibody and analyzed by flow cytometry. Histograms are representative of data from 3 independent experiments.

panel), with peak protein concentrations at fractions 17–19. Coomassie staining confirmed the high purity of the mCLEC14A-ECD-Fc protein (Fig. 5D, upper panel). As we observed for the HUVEC spheroid sprouting assay, 20 mg/ml of mCLEC14A-ECD-Fc inhibited endothelial sprout outgrowth from aortic ring explants compared with Fc-treated aortic rings (Fig. 5E, F). Furthermore, soluble CLEC14A reduced tube formation from an average of 30 tubes per aortic ring with control treatment to 11 for CLEC14A-treated aortic rings (Fig. 5F). Endothelial migration was also impaired with treatment. Endothelial cells migrated an average of 1028 mm from control aortic rings, 8

Vol. 30

June 2016

whereas migration was reduced to 678 mm in treated aortic rings (Fig. 5G). We conclude that soluble CLEC14A can inhibit endothelial cell migration and tube formation in vitro. CLEC14A binds to endothelial tip cells To investigate whether soluble CLEC14A binds to sprouting endothelial cells, sprouting aortic ring explants were stained with mCLEC14A-ECD-Fc or human Fc. Aortic rings were costained with isolectin-B4 and DAPI to stain the endothelial cells and the individual cell nuclei,


NOY ET AL.

Figure 4. The cleaved extracellular region of CLEC14A inhibits endothelial cell migration. A) Schematic representation of CLEC14A-ECD-Fc protein. B) Purified hCLEC14A-ECD-Fc protein fractions separated by SDS-PAGE and stained with coomassie (left) or transferred to a PVDF membrane and stained with CLEC14A antisera (right). Arrows indicate purified hCLEC14A-ECDFc protein. C ) Wounds were scratched into confluent monolayers of HUVECs, and media was supplemented with 20 mg/ml CLEC14A-Fc or an equimolar concentration of hFc. Dotted lines mark the scratch boundaries. Representative image of 1 scratch from 1 of 3 independent experiments. D) Quantitation of (C ), collating scratches from 3 independent experiments. E ) Wounds were scratched into confluent monolayers of HUVECs. CM from HUVECs treated with control or CLEC14A targeted siRNA was removed from cells and added to scratched HUVEC monolayers at 0 h. Dotted lines mark the scratch boundaries. Representative image of 1 scratch from 1 of 3 independent experiments. F ) Quantitation of (E ), collating scratches from 3 independent experiments. KD, knockdown. Mann-Whitney U test. *P = 0.04 (F). **P = 0.0025 (D).

respectively (Fig. 5H). The mCLEC14A-ECD-Fc protein most strongly stained the tip cells and the extending filopodia from the migrating endothelial cells within individual endothelial sprouts (Fig. 5H).

density within the invasive sponge tissue for the mCLEC14AECD-Fc–treated sponges (Fig. 6D, E; paired Student’s t test P , 0.001). These data provide further evidence that soluble CLEC14A is a negative regulator of angiogenesis.

CLEC14A ECD modulates in vivo angiogenesis

DISCUSSION

To further investigate the function of soluble CLEC14A protein, 2 subcutaneous sponge barrels were implanted per C57BL/6 mouse, one on the right and one on the left flank. mCLEC14A-ECD-Fc was injected into one of these barrels and Fc alone was injected into the other with bFGF to stimulate cellular ingrowth and angiogenesis. The sponge barrels were excised at 2 wk postimplantation (Fig. 6A). Histologic analysis by hematoxylin and eosin staining revealed a significant defect in total cellular invasion into the sponge barrels in mCLEC14A-ECD-Fc–treated sponges compared with the paired Fc-treated sponge from the opposite flank (Fig. 6B, C; paired Student’s t test P , 0.01). This impaired invasion was matched with reduced vascular

Role of RHBDL family proteases in the modulation of endothelial-derived soluble factors


