The FASEB Journal • Research Communication
Sprouty1 is a critical regulatory switch of mesenchymal stem cell lineage allocation Sumithra Urs, Deepak Venkatesh, Yuefeng Tang, Terry Henderson, Xuehui Yang, Robert E. Friesel, Clifford J. Rosen, and Lucy Liaw1 Center for Molecular Medicine, Maine Medical Center Research Institute, Scarborough, Maine, USA Development of bone and adipose tissue are linked processes arising from a common progenitor cell, but having an inverse relationship in disease conditions such as osteoporosis. Cellular differentiation of both tissues relies on growth factor cues, and we focus this study on Sprouty1 (Spry1), an inhibitor of growth factor signaling. We tested whether Spry1 can modify the development of fat cells through its activity in regulating growth factors known to be important for adipogenesis. We utilized conditional expression and genetic-null mouse models of Spry1 in adipocytes using the fatty acid binding promoter (aP2). Conditional deletion of Spry1 results in 10% increased body fat and decreased bone mass. This phenotype was rescued on Spry1 expression, which results in decreased body fat and increased bone mass. Ex vivo bone marrow experiments indicate Spry1 in bone marrow and adipose progenitor cells favors differentiation of osteoblasts at the expense of adipocytes by suppressing CEBP- and PPAR␥ while up regulating TAZ. Age and gender-matched littermates expressing only Cre recombinase were used as controls. Spry1 is a critical regulator of adipocyte differentiation and mesenchymal stem cell (MSC) lineage allocation, potentially acting through regulation of CEBP- and TAZ.—Urs, S., Venkatesh, D., Tang, Y., Henderson, T., Yang, X., Friesel, R. E., Rosen, C. J., Liaw, L. Sprouty1 is a critical regulatory switch of mesenchymal stem cell lineage allocation. FASEB J. 24, 3264 –3273 (2010). www.fasebj.org
ABSTRACT
Key Words: adipocyte 䡠 osteoblast 䡠 growth factor signaling 䡠 body fat 䡠 bone mass
Adipose tissue has an enormous influence on wholebody homeostasis because of its endocrine, autocrine, and paracrine effects on several processes, including blood pressure, immune function, angiogenesis, and energy balance (1). Obesity is a global epidemic affecting 1 billion people worldwide, with more than 300 million diagnosed clinically obese (World Health Organization, 2009; http://www.who.int/dietphysicalactivity/ publications/facts/obesity/en/). As a result, research into the underlying biological factors of obesity has gained enormous importance. One mechanistic approach to combat obesity is inhibiting adipose tissue hyperplasia, the main cause of obesity, and controlling adipocyte differentiation by targeting regulatory mole3264
cules. The metabolic syndrome, osteoporosis, and other disorders have been directly linked to obesity (2– 4). Obesity and metabolic bone diseases, including osteoporosis, share common genetic and environmental determinants and have opposing effects on wholebody metastasis with increase in adiposity commonly associated with loss of bone mass. Osteoblasts and adipocytes arise from mesenchymal stem cells (MSCs), a common progenitor cell type located in bone marrow, adipose tissue and other adult organs (5). The lineage commitment of multipotent MSCs depends on several factors including growth factor signaling. Adipogenesis itself is regulated by several growth factors starting from determination, commitment to preadipocytes, and lipid accumulation stages (6), involving several receptor kinase signaling pathways, such as EGF, FGF, VEGF, and IGF (7, 8). Sprouty and Spred (Spryrelated protein) family proteins are evolutionarily conserved inhibitors of receptor tyrosine kinase (RTK) signaling (9 –11). Spry regulates several signaling pathways and affects common signal mediators, i.e., MAPK, by suppressing the RAS/MAPK pathway and generating a negative feedback loop during development (12). Although the Spry1 gene is expressed in virtually all mouse tissues, including adipose and bone marrow, there are no reports describing a role for Spry in adipose tissue (13). In this study, we focused on Spry1 regulation of cytokine signaling, as receptor activation of growth factors results in stimulation of PPAR␥, a key transcription factor regulating adipogenesis (14). Earlier reports have shown stimulation of adipogenic differentiation in human adipose tissue-derived stem cells by FGF (8) and also increase in glucose transport and GLUT1 expression in the presence of FGF (15). Given the existing evidence for the role of cytokines in promoting adipogenesis, we hypothesized that inhibition of growth factor signaling in mesenchymal precursor cells can prevent differentiation of preadipocytes. To test this tenet, we studied Spry1-mediated inhibition of MAP kinase signaling in adipocytes, using the classical mouse model Cre-lox system with floxed mSpry1 expressed 1
Correspondence: Maine Medical Center Research Institute, 81 Research Dr., Scarborough, ME 04074, USA. E-mail:
[email protected] doi: 10.1096/fj.10-155127 0892-6638/10/0024-3264 © FASEB
under the control of Cre-fatty acid binding promoter (aP2) to accomplish site-specific expression of mSpry1 in vivo. Loss of function of Spry1 in adipocytes resulted in a high-fat–low bone mass phenotype compounded by developing diabetes similar to the metabolic syndrome. We address the question of whether gain of function of Spry1 can rescue this phenotype and evaluate the potential mechanism involved in Spry1 regulation of adipocyte differentiation and impact on bone mass. In addition, we also demonstrate the impact of Spry1 expression on MSCs and its role as a regulatory switch influencing osteoblast and adipocyte lineage specification.
