Structural and binding properties of the PASTA ... - Wiley Online Library

Structural and Binding Properties of the PASTA Domain of PonA2, A Key Penicillin Binding Protein from Mycobacterium tuberculosis Luisa Calvanese,1 Lucia Falcigno,1,2,3 Cira Maglione,4 Daniela Marasco,2 Alessia Ruggiero,3 Flavia Squeglia,3 Rita Berisio,3 Gabriella D’Auria1,2,3 1

CIRPeB, University of Naples Federico II, Naples, Italy

2

Department of Pharmacy, University of Naples “Federico II,” via Mezzocannone 16, 80134, Naples, Italy

3

Institute of Biostructures and Bioimaging-CNR, via Mezzocannone, 16, 80134, Naples, Italy

4

Department of Chemical Sciences, University of Naples “Federico II,”, via Cintia 45, 80126, Naples, Italy

Received 2 September 2013; accepted 8 November 2013 Published online 27 November 2013 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/bip.22447

ABSTRACT: PonA2 is one of the two class A penicillin binding proteins of Mycobacterium tuberculosis, the etiologic agent of tuberculosis. It plays a complex role in mycobacterial physiology and is spotted as a promising target for inhibi-

cannot be generalized, as their specific binding properties strongly depend on surface residues, which are widely C 2013 Wiley Periodicals, Inc. Biopolymers 101: variable. V

712–719, 2014. Keywords: structure; binding; tuberculosis

tors. PonA2 is involved in adaptation of M. tuberculosis to dormancy, an ability which has been attributed to the presence in its sequence of a C-terminal PASTA domain. Since PASTA modules are typically considered as b-

This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at [email protected]

lactam antibiotic binding domains, we determined the solution structure of the PASTA domain from PonA2 and analyzed its binding properties versus a plethora of potential binders, including the b-lactam antibiotics, two typical muropeptide mimics, and polymeric peptidoglycan. We show that, despite a high structural similarity with other PASTA domains, the PASTA domain of PonA2 displays different binding properties, as it is not able to bind muropeptides, or b-lactams, or polymeric peptidoglycan. These results indicate that the role of PASTA domains Additional Supporting Information may be found in the online version of this article. Correspondence to: Rita Berisio; e-mail: [email protected] or Gabriella D’Auria; e-mail: [email protected] Contract grant sponsor: University of Naples “Federico II” (Ph.D. fellowship to F.S.) Contract grant sponsor: MIUR Contract grant numbers: PRIN 2009-prot; 200993WWF9 (to R.B. and A.R.) Contract grant sponsor: COST-Action BM1003 Contract grant number: COST-Grants-BM1003-00772) (to R.B. and A.R.) C 2013 Wiley Periodicals, Inc. V

712

INTRODUCTION

T

he special composition of the mycobacterial cell wall has a pivotal role in the pathogenesis of mycobacterial infections and represents a barrier which accounts for the exceptional resistance of this pathogen to many antibiotics.1 Beside an external mycolic acid layer, two glycosidic components constitute the cell wall, arabinogalactan and peptidoglycan (PGN), whose biosynthesis and metabolism are crucial processes for mycobacterial survival. The innermost layer of the cell envelope, PGN, is an essential bacterial cell wall polymer, formed by glycan chains of b-(1-4)-linked-N-acetylglucosamine and N-acetylmuramic acid (MurNAc) crosslinked by short peptide stems. Depending on the amino acid located at the third position of the peptide stem, PGN is classified as either Lys-type or meso-diaminopimelic acid (DAP)-type. Mycobacterium tuberculosis (Mtb), the etiologic agent of Tuberculosis, possesses a DAP-type PGN, whose modeling is a key process in

Biopolymers Volume 101 / Number 7

Structural and Binding Properties of the PASTA Domain of PonA2

important cellular events, including cell growth, cell division, and resuscitation from dormancy.2–11 Penicillin binding proteins (PBPs), so named because primary targets for b-lactam antibiotics, are the enzymes responsible for synthesis, maturation, and recycling of PGN.7 Based on their dimensions and other structural characteristics, PBPs have been grouped in several classes. Class A PBPs are highmolecular weight proteins which contain both a transglycosylase domain (TG) and a transpeptidase domain (TP) and are tethered to the cytoplasmic membrane by a transmembrane helix.7,12 Antibiotic activity of b-lactams is due to their ability to mimic the peptide stem, occupy the TP catalytic site, and inhibit PGN biosynthesis. The X-ray structure of PBP2x from Streptococcus pneumoniae in complex with cefuroxime shows the presence of two antibiotic molecules, one covalently bound to TP catalytic site and another sandwiched between the TP domain and the first of two homologous C-terminal noncatalytic domains.13 These domains are named as PASTA domains (PBP and Ser/Thr kinase Associated domain) as they exist in single or multiple copies in several PBPs as well as in bacterial Ser/Thr kinases.14 Due to their binding to cefuroxime, PASTA domains were defined as b-lactam binding modules.13,14 A novel role for PASTA domains was recently evidenced in Ser/ Thr kinases. Indeed, extracellular PASTA domains of PrkC from Bacillus subtilis were found to mediate resuscitation from dormancy induced by muropeptides.15 However, physical binding of muropeptides to the extracellular region of PrkC was found to involve only one of the three PrkC extracellular PASTA.16 Binding properties of the extracellular domain of PknB, a Ser/Thr kinase from Mtb also demonstrated that, as in the case of PrkC, PknB PASTA domains are able to preferentially bind DAP type muropeptides.