Rhomboid serine proteases have roles in multiple cellular processes, and the release of active ectodomains has been demonstrated for several targets (29). Our data are the first, to our knowledge, to identify a direct role for a protein ectodomain that is released by a rhomboid protease that regulates angiogenesis in vitro and in vivo. Previous work has identified proteins expressed on endothelial cells as substrates but have not shown a functional effect of the endogenous cleavage itself. RHBDL2 has been implied in 9

A

B

D

C

Fc

*** Maximal migration per spheroid ( m)

No. of sprouts per spheroid

C14A-Fc

55

1000

5

500

7

9

36 11 13 15 17 19 Fractions

blot: -CLEC14A

0

E

14

***

10

0

F

kDa 140 100 70

C

Fc

Fc C 14

A

A

-F

-F

c

c

Coomassie

kDa 140 100 70

G c -F A 14 C

9 11 13

15 17 19 Fractions

1000 30 20 10

500

0

Fc

Merge

20X

BS-1 Lectin

40X

mC14A-Fc

20X

Fc

DAPI

m

7

0

H

36

**

** Maximal distance migrated ( m)

mC14A-Fc

No. of tubes per ring

40

Fc

Fc

Fc m C

14

A

-F

c

55

Figure 5. RHBDL2-mediated shedding of CLEC14A inhibits sprouting angiogenesis in vitro, and the cleaved CLEC14A ECD binds to sprouting tip cells. A) Representative images of sprout outgrowth from HUVEC spheroids treated with 20 mg/ml CLEC14A-Fc or an equimolar concentration of Fc. B) Quantitation of sprouts for 27 spheroids (9 spheroids from 3 cords) for CLEC14A-Fc or Fc-treated HUVEC spheroids from (A). C ) Quantitation of maximal sprout length, as described for (A, B). D) Purified mCLEC14A-ECD-Fc protein fractions separated by SDS-PAGE and stained with coomassie (top) or transferred to a PVDF membrane and stained with CLEC14A antisera (bottom). Arrows indicate purified mCLEC14A-ECD-Fc protein. E ) Representative images of aortic rings from C57BL/6 mice cultured in the presence of 20 mg/ml CLEC14A-Fc or an equimolar concentration of Fc. F ) Quantitation of tubes formed per ring with data from 30 rings; at least 6 mice were used for each condition. G) Quantitation of maximal distance migration per ring, as for (D, E ). H ) Immunofluorescent staining of aortic rings (continued on next page)

10

Vol. 30 June 2016


NOY ET AL.

A

B

E

mC14A-Fc

**

20 0

-F 14 C m

mC14A-Fc

60 40

A

H & E staining

***

Fc

80 Area of invasion (%)

mC14A-Fc

Fc

Fc m C 14 A -F

c

c

H & E staining

10 Vessels per field

Fc

D

C

5

0

Figure 6. RHBDL2-mediated shedding of CLEC14A inhibits sprouting angiogenesis in vivo. A) Representative images of sponge implants injected with 100 ml of 20 ng/ml bFGF and 20 mg Fc (con) or 20 mg mCLEC14A-Fc every other day for 2 wk. B) Representative images of hematoxylin and eosin (H&E)–stained sections of the whole sponge implant from (A). Sections at the center of the sponge were analyzed. C ) Quantitation of cellular invasion into the sponge implants shown in (B). D) Representative images of H&E-stained sections of sponge implant from (A). E ) Quantitation of erythrocyte filled vessel density from (A). Paired Student’s t test. **P , 0.01 (C ). ***P , 0.001 (E ). Scale bars, 100 mm (D).