MATERIALS AND METHODS Mouse models All experiments involving mice were approved by the Institutional Animal Care and Use Committee at Maine Medical Center. Transgenic aP2-Cre (B6.Cg-Tg(Fabp4-cre)1Rev/J, stock 005069) and R26Rosa Cre reporter (Gt(ROSA)26Sortm1Sor/J, stock 009427) mice were obtained from the Jackson Laboratory (Bar Harbor, ME, USA). The Spry1-transgenic mouse (16) and the conditional targeted Spry1-null allele (17) have been previously characterized. Double transgenics were identified by genotyping using specific primer sets. Densitometry Total-body dual-energy X-ray absorptiometry scans were conducted using a peripheral instantaneous X-ray imager (GE Lunar PIXImus; GE Healthcare, Waukesha, WI, USA). Data were analyzed for whole-body tissue, as well as a region of interest (11⫻35 voxels), fixed at the central diaphysis of the left femur. Each study group of the transgenic or targeted strain was n ⱖ 8. MicroCT analysis The femurs were dissected, cleaned of soft tissue, fixed, and stored in 70% ethanol at 4°C until analysis. Bones were loaded into 12.3-mm-diameter scanning tubes and imaged using a vivaCT 40 scanner (Scanco Medical AG, Bru¨ttisellen, Switzerland). Scans were integrated into 3-D voxel images (2048- ⫻ 2048-pixel matrices for trabecular and 1024- ⫻ 1024-pixel matrices for all other individual planar stack). A threshold of 220 was applied to all scans at high resolution (E⫽55 kVp, I⫽145 A, integration time⫽300 ms). All trabecular measurements were made by drawing contours every 20 slices and using voxel counting for bone volume per tissue volume and sphere filling distance transformation indices. Cortical thickness was measured at the femoral middiaphysis. Cell culture Bone marrow cells were isolated by flushing the femur and tibia of 16-wk-old mice and cultured, as described previously (18), in DMEM and/or ␣-MEM (for osteoblast differentiation) supplemented with 10% FBS, 1% penicillin, and streptomycin. Adherent cell populations were induced to differentiation at near confluence to osteoblast or adipocytes by supplementing the culture medium with ascorbic acid and -glycerol phosphate for osteoblasts and with SPRY1 REDUCES BODY FAT AND INCREASES BONE MASS
IBMX, insulin, dexamethasone, and rosiglitazone for 2 d for adipocytes and maintained with insulin, thereafter, for the adipocytes. Six-well plates up to near confluence were induced to differentiation as described above to osteoblast or adipocytes. Cells were washed with PBS and harvested using TriReagent (Sigma-Aldrich, St. Louis, MO, USA) for RNA or lysis buffer with protease inhibitors for Western blot. For staining, cells were fixed in 4% PFA for 10 –15 min and rinsed in PBS. ALP was performed using the ALP kit (Sigma-Aldrich), silver nitrate (5%) and sodium thiosulfate (5%) for von Kossa, alizarin red, oil red O staining and leukocyte acid phosphatase TRAP kit (Sigma-Aldrich). Quantitative RT-PCR Osteocalcin: forward primer 5⬘-CTAGCAGACACCATGAGGAC-3⬘, reverse primer 5⬘-CAGGTCCTAAATAGTGATACC-3⬘; Runx2: forward primer 5⬘-CGCACGACAACCGCACCAT-3⬘, reverse primer 5⬘-CAGCACGGAGCACAGGAAGTT-3⬘; osteopontin: forward primer 5⬘-GGTGATAGCTTGGCTTATGGACTG-3⬘, reverse primer 5⬘-GCTCTTCATGTGAGAGGTGAGGTC-3⬘; TAZ: forward primer 5⬘-GTCACCAACAGTAGCTCAGATC-3⬘, reverse primer 5⬘AGTGATTACAGCCAGGTTAGAAAG-3⬘; mSpry1: forward primer 5⬘-TAGGTCAGATCGGGTCATCC-3⬘, reverse primer 5⬘CCTTGACCAAACACATGCAG-3⬘; PPAR␥2: forward primer 5⬘AAACTCTGGGAGATTCTCCTG TTG-3⬘, reverse primer 5⬘-GAAGTGCTCATAGGCAGTGCA-3⬘; C/EBP-: forward primer 5⬘-CGCAGACAGTGGTGAGCTT-3⬘,reverse primer 5⬘CTTCTGCTGCATCTCCTGGT-3⬘; LP: forward primer 5⬘GGTAGATTACGCTCACAACAAC3⬘, reverse primer 5⬘-AGGCACAGTGGTCAAGGT-3⬘; PPAR␥1 ⫹ 2: forward primer 5⬘-TCATCTCAGAGGGCCAAGGA-3⬘, reverse primer 5⬘CACCAAAGGGCTTCCGC-3⬘; FABP4: forward primer 5⬘TGGAAGCTTGTCTCCAGTGA-3⬘, reverse primer 5⬘-AATCCCCATTTACGCTGATG-3⬘; -actin: forward primer 5⬘-GGAGGAAGAGGATGCGGCA-3⬘, reverse primer 5⬘GAAGCTGTCCTATGTTGCTCTA-3⬘; cyclophilin: forward primer 5⬘-CTCGAATAAGTTTGACTTGTGTTT-3⬘, reverse primer 5⬘CTAGGCATGGGAGGGAACA-3⬘. Total RNA was extracted from cells using Trireagent and reverse transcribed using the qScript cDNA supermix (Quanta BioScience, Gaithersburg, MD, USA). Real-time quantitative PCR was performed on the iQCycler (Bio-Rad LifeScience, Hercules, CA, USA) using the iQ-SYBR Green supermix (Bio-Rad LifeScience). All runs were done in duplicate; results are an average of 3 separate runs, and quantification was performed by normalizing to -actin or cycophilin gene expression and further to undifferentiated confluent cells of the same origin. Immunoblotting and immunohistochemistry Tissue and cell lysates were prepared as described previously (19). Proteins were separated by SDS-PAGE, transferred to PVDF membranes (Bio-Rad Life Science), immunoblotted and visualized by ECL (Amersham Biosciences, GE Healthcare Bioscience, Pittsburgh, PA, USA). Antibodies were anti-actin (Sigma-Aldrich), anti-PPAR␥ (Cell Signaling Technology, Danvers, MA, USA), anti-myc (provided by V. Lindner, Maine Medical Center Research Institute), and anti-TAZ (Santa Cruz Biotechnology, Santa Cruz, CA, USA). For immunostaining, paraffin sections were deparaffinized; antigen was recovered using DAKO and blocked in 2% BSA. Primary antibodies were used at recommended dilutions, followed by detection using AlexaFluor-conjugated secondary antibody. 3265
Statistical analysis All data are reported as means ⫾ sd. Group mean values were compared, as appropriate, by Student’s unpaired 2-tailed t test. A value of P ⱕ 0.05 was considered significant.