endothelial function via the characterization of thrombomodulin shedding, which is an important regulator of hemostasis and endothelial function (21). Despite this, the endogenous thrombomodulin cleavage product has not been shown to effect endothelial cell processes. Soluble recombinant thrombomodulin, which consists of the extracellular region that lacks CTLD, is known to have pro-angiogenic effects in vitro and in vivo; however, this protein is not naturally produced via RHBDL2-mediated shedding (13). Furthermore, the recombinant thrombomodulin CTLD region alone has the opposite effect, inhibiting angiogenesis by interacting with Lewis Y antigen on endothelial cells (14). RHBDL2 shedding of thrombomodulin has been shown to regulate wound healing in vivo, but this activity is thought to be mediated by stimulating keratinocyte migration (30). Other endothelial factors that have been reported to be cleaved by RHBDL2 include members of the ephrin family, ephrinB3, and possibly ephrinB2. These factors were shown to be cleaved in an overexpression system but the physiologic role of this shedding or shedding of endogenous proteins have yet to be determined (31). Thus, we conclude that CLEC14A is not only the first fully characterized endothelial-specific cleavage by a rhomboid protease but that we have also identified a novel mechanism for the regulation of endothelial cell sprouting. The C-type lectin domain family 14, has four members, including CLEC14A, thrombomodulin, CD93, and endosialin (CD248). CLEC14A, thrombomodulin, and CD93 are endothelial-expressed genes, whereas endosialin is found on endothelial proximal stromal cells. All have

functions in the vascular system (3, 8, 32–34), and both thrombomodulin and CD93 are cleaved and released into the blood (9–12). Lohi et al. (21) described thrombomodulin shedding by RHBDL2, and the Freeman group (28) later predicted proximal and intratransmembrane sites. We have now shown that CLEC14A is also released by RHBDL2, which suggests that RHBDL2 may have a role in the regulation of this family of structurally related proteins. Of interest, on the basis of the rhomboid specificity matrix, CD93 also has a putative rhomboid cleavage motif proximal to its transmembrane domain and may also be targeted by a rhomboid-like protein; however, we were unable to identify any such motif within the endosialin sequence (data not shown). It is possible that the regulation of this family by RHBDL2 is restricted to the endothelial-expressed members. Cytoplasmic domains of RHBDL2 substrates are important for shedding Recent data has suggested that Rhomboid proteins lack the need for defined cleavage recognition motifs (35, 36); however, Strisovsky et al. (28) demonstrated strong evidence for motif-directed proteolysis, and we have been able to reproduce this sequence specificity here (Fig. 3). Furthermore, characterization of thrombomodulin ectodomain shedding by RHDBL2 demonstrated that the CYTO of thrombomodulin is required for efficient shedding (21), as we have shown here for CLEC14A (Fig. 2B, C). It is unclear how shedding is regulated in this way because loss of the CLEC14A CYTO has no effect on the binding of CLEC14A to RHBDL2 (Fig. 2F). However, it is possible that the

stimulated with 50 ng/ml VEGF for 6 d, with isolectin-B4–tetramethylrhodamine, murine CLEC14A-Fc, or Fc (FITC) and DAPI. Mann-Whitney U test. **P , 0.01 (F, G); ***P , 0.001 (B, C ). Original magnification, 320 and 340 (H ). Scale bars, 100 mm (A) and 200 mm (E ). CLEC14A ECTODOMAIN REGULATES SPROUTING ANGIOGENESIS

11

A MMRN2

sCLEC14A CLEC14A

sMMRN2

Loss of CLEC14A

CLEC14A antibodies Sprouting/tube formation

B MMRN2

CLEC14A

RHBDL2

Direction of Migration

Figure 7. Proposed model for cleaved CLEC14A disruption of sprouting angiogenesis. A) Proposed model of CLEC14A-targeted modulation of sprouting angiogenesis. B) Proposed model for the role of RHBDL2 in endothelial migration and sprouting angiogenesis.

intracellular domains have a conformational or stabilizing role for transmembrane helices, which influences efficient proteolysis of a loose cleavage motif for the rhomboid protease (36). CLEC14A ectodomain regulates angiogenesis CLEC14A is an endothelial gene that is up-regulated on the vasculature of multiple tumor types (3). We show here that the released CLEC14A ectodomain has sprout inhibiting, anti-migratory effects in vitro and in vivo (Figs. 4–6), which are similar to those observed for other anti-angiogenic proteins, such as Robo4 (37), endostatin (38, 39), and recombinant thrombomodulin domain 1 (14). Active concentrations are nevertheless considerably higher than the active nanomolar range of pro-angiogenic factors, such as VEGF or bFGF; however, these anti-angiogenic effects are competing within a pro-angiogenic environment and are within the range of anti-angiogenic therapies (40, 41). Knockdown in vitro and in vivo or knockout in vivo of CLEC14A also has anti-angiogenic effects (3, 7), which suggests that the soluble CLEC14A ectodomain is mimicking the loss of CLEC14A. Zanivan et al. (6) demonstrated that CLEC14A binds to the extracellular matrix via interaction 12

Vol. 30 June 2016

with MMRN2. We recently confirmed this interaction and identified a monoclonal antibody against CLEC14A that could disrupt this interaction (7). The same monoclonal antibody also inhibits endothelial sprouting and migration in vitro and in vivo. We hypothesized that the CLEC14A ectodomain inhibits endothelial function via competition for MMRN2 in the extracellular matrix (Fig. 7A). This model is supported by the fact that soluble MMRN2 has antiangiogenic activity (42); therefore, we postulate that binding to the cognate ligand in the matrix (CLEC14A ectodomain from rhomboid-mediated shedding) or on the endothelial cell (soluble MMRN2) blocks endothelial function. Alternatively, Ki et al. (4) reported that CLEC14A binds to its own CTLD; however, we have been unable to reproduce this. It was reported that the CTLD of CLEC14A is essential for migration and filopodia formation after comparing the effect of overexpressed CLEC14A with that of CLEC14A that lacked CTLD (4). However, we show here that CLEC14A that lacked CTLD or SL domains failed to reach the cell surface. This result is in agreement with previously reported cell localization of the GFP-tagged form of this mutant (4, 5). Thus, the conclusion that the CTLD is responsible for the effect of CLEC14A on cell migration and filopodia formation is invalid. Instead, we show that the localization of CLEC14A on the cell surface is essential for function. It is of interest to consider why rhomboid-mediated shedding inhibits angiogenesis. We know that CLEC14A and MMRN2 are up-regulated on tumor endothelium and that tumors use sprouting angiogenesis as the principle mode of vessel acquisition (3, 43). CLEC14A shedding, in this context, could be a mechanism to release CLEC14A from MMRN2 and the extracellular matrix to allow for endothelial migration. The sprouting tip cell senses its environment through filopodia, and we know that CLEC14A can induce filopodia formation (3, 4); therefore, membranebound CLEC14A could sense the extracellular environment and influence the direction of endothelial migration. Rhomboid-mediated shedding of CLEC14A could release these endothelial–extracellular matrix interactions, and the CLEC14A ectodomain could then be left attached to the extracellular matrix to limit sprouting from the stalk of the migratory sprout (Fig. 7B). This idea is supported by the effect of exogenous CLEC14A ectodomain on limiting endothelial migration and sprouting (Figs. 4–6), which suggests that it is competing for binding sites in the ECM, through MMRN2 (6, 7), with membrane-bound CLEC14A. These data suggest that the ectodomain of CLEC14A may inhibit tumor angiogenesis. Furthermore, we have identified a role for rhomboid proteases in the regulation of sprouting angiogenesis and endothelial cell migration. This work was supported by Project Grant A13027 from Cancer Research UK (P.J.N.; grant awarded to R.B.), by Programme Grant A6766 from Cancer Research UK (R.K.S.; grant awarded to R.B.), by the UK Medical Research Council and the University of Birmingham (to P.L.), and by the University of Birmingham (to K.K.). The authors acknowledge additional financial support from Pancreatic Cancer UK. R.B. is a named inventor of a patent filed by Cancer Research UK in the U.S. Patent and Trademark Office on September 3, 2009 (No. 61/ 239,584, bearing Attorney Docket No. P0357.70004US00, entitled “Inhibitors”). The remaining authors declare no conflicts of interest.