RESULTS Spry1 loss of function leads to low bone mass and high body fat We generated a mouse model by conditional deletion of Spry1 (17) under the fat-specific FABP4 (aP2) promoter (20) in adipocytes. The animals had normal embryonic and neonatal development, despite known activity of the aP2 promoter during various developmental stages (21). The aP2-Spry1null mice were evaluated by genotyping DNA for the aP2 promoter and the floxed Spry1 gene, as described previously (16). The aP2-Spry1null mice showed normal postnatal growth and weight gain on a standard diet up to 16 wk. Changes in body fat were observable from as early as 10 wk of age. Histological examination of the intra-abdominal fat showed 15% increase (P⬍0.01) in fat cell numbers in the homozygous aP2-Spry1null with smaller but numerous cells per field (Fig. 1A). Increased total body fat in aP2Spry1null mice at 16 wk of age (Pⱕ0.05) (Fig. 1B) was accompanied by lower body weight (Fig. 1C). Since the aP2-Spry1null mice lost weight at 16 wk of age but showed an increase in body fat, we considered the possibility of insulin resistance, and glucose tolerance tests conducted on 16-wk-old aP2-Spry1null mice showed increased glucose levels (data not shown). Serum insulin levels were significantly lower in the null mice, while there were no significant changes in
leptin, adiponectin, and osteocalcin levels (Supplemental Fig. 1). The homozygous conditional Spry1-null mice (aP2Spry1null) showed significant changes in bone structure and volume compared to controls (Fig. 1D, E) at 16 wk of age. The aP2-Spry1null mice showed a 25% decrease in bone mineral content (BMC) (Fig. 1F) along with a decrease in trabecular BV/TV (Fig. 1G), number of trabeculae (Fig. 1H), trabecular thickness (Fig. 1I), and a corresponding increase in trabecular separation (Fig. 1J). Heterozygous deletion of Spry1 allele in mice at 16 wk of age also showed significant increases in body weight and a 5% increase in percentage total body fat at 16 wk of age (P⬍0.001, data not shown). Although changes in areal BMC and BMD were not significant in mice heterozygous for the aP2-Spry1null allele, there was a significant decrease in trabecular bone mass (15% BV/TV) in the femur accompanied by reduced cortical and trabecular thickness, with a corresponding increase in spacing in the heterozygotes (data not shown). In addition, the mice exhibited increased marrow adiposity accompanied by decrease in bone mass, reflecting an osteoporotic condition. In vivo cell-specific expression of mSpry1 using Cre-lox system To address the question of whether Spry1 expression could rescue the bone and fat phenotype, we generated a mouse model conditionally expressing Spry1 (transgene previously described (16) under the same fatspecific FABP4 (aP2) promoter in adipocytes. Doubletransgenic mice expressing Spry1 under the aP2 promoter, hereafter referred to as aP2-Spry1, were evaluated based on genotyping of DNA by PCR for aP2 promoter and Spry1 sequences/alleles. While Spry1
Figure 1. Fat-specific deletion of Spry1 induces total body fat accumulation. A) Intraabdominal fat was examined histologically from control, heterozygous, or aP2-nullSpry1 mice, and fat cell numbers were quantified. B) Whole-body densitometry (DEXA) analysis showed increased percentage total fat in the aP2-null-nullSpry1 mice (n⫽10). C) Average body weight of control and aP2-Spry1null mice at 15 wk of age (nⱖ10). D, E) Longitudinal nondecalcified section of micro-CT imaged femurs from control (D) and aP2-Spry1null (E) mice at 16 wk of age. Micro-CT image analysis shows trabecular thickness and trabecular separation in control and aP2-Spry1null femurs (nⱖ4, left). F) Bone mineral content of 15-wk-old mice (n⫽10). G–J) Analysis of each group included bone volume/total volume (G), trabecular number (Tb.No; H), trabecular thickness (Tb.Th; I), and trabecular separation (Tb.Sp; J). Bars indicate means ⫾ sd. *P ⬍ 0.05. 3266
Vol. 24
September 2010
The FASEB Journal 䡠 www.fasebj.org
URS ET AL.
expression under the Col2a1 promoter resulted in embryonic and neonatal defects and lethality in the double transgenics (16), we did not observe any visible defects in the aP2-Spry1 offspring. The double-transgenic mice had normal embryonic and neonatal development with normal postnatal growth and weight gain on a standard diet during the observed period of 50 wk. Tissue-specific expression of Spry1 expression was confirmed in adipose tissue by immunostaining for the myc-tag and qRT-PCR for fat tissue, which showed a 2.5-fold increase in Spry1 transcript levels compared to controls (Fig. 2). Spry1 gain of function leads to reduced total body fat and hypertrophy of abdominal fat cells Histological examination of intra-abdominal fat showed significant differences in the control and double-transgenic mice in both males and females. The fat cells were large and exhibited hypertrophy (Fig. 3A, B). Quantification of the number of cells per field showed fewer cells in the double transgenic with up to 50% decrease in number of cells (Fig. 3C). In addition to the abdominal fat phenotype, H&E-stained dorsal skin from the double-transgenic mice showed decreased epidermal fat with a reduced number of adipocyte layers (Fig. 3D, E). Additionally, transcript levels for known adipogenic markers PPAR␥, FABP4/aP2, and
leptin were down-regulated in abdominal fat tissue from aP2-Spry1 mice, as determined by qRT-PCR (Fig. 3F). Further, PPAR␥ protein levels were also lower in fat tissue from the aP2-Spry1 mice (Fig. 3G). Spry1 gain of function leads to increased bone mass Expression of the aP2-Spry1 transgene did not affect overall body weight over time (Fig. 4A). However, DEXA scanning of the aP2-Spry1-transgenic mice from age 10 wk onward showed a decrease (up to 10%) in total body fat compared to littermate controls (P⬍0.05, Fig. 4B). In contrast starting from 10 wk of age, aP2-Spry1 mice showed a corresponding increase in bone mineral content (P⬍0.03) and bone mineral density in the central diaphysis of the left femur (Fig. 4D). At 25 wk of age, bone mineral content in aP2Spry1 mice was 10% higher than controls (P⫽0.025), and the total percentage body fat lower by 30% (P⫽0.00016, Fig. 3B), demonstrating that Spry1 expression influences whole-body homeostasis with increased bone mass and decreased fat tissue accumulation. Three-dimensional microCT analyses of femurs from controls (Fig. 5A–C) and aP2-Spry1 mice (Fig. 5D–F) at 16 wk of age indicated increased bone mass with trabeculae extending into the diaphyseal region in the aP2-Spry1 mice. This was associated with an increased trabecular bone volume fraction (Fig. 5G, %BV/TV) and 35% greater cortical thickness (Fig. 5H) in the aP2-Spry1 mice vs. the controls. In addition, there was a 10% increase in the number of trabeculae (Fig. 4I), with greater trabecular thickness (Fig. 5B, E, J) and a corresponding 9% decrease in trabecular separation (5C, F, K). Full femur BV/TV from 8-, 16-, and 40-wkold mice also showed consistent increases in bone volume fraction in the aP2-Spry1 mice vs. controls with increase in trabecular number and thickness and corresponding decrease in trabeculae (data not shown). Consistent with the early increase in bone mass, there was a 40% decrease in osteoclast numbers at 8 wk of age (Fig. 5L) in aP2-Spry1 femurs, as determined by TRAP staining of histological samples. Osteoclast number did not differ from control at 16 wk of age. Ex vivo Spry1 expression in MSCs mimics in vivo phenotype
Figure 2. Model of fat tissue-specific expression of Spry1 under the aP2/FABP4 promoter. A–D) Immunofluorescence staining using anti-myc antibody showing mSpry1 expression in adipose tissue from aP2-Spry1 mice. Scale bars ⫽ 50 m. A) Control for secondary antibody (AlexaFluor 480). B) Fat tissue from littermate control mouse stained with anti-myc; view ⫻200. C, D) aP2-Spry1 fat tissue showing positive staining for Spry1 in the cytoplasm; view ⫻200 (C) and ⫻400. E) Adipose tissue from control and transgenic mice was analyzed by quantitative RT-PCR for Spry1 transcripts. SPRY1 REDUCES BODY FAT AND INCREASES BONE MASS
Since the in vivo Spry1 expression indicated a strong inverse correlation with the bone and fat, our next approach was to evaluate effects of Spry1 expression in the bone marrow and determine its influence on osteoblast and adipocyte development and differentiation. Although Spry1 itself is reportedly expressed in bone marrow (GenAtlas), we confirmed aP2-promoter activity in the bone marrow cells using the Rosa reporter mouse system to establish -galactosidase activity in MSC (data not shown). For the differentiation assay, bone marrow stromal cultures were set up using 15-wkold mice from the double-transgenic and littermate controls. When cells reached confluence, they were 3267
Figure 3. Spry1 expression suppresses fat accumulation. A, B) Intra-abdominal fat tissue stained with hematoxylin/eosin (H&E) from 16-wk-old control mice (A) or aP2-Spry1 littermates (B). C) Fat cell numbers were quantified; graphed values are means ⫾ sd. *P ⱕ 0.0005. D, E) Representative H&E-stained section from the dorsal skin from control (D) and aP2-Spry1 mice (E) at 15 wk of age. F) qRT-PCR for adipose tissue RNA transcripts from aP2-Spry1 and control mice showing down-regulation of adipogenic markers. G) Immunoblot analysis to compare PPAR␥ protein expression in fat tissue. Scale bars ⫽ 50 m.
induced to osteoblast or adipocyte differentiation using -glycerol phosphate/ascorbic acid and IBMX, insulin, and dexamethasone, respectively. Cells in adipocyte differentiation medium were changed to maintenance medium with insulin alone after 2 d, and medium was changed every 2 d. Oil Red O staining after 2 wk of adipocyte differentiation showed a reduced number of adipocyte colonies (1.5-fold decrease) in the aP2-Spry1 culture compared to littermate controls (Fig. 6A, B).
Osteoblast differentiation of the bone marrow cells resulted in a striking increase in alizarin red, alkaline phoshophatase (ALP), and von Kossa-stained colonies when compared to control cultures 1 and 2 wk postdifferentiation (Fig. 6C). There was a 2-fold increase in the ALP-stained colonies after 1 wk (P⬍0.02) and 1.5-fold increase in mineralization, as determined by von Kossa staining (P⬍0.03) (Fig. 6D), indicating elevated osteoblast differentiation and mineralization ca-
Figure 4. Sprouty expression in fat tissue leads to decreased body fat and increased bone mass. A) Average body weights of control (gray bar) and aP2-Spry1 (black bar) mice at 10, 15, 20, and 25 wk of age (n⫽10). B) Whole-body densitometry (DEXA) scan analysis showing percentage total fat (nⱖ10). C) Whole-body bone mineral content (n⫽10). D) Bone mineral density of region of interest (ROI), determined as a fixed voxel in the central region on the left hind femur (n⫽10). Bars indicate means ⫾ sd; *P ⬍ 0.05.
3268
Vol. 24
September 2010
The FASEB Journal 䡠 www.fasebj.org
URS ET AL.