NOY ET AL.

REFERENCES 1. Chung, A. S., and Ferrara, N. (2011) Developmental and pathological angiogenesis. Annu. Rev. Cell Dev. Biol. 27, 563–584 2. Potente, M., Gerhardt, H., and Carmeliet, P. (2011) Basic and therapeutic aspects of angiogenesis. Cell 146, 873–887 3. Mura, M., Swain, R. K., Zhuang, X., Vorschmitt, H., Reynolds, G., Durant, S., Beesley, J. F. J., Herbert, J. M. J., Sheldon, H., Andre, M., Sanderson, S., Glen, K., Luu, N.-T., McGettrick, H. M., Antczak, P., Falciani, F., Nash, G. B., Nagy, Z. S., and Bicknell, R. (2012) Identification and angiogenic role of the novel tumor endothelial marker CLEC14A. Oncogene 31, 293–305 4. Ki, M. K., Jeoung, M. H., Choi, J. R., Rho, S.-S., Kwon, Y.-G., Shim, H., Chung, J., Hong, H. J., Song, B. D., and Lee, S. (2013) Human antibodies targeting the C-type lectin-like domain of the tumor endothelial cell marker clec14a regulate angiogenic properties in vitro. Oncogene 32, 5449–5457 5. Rho, S.-S., Choi, H.-J., Min, J.-K., Lee, H.-W., Park, H., Park, H., Kim, Y.-M., and Kwon, Y.-G. (2011) Clec14a is specifically expressed in endothelial cells and mediates cell to cell adhesion. Biochem. Biophys. Res. Commun. 404, 103–108 6. Zanivan, S., Maione, F., Hein, M. Y., Hernández-Fernaud, J. R., Ostasiewicz, P., Giraudo, E., and Mann, M. (2013) SILAC-based proteomics of human primary endothelial cell morphogenesis unveils tumor angiogenic markers. Mol. Cell. Proteomics 12, 3599–3611 7. Noy, P. J., Lodhia, P., Khan, K., Zhuang, X., Ward, D. G., Verissimo, A. R., Bacon, A., and Bicknell, R. (2015) Blocking CLEC14A-MMRN2 binding inhibits sprouting angiogenesis and tumour growth. Oncogene 34, 5821–5831 8. Zelensky, A. N., and Gready, J. E. (2005) The C-type lectin-like domain superfamily. FEBS J. 272, 6179–6217 9. Greenlee, M. C., Sullivan, S. A., and Bohlson, S. S. (2009) Detection and characterization of soluble CD93 released during inflammation. Inflamm. Res. 58, 909–919 ¨ 10. Mälarstig, A., Silveira, A., W˚agsäter, D., Ohrvik, J., Bäcklund, A., Samneg˚ard, A., Khademi, M., Hellenius, M.-L., Leander, K., Olsson, T., Uhlén, M., de Faire, U., Eriksson, P., and Hamsten, A. (2011) Plasma CD93 concentration is a potential novel biomarker for coronary artery disease. J. Intern. Med. 270, 229–236 11. Refaat, L. A., Ali, O. E., Hassan, A. A., and Metwally, A. M. (2012) Urinary thrombomodulin is down regulated in schistosomiasis associated bladder cancer. J. Genet. Eng. Biotech. 