Figure 5. Sprouty expression induces bone formation and increased bone mass. A–F) Longitudinal nondecalcified section of micro-CT imaged femurs from control (A–C) and aP2-Spry1 (D–F) mice at 16 wk of age. B, E) Micro-CT image analysis showing trabecular thickness in control (B) and aP2-Spry1 femurs (E) (nⱖ4). C, F) Micro-CT image analysis showing trabecular spacing in control (C) aP2-Spry1 (F) femurs (nⱖ4). Analysis of each group included percentage bone volume/total volume (%BV/TV; G), cortical thickness (H), trabecular number (Tb.No; I), trabecular thickness (Tb.Th; J), and trabecular separation (Tb.Sp; L). Number of tartrate-resistant acid phosphatase (TRAP)-positive osteoclasts with ⱖ3 nuclei from 8- and 16-wk-old mice femurs are compared. Bars indicate means ⫾ sd. *P ⬍ 0.05.
pacity in the bone marrow MSCs derived from aP2Spry1 mice. Further, using adipose tissue-derived stromal cells (ATSCs) from intra-abdominal fat depots in similar culture conditions, there was an increase in osteoblast formation and decreased adipocyte colonies in the aP2-Spry1 cultures, similar to what was shown for bone marrow cultures. Spry1 expression predisposes bone marrow and adipose stromal cells to enter the osteogenic lineage To confirm the changes occurring during differentiation at the molecular/transcript level, RNA collected
from the bone marrow cultures of differentiating osteoblasts and adipocytes derived from bone marrow was analyzed by quantitative real-time PCR for known lineage-specific markers. Changes were observed starting from the undifferentiated state at confluence with a clear increase in transcript levels of osteogenic markers osteocalcin (OC, 3.5-fold), ALP (2-fold), and Runx2 (4-fold) in aP2-mSpry1 cells compared to littermate controls (not shown). On osteogenic induction for 7 d, qRT-PCR data from bone marrow cells of aP2-Spry1-transgenic mice showed consistent induction in all the osteoblastic markers osteocalcin (2-fold), Runx2 (2–3 fold), ALP (10-fold),
Figure 6. Sprouty suppresses ex vivo adipocyte differentiation and promotes osteoblast differentiation from bone marrow MSCs. A) Bone marrow MSCs were induced to adipocyte differentiation for 2 wk and stained with oil red O (right panel). B) Number of oil red O colonies was quantified. C) Bone marrow MSCs were induced to osteoblast differentiation for 1 wk (top panels) and 2 wk (bottom panels) and stained with alizarin red (left panels), alkaline phosphatase (top right panel), and von Kossa stain (bottom right panel). D) Numbers of alkaline phosphatase and von Kossa-positive colonies were quantified. Bars indicate means ⫾ sd. *P ⬍ 0.05.
SPRY1 REDUCES BODY FAT AND INCREASES BONE MASS
3269
osteopontin (OPN, 4-fold), and TAZ, the transcriptional coactivator with a PDZ motif (5-fold), compared to controls (Fig. 7A). On adipocyte differentiation in aP2-Spry1 cells, there was a moderate increase in the adipogenic markers, but expression levels remained lower than controls. PPAR␥2 (2-fold), PPAR␥ 1 ⫹ 2, and FABP4 (2-fold) were down-regulated (Fig. 7B). This confirmed that the adipogenic potential of MSCs is suppressed in cells expressing the aP2-Spry1 transgene. In ATSCs, the expression pattern was similar to the bone marrow-derived cells with enhanced osteogenic markers and suppressed adipogenic markers (Fig. 7C, D). However, we noted there was up-regulation of PPAR␥1 ⫹ 2 in adipose-derived cells compared to controls, whereas PPAR␥2 by itself was down-regulated, suggesting a compensatory mechanism may be operative in these cells. Potential mechanism of Spry1 regulation In Spry1-expressing mice, decrease in PPAR␥ expression both at the transcript and protein levels indicated Spry targeting transcription upstream of PPARg. In the sequence of events that modulate adipogenesis, although PPAR␥ has been acknowledged as the master regulatory transcription factor responsible for adipocyte differentiation, the CAAT enhancer binding (C/ EBP) proteins, C/EBP-, in particular, is the primary transcription factor activated on adipogenic induction. Phosphorylation of ERK1/2 initiates C/EBP- , which activates PPAR␥ transcription (22). In aP2-Spry1 cultures stimulated with adipogenic medium, transcript levels of C/EBP-␣ and  were down-regulated compared to unstimulated cells (data not shown). Adipogenic induction also showed suppression of C/EBP- levels (Fig. 8A), suggesting Spry1 expression hinders C/EBP- activation. Twist1 expression was also down-
regulated 3.5-fold in Spry1-expressing bone marrow cultures in adipogenic medium (Fig. 8A). Concurrently, another molecule noticeably affected by Spry1 expression is TAZ, the transcriptional coactivator with a PDZ motif. Q-RT-PCR showed elevated TAZ transcripts in the transgenic cells expressing Spry1 prior to differentiation (data not shown) and increasing with osteogenic induction (Fig. 6A). TAZ protein levels were also higher in adipose tissue from Spry1-transgenic mice compared to controls (Fig. 8B). TAZ has been reported to bind to PPAR␥ and Runx2 and function in regulating the adipogenic and osteogenic events. When bound to PPAR␥, TAZ acts as a corepressor having an inhibitory effect on adipogenesis, while its binding to Runx2 functions as a coactivator to enhance osteogenesis in MSC (23, 24). In a recent study, FGF-2 was reported to be a negative regulator of TAZ protein levels in MC3T3-E1 cells, in which TAZ levels were down-regulated in the presence of FGF-2; furthermore, removal of FGF-2 from the medium restored TAZ levels and the osteoblastic phenotype (25). On the basis of these results, our data support a model in which Spry1 inhibits one of its targets, the FGF signaling pathway, and regulate the adipogenic and osteogenic processes by suppressing the MAPK signaling via inhibition of ERK1/2 phosphorylation, leading to down-regulation of C/EBP- activation in the adipogenic lineage and enhanced expression of TAZ and its subsequent interaction with Runx2 and PPAR␥ (Fig. 8C).
DISCUSSION In this study, we demonstrate the role of Spry1 in fat cells during adipocyte differentiation using an in vivo aP2-Spry1 mouse model. Loss of Spry1 function resulted in a low bone mass and high body fat phenotype,
Figure 7. Sprouty expression induces changes in mRNA transcript levels. A) Bone marrow MSCs were cultured in osteoblast medium for 7 d, and indicated markers were analyzed by quantitative RT-PCR. All values shown are fold change normalized to undifferentiated confluent cultures of the same origin and to cyclophilin. B) Bone marrow MSCs were cultured in adipocyte medium and analyzed for transcript levels. C) ATSCs were cultured in osteogenic medium and analyzed for transcript levels. D) ATSCs were cultured in adipocyte medium and analyzed for indicated transcript levels. 3270
Vol. 24
September 2010
The FASEB Journal 䡠 www.fasebj.org
URS ET AL.
Figure 8. Spry1 regulation of C/EBP- and Twist1. A) Bone marrow MSCs were cultured in adipogenic medium for 7 d, and total RNA was collected for quantitative RT-PCR to detect C/EBP- and Twist1 mRNA. Values are shown as fold induction normalized to undifferentiated confluent cultures of the same origin and to cyclophilin. B) Abdominal fat tissue from 16-wk-old mice showing TAZ protein expression. C) Schematic model describing Spry1 regulation of adipocyte and osteoblast cell fate.
while gain-of-function studies provide evidence to support the hypothesis that Spry1 expression leads to enhanced bone mass accompanied by a reduction in body fat. These results advocate a significant interplay between cells of the bone and fat lineages and their commitment. Spry1 expression in chondrocytes (Col2a1 promoter) was previously shown to result in decreased chondrocyte proliferation and neonatal lethality along with other associated skeletal abnormalities brought about by the inhibition of FGF signaling (16). Unlike the Col2a1-Spry1 phenotype, aP2-Spry1 mice had normal embryonic development and postnatal growth and body weight. Spry1 expression in adipose tissue induced hypertrophy of abdominal fat cells with the individual cells adopting a large and lipid-filled phenotype, but significantly reduced cell number. Abdominal adipose tissue hypertrophy is considered to be a predominant characteristic of obese models associated with insulin resistance and type 2 diabetes, as seen in the aquaporin-null mouse (26) and the ob/ob mouse (27), particularly during the latter stages of obesity. Alternatively, hypertrophy of abdominal fat cells has also been described in lean models with reduced body fat as in the PPAR␥-null mice (28) and MOX2-Cre-PPAR␥-null mice (29), which have few, but large fat cells, reflecting the intensified demand for triglyceride storage. Unlike the homozygous hypomorphic PPAR␥2-null mice (28, 30), we postulate that Spry1 does not completely inhibit adipocyte formation or PPAR␥ activity, but moderately represses PPAR␥ expression. This repression results in a failure of adipocytes to adequately proliferate and differentiate as reflected by the decrease in adipogenic gene expression as also previously suggested (1). Spry1 expression in the transgenic mice did not alter blood serum glucose or insulin levels unlike the impaired insulin levels seen at 8 wk in the PPAR␥ haploinsufficient model (30). Therefore, hypertrophy in the aP2-mSpry1 mice was not a result of the metabolic syndrome, but a result of repressed adipocyte recruitment, proliferation, and differentiation. An ELISA-based determination of secreted growth factors from conditioned medium exposed to abdominal fat tissue of the transgenic and SPRY1 REDUCES BODY FAT AND INCREASES BONE MASS
control mice showed a decrease in FGF and consequently reduced vessel area in the abdominal fat tissue as determined by PECAM staining (data not shown) supporting the possibility that diminished FGF in the fat tissue impaired vessel recruitment. Additionally, aP2-Spry mice on a high-fat diet for 8 wk did not gain as much total body fat as the controls, even though their weights were similar (data not shown), indicating a possible protection from highfat diet-induced obesity and adipocyte hyperplasia. Further, on aging (40 wk), aP2-Spry1 mice had significantly decreased marrow adipocytes in the proximal tibia as compared to controls (data not shown), suggesting a protective role against marrow adiposity and potential therapeutic target for osteoporosis treatment. These findings indicate that dynamics in the MSC population can be altered due to the expression of Spry1 as an inhibitor of growth factor signaling. This alteration seems to shift the commitment of MSCs toward the osteoblastic over the adipogenic lineage—a lineage preference exhibited in the bone marrow milieu. This phenotype is consistent with the role for Spry1 in inhibiting FGF signaling. Since adipocytes share a common lineage with osteoblasts, myocytes, and neurons, our results support the theory of plasticity of bone marrow progenitors and switching of differentiation as a result of changes in gene expression patterns (30). Our study demonstrates that bone marrow populations support entry into an osteogenic lineage when Spry1 is expressed/activated at higher than endogenous levels and vice versa in the conditional Spry1 null. Although the resulting phenotype with higher bone mass and lower body fat has been reported in earlier studies targeting negative regulators of osteogenesis like PPAR␥ haploinsufficient mice (30) and DKK1-null mice (31), the effects of Spry1 are not dramatic. Spry1 gain-of-function mice have normal weight gain without visible lipodystrophy on a standard diet over the observation period of 40 wk, while the conditional nulls have similar weight and size during early stages, and begin to lose weight by 16 wk of age. In aP2-Spry1-transgenic mice, the lengths of the trunk and long bones were also similar to WT littermate controls (data not shown), 3271
much like the PPAR␥ haploinsufficient mice, indicating that PPAR␥ repression did not affect skeletal growth (30). Previously, a hypomorphic mutation in the PPAR␥2 locus was associated with a complete absence of PPAR␥2 expression along with a reduction in PPAR␥1 in white adipose tissue, and the mice exhibit severe lipodystrophy with lowered fat mass (28) and increased bone mass similar to the aP2-Spry1 gain-offunction phenotype described herein, supporting our hypothesis that PPAR␥ is the potential target molecule effected by Spry1. Spry1 regulation of PPAR␥ can be described in two mechanisms, both stemming from inhibition of the FGF-mediated MAPK signaling pathway and influencing C/EBP- and TAZ expression. Decreased ERK phosphorylation in committed cells suppresses C/EBP- and thereby PPAR␥. On the other hand, decreased FGF signaling can potentially lead to an increase in TAZ expression levels. TAZ interacts with a variety of transcription factors and exhibits transcriptional regulatory functions (32). TAZ acts as a coactivator of Runx2, the master regulator of osteoblast differentiation, and simultaneously, is a corepressor of PPAR␥, a critical regulator of adipocyte differentiation, thus playing an important role in balancing MSC differentiation (6, 24, 33). In addition, TAZ is involved in shuttling and nucleocytoplasmic localization of Smad 2/3– 4 complexes necessary for Smad nuclear accumulation to function as transcriptional regulators (34). TAZ expression depends on the presence of FGF, with FGF2 repressing TAZ expression, while removal of FGF2 from culture medium of MC3T3-E1 cells increased the level of TAZ protein restoring the osteoblastic morphology mediated by the SAPK/JNK signaling pathway (25). Therefore, Spry1 modulates PPAR␥ via C/EBP- and TAZ by inhibiting FGF signal pathway and functions as a transcription factor regulator determining lineage commitment of MSCs. In summary, we demonstrate that Spry1, an inhibitor of FGF signaling is a critical regulator of MSC lineage allocation, potentially through regulation of TAZ. The authors gratefully acknowledge the support of their histopathology core (K. Carrier and V. Lindner), mouse transgenic core (A. Harrington), animal facility personnel, and clinical and translational research laboratory services (P. Le and C.J.R.). This work was supported by U.S. National Institutes of Health (NIH) grants R01HL070865 (to L.L.), AR54604 (to C.J.R.), DK73871 (to R.E.F.) and P20RR1555 (PI: R.E.F.). The Histopathology Core Facility was supported by P20RR181789 (PI: D. Wojchowski), and the Mouse Transgenic Facility was supported by NIH grant P20RR1555 (PI: R.E.F.), both from the National Center for Research Resources.