10, 67–71 12. Lindahl, A. K., Boffa, M. C., and Abildgaard, U. (1993) Increased plasma thrombomodulin in cancer patients. Thromb. Haemost. 69, 112–114 13. Shi, C.-S., Shi, G.-Y., Chang, Y.-S., Han, H.-S., Kuo, C.-H., Liu, C., Huang, H.-C., Chang, Y.-J., Chen, P.-S., and Wu, H.-L. (2005) Evidence of human thrombomodulin domain as a novel angiogenic factor. Circulation 111, 1627–1636 14. Kuo, C.-H., Chen, P.-K., Chang, B.-I., Sung, M.-C., Shi, C.-S., Lee, J.-S., Chang, C.-F., Shi, G.-Y., and Wu, H.-L. (2012) The recombinant lectinlike domain of thrombomodulin inhibits angiogenesis through interaction with Lewis Y antigen. Blood 119, 1302–1313 15. Kao, Y.-C., Jiang, S.-J., Pan, W.-A., Wang, K.-C., Chen, P.-K., Wei, H.-J., Chen, W.-S., Chang, B.-I., Shi, G.-Y., and Wu, H.-L. (2012) The epidermal growth factor-like domain of CD93 is a potent angiogenic factor. PLoS One 7, e51647 16. Jeon, J. W., Jung, J. G., Shin, E. C., Choi, H. I., Kim, H. Y., Cho, M. L., Kim, S. W., Jang, Y. S., Sohn, M. H., Moon, J. H., Cho, Y. H., Hoe, K. L., Seo, Y. S., and Park, Y. W. (2010) Soluble CD93 induces differentiation of monocytes and enhances TLR responses. J. Immunol. 185, 4921–4927 17. Freeman, M. (2008) Rhomboid proteases and their biological functions. Annu. Rev. Genet. 42, 191–210 18. Higashiyama, S., Iwabuki, H., Morimoto, C., Hieda, M., Inoue, H., and Matsushita, N. (2008) Membrane-anchored growth factors, the epidermal growth factor family: beyond receptor ligands. Cancer Sci. 99, 214–220 19. Adrain, C., Strisovsky, K., Zettl, M., Hu, L., Lemberg, M. K., and Freeman, M. (2011) Mammalian EGF receptor activation by the rhomboid protease RHBDL2. EMBO Rep. 12, 421–427 20. Seals, D. F., and Courtneidge, S. A. (2003) The ADAMs family of metalloproteases: multidomain proteins with multiple functions. Genes Dev. 17, 7–30 21. Lohi, O., Urban, S., and Freeman, M. (2004) Diverse substrate recognition mechanisms for rhomboids; thrombomodulin is cleaved by mammalian rhomboids. Curr. Biol. 14, 236–241 22. Hansson, M. D., Rzeznicka, K., Rosenbäck, M., Hansson, M., and Sirijovski, N. (2008) PCR-mediated deletion of plasmid DNA. Anal. Biochem. 375, 373–375