2. 3.
4. 5.
6. 7.
8.
9.
10. 11. 12. 13. 14.
15.
16.
17.
18. 19.
20.
REFERENCES 21. 1.
3272
Bays, H. E., Gonzalez-Campoy, J. M., Bray, G. A., Kitabchi, A. E., Bergman, D. A., Schorr, A. B., Rodbard, H. W., and Henry, R. R. (2008) Pathogenic potential of adipose tissue and metabolic consequences of adipocyte hypertrophy and increased visceral adiposity. Expert Rev. Cardiovasc. Ther. 6, 343–368
Vol. 24
September 2010
22.
Duque, G. (2008) Bone and fat connection in aging bone. Curr. Opin. Rheumatol. 20, 429 – 434 Rodriguez, J. P., Astudillo, P., Rios, S., and Pino, A. M. (2008) Involvement of adipogenic potential of human bone marrow mesenchymal stem cells (MSCs) in osteoporosis. Curr. Stem Cell Res. Ther. 3, 208 –218 Rosen, C. J., and Klibanski, A. (2009) Bone, fat, and body composition: evolving concepts in the pathogenesis of osteoporosis. Am. J. Med. 122, 409 – 414 Lin, Y. F., Jing, W., Wu, L., Li, X. Y., Wu, Y., Liu, L., Tang, W., Long, J., Tian, W. D., and Mo, X. M. (2008) Identification of osteo-adipo progenitor cells in fat tissue. Cell Prolif. 41, 803– 812 Rosen, E. D., and MacDougald, O. A. (2006) Adipocyte differentiation from the inside out. Nat. Rev. Mol. Cell. Biol. 7, 885– 896 Newell, F. S., Su, H., Tornqvist, H., Whitehead, J. P., Prins, J. B., and Hutley, L. J. (2006) Characterization of the transcriptional and functional effects of fibroblast growth factor-1 on human preadipocyte differentiation. FASEB J. 20, 2615–2617 Kakudo, N., Shimotsuma, A., and Kusumoto, K. (2007) Fibroblast growth factor-2 stimulates adipogenic differentiation of human adipose-derived stem cells. Biochem. Biophys. Res. Commun. 359, 239 –244 Wakioka, T., Sasaki, A., Kato, R., Shouda, T., Matsumoto, A., Miyoshi, K., Tsuneoka, M., Komiya, S., Baron, R., and Yoshimura, A. (2001) Spred is a Sprouty-related suppressor of Ras signalling. Nature 412, 647– 651 Kim, H. J., and Bar-Sagi, D. (2004) Modulation of signalling by Sprouty: a developing story. Nat. Rev. Mol. Cell. Biol. 5, 441– 450 Guy, G., Jackson, R. A., Yusoff, P., and Chow, S. Y. (2009) Sprouty proteins: modified modulators, matchmakers or missing links? J. Endocrinol 203, 191–202 Cabrita, M. A., and Christofori, G. (2008) Sprouty proteins, masterminds of receptor tyrosine kinase signaling. Angiogenesis 11, 53– 62 Novakofski, J. (2004) Adipogenesis: usefulness of in vitro and in vivo experimental models. J. Anim. Sci. 82, 905–915 Widberg, C. H., Newell, F. S., Bachmann, A. W., Ramnoruth, S. N., Spelta, M. C., Whitehead, J. P., Hutley, L. J., and Prins, J. B. (2009) Fibroblast growth factor receptor 1 is a key regulator of early adipogenic events in human preadipocytes. Am. J. Physiol. Endocrinol. Metab. 296, E121–E131 Moyers, J. S., Shiyanova, T. L., Mehrbod, F., Dunbar, J. D., Noblitt, T. W., Otto, K. A., Reifel-Miller, A., and Kharitonenkov, A. (2007) Molecular determinants of FGF-21 activity-synergy and cross-talk with PPAR␥ signaling. J. Cell. Physiol. 210, 1– 6 Yang, X., Harkins, L. K., Zubanova, O., Harrington, A., Kovalenko, D., Nadeau, R. J., Chen, P. Y., Toher, J. L., Lindner, V., Liaw, L., and Friesel, R. (2008) Overexpression of Spry1 in chondrocytes causes attenuated FGFR ubiquitination and sustained ERK activation resulting in chondrodysplasia. Dev. Biol. 321, 64 –76 Basson, M. A., Akbulut, S., Watson-Johnson, J., Simon, R., Carroll, T. J., Shakya, R., Gross, I., Martin, G. R., Lufkin, T., McMahon, A. P., Wilson, P. D., Costantini, F. D., Mason, I. J., and Licht, J. D. (2005) Sprouty1 is a critical regulator of GDNF/RET-mediated kidney induction. Dev. Cell 8, 229 –239 Hughes, F. J. and Auben J. E (1998) Culture of cells of the osteoblast lineage, In Methods in Bone Biology (Arnett, R. T and Henderson, B., eds) pp. 1–39, Chapman and Hall, London Havrda, M. C., Johnson, M. J., O’Neill, C. F., and Liaw, L. (2006) A novel mechanism of transcriptional repression of p27kip1 through Notch/HRT2 signaling in vascular smooth muscle cells. Thromb. Haemost. 96, 361–370 He, W., Barak, Y., Hevener, A., Olson, P., Liao, D., Le, J., Nelson, M., Ong, E., Olefsky, J. M., and Evans, R. M. (2003) Adiposespecific peroxisome proliferator-activated receptor gamma knockout causes insulin resistance in fat and liver but not in muscle. Proc. Natl. Acad. Sci. U. S. A. 100, 15712–15717 Urs, S., Harrington, A., Liaw, L., and Small, D. (2006) Selective expression of an aP2/fatty acid binding protein 4-Cre transgene in non-adipogenic tissues during embryonic development. Transgenic Res. 15, 647– 653 Prusty, D., Park, B. H., Davis, K. E., and Farmer, S. R. (2002) Activation of MEK/ERK signaling promotes adipogenesis by
The FASEB Journal 䡠 www.fasebj.org
URS ET AL.