23. Urban, S., Lee, J. R., and Freeman, M. (2002) A family of rhomboid intramembrane proteases activates all Drosophila membrane-tethered EGF ligands. EMBO J. 21, 4277–4286 24. Maciag, T., Cerundolo, J., Ilsley, S., Kelley, P. R., and Forand, R. (1979) An endothelial cell growth factor from bovine hypothalamus: identification and partial characterization. Proc. Natl. Acad. Sci. USA 76, 5674–5678 25. Desjobert, C., Noy, P., Swingler, T., Williams, H., Gaston, K., and Jayaraman, P.-S. (2009) The PRH/Hex repressor protein causes nuclear retention of Groucho/TLE co-repressors. Biochem. J. 417, 121–132 26. Pfaffl, M. W. (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45 27. Lemberg, M. K., Menendez, J., Misik, A., Garcia, M., Koth, C. M., and Freeman, M. (2005) Mechanism of intramembrane proteolysis investigated with purified rhomboid proteases. EMBO J. 24, 464–472 28. Strisovsky, K., Sharpe, H. J., and Freeman, M. (2009) Sequencespecific intramembrane proteolysis: identification of a recognition motif in rhomboid substrates. Mol. Cell 36, 1048–1059 29. Bergbold, N., and Lemberg, M. K. (2013) Emerging role of rhomboid family proteins in mammalian biology and disease. Biochim. Biophys. Acta 1828, 2840–2848 30. Cheng, T.-L., Wu, Y.-T., Lin, H.-Y., Hsu, F.-C., Liu, S.-K., Chang, B.-I., Chen, W.-S., Lai, C.-H., Shi, G.-Y., and Wu, H.-L. (2011) Functions of rhomboid family protease RHBDL2 and thrombomodulin in wound healing. J. Invest. Dermatol. 131, 2486–2494 31. Pascall, J. C., and Brown, K. D. (2004) Intramembrane cleavage of ephrinB3 by the human rhomboid family protease, RHBDL2. Biochem. Biophys. Res. Commun. 317, 244–252 32. Rettig, W. J., Garin-Chesa, P., Healey, J. H., Su, S. L., Jaffe, E. A., and Old, L. J. (1992) Identification of endosialin, a cell surface glycoprotein of vascular endothelial cells in human cancer. Proc. Natl. Acad. Sci. USA 89, 10832–10836 33. Conway, E. M. (2012) Thrombomodulin and its role in inflammation. Semin. Immunopathol. 34, 107–125 34. MacFadyen, J. R., Haworth, O., Roberston, D., Hardie, D., Webster, M.-T., Morris, H. R., Panico, M., Sutton-Smith, M., Dell, A., van der Geer, P., Wienke, D., Buckley, C. D., and Isacke, C. M. (2005) Endosialin (TEM1, CD248) is a marker of stromal fibroblasts and is not selectively expressed on tumour endothelium. FEBS Lett. 579, 2569–2575 35. Moin, S. M., and Urban, S. (2012) Membrane immersion allows rhomboid proteases to achieve specificity by reading transmembrane segment dynamics. eLife 1, e00173 36. Urban, S., and Moin, S. M. (2014) A subset of membrane-altering agents and g-secretase modulators provoke nonsubstrate cleavage by rhomboid proteases. Cell Reports 8, 1241–1247 37. Suchting, S., Heal, P., Tahtis, K., Stewart, L. M., and Bicknell, R. (2005) Soluble Robo4 receptor inhibits in vivo angiogenesis and endothelial cell migration. FASEB J. 19, 121–123 38. Akhtar, N., Dickerson, E. B., and Auerbach, R. (2002) The sponge/ Matrigel angiogenesis assay. Angiogenesis 5, 75–80 39. Chen, Y., Wang, S., Lu, X., Zhang, H., Fu, Y., and Luo, Y. (2011) Cholesterol sequestration by nystatin enhances the uptake and activity of endostatin in endothelium via regulating distinct endocytic pathways. Blood 117, 6392–6403 40. Kim, K. J., Li, B., Winer, J., Armanini, M., Gillett, N., Phillips, H. S., and Ferrara, N. (1993) Inhibition of vascular endothelial growth factorinduced angiogenesis suppresses tumour growth in vivo. Nature 362, 841–844 41. Noguera-Troise, I., Daly, C., Papadopoulos, N. J., Coetzee, S., Boland, P., Gale, N. W., Lin, H. C., Yancopoulos, G. D., and Thurston, G. (2006) Blockade of Dll4 inhibits tumour growth by promoting nonproductive angiogenesis. Nature 444, 1032–1037 42. Lorenzon, E., Colladel, R., Andreuzzi, E., Marastoni, S., Todaro, F., Schiappacassi, M., Ligresti, G., Colombatti, A., and Mongiat, M. (2012) MULTIMERIN2 impairs tumor angiogenesis and growth by interfering with VEGF-A/VEGFR2 pathway. Oncogene 31, 3136–3147 43. Masiero, M., Simões, F. C., Han, H. D., Snell, C., Peterkin, T., Bridges, E., Mangala, L. S., Wu, S. Y.-Y., Pradeep, S., Li, D., Han, C., Dalton, H., Lopez-Berestein, G., Tuynman, J. B., Mortensen, N., Li, J.-L., Patient, R., Sood, A. K., Banham, A. H., Harris, A. L., and Buffa, F. M. (2013) A core human primary tumor angiogenesis signature identifies the endothelial orphan receptor ELTD1 as a key regulator of angiogenesis. Cancer Cell 24, 229–241 Received for publication December 21, 2015. Accepted for publication February 18, 2016.

13