23.
24.
25. 26.
27.
28.
enhancing peroxisome proliferator-activated receptor gamma (PPAR␥) and C/EBP␣ gene expression during the differentiation of 3T3–L1 preadipocytes. J. Biol. Chem. 277, 46226 – 46232 Hong, D., Chen, H. X., Xue, Y., Li, D. M., Wan, X. C., Ge, R., and Li, J. C. (2009) Osteoblastogenic effects of dexamethasone through upregulation of TAZ expression in rat mesenchymal stem cells. J. Steroid. Biochem. Mol. Biol. 116, 86 –92 Hong, J. H., Hwang, E. S., McManus, M. T., Amsterdam, A., Tian, Y., Kalmukova, R., Mueller, E., Benjamin, T., Spiegelman, B. M., Sharp, P. A., Hopkins, N., and Yaffe, M. B. (2005) TAZ, a transcriptional modulator of mesenchymal stem cell differentiation. Science 309, 1074 –1078 Eda, H., Aoki, K., Marumo, K., Fujii, K., and Ohkawa, K. (2008) FGF-2 signaling induces downregulation of TAZ protein in osteoblastic MC3T3–E1 cells. Biochem. Biophys. Res. Commun. 366, 471–475 Hibuse, T., Maeda, N., Funahashi, T., Yamamoto, K., Nagasawa, A., Mizunoya, W., Kishida, K., Inoue, K., Kuriyama, H., Nakamura, T., Fushiki, T., Kihara, S., and Shimomura, I. (2005) Aquaporin 7 deficiency is associated with development of obesity through activation of adipose glycerol kinase. Proc. Natl. Acad. Sci. U. S. A. 102, 10993–10998 Medina-Gomez, G., Gray, S. L., Yetukuri, L., Shimomura, K., Virtue, S., Campbell, M., Curtis, R. K., Jimenez-Linan, M., Blount, M., Yeo, G. S., Lopez, M., Seppanen-Laakso, T., Ashcroft, F. M., Oresic, M., and Vidal-Puig, A. (2007) PPAR gamma 2 prevents lipotoxicity by controlling adipose tissue expandability and peripheral lipid metabolism. PLoS Genet. 3, e64 Koutnikova, H., Cock, T. A., Watanabe, M., Houten, S. M., Champy, M. F., Dierich, A., and Auwerx, J. (2003) Compensation by the muscle limits the metabolic consequences of lipodystrophy in PPAR gamma hypomorphic mice. Proc. Natl. Acad. Sci. U. S. A. 100, 14457–14462
SPRY1 REDUCES BODY FAT AND INCREASES BONE MASS
29.
30.
31.
32.
33. 34.
Duan, S. Z., Ivashchenko, C. Y., Whitesall, S. E., D’Alecy, L. G., Duquaine, D. C., Brosius, F. C., 3rd, Gonzalez, F. J., Vinson, C., Pierre, M. A., Milstone, D. S., and Mortensen, R. M. (2007) Hypotension, lipodystrophy, and insulin resistance in generalized PPAR␥-deficient mice rescued from embryonic lethality. J. Clin. Invest. 117, 812– 822 Akune, T., Ohba, S., Kamekura, S., Yamaguchi, M., Chung, U. I., Kubota, N., Terauchi, Y., Harada, Y., Azuma, Y., Nakamura, K., Kadowaki, T., and Kawaguchi, H. (2004) PPAR␥ insufficiency enhances osteogenesis through osteoblast formation from bone marrow progenitors. J. Clin. Invest. 113, 846 – 855 Morvan, F., Boulukos, K., Clement-Lacroix, P., Roman Roman, S., Suc-Royer, I., Vayssiere, B., Ammann, P., Martin, P., Pinho, S., Pognonec, P., Mollat, P., Niehrs, C., Baron, R., and Rawadi, G. (2006) Deletion of a single allele of the Dkk1 gene leads to an increase in bone formation and bone mass. J. Bone Miner. Res. 21, 934 –945 Lei, Q. Y., Zhang, H., Zhao, B., Zha, Z. Y., Bai, F., Pei, X. H., Zhao, S., Xiong, Y., and Guan, K. L. (2008) TAZ promotes cell proliferation and epithelial-mesenchymal transition and is inhibited by the hippo pathway. Mol. Cell. Biol. 28, 2426 –2436 Hong, J. H., and Yaffe, M. B. (2006) TAZ: a -catenin-like molecule that regulates mesenchymal stem cell differentiation. Cell Cycle 5, 176 –179 Varelas, X., Sakuma, R., Samavarchi-Tehrani, P., Peerani, R., Rao, B. M., Dembowy, J., Yaffe, M. B., Zandstra, P. W., and Wrana, J. L. (2008) TAZ controls Smad nucleocytoplasmic shuttling and regulates human embryonic stem-cell self-renewal. Nat. Cell Biol. 10, 837– 848 Received for publication February 2, 2010. Accepted for publication April 8, 2010.
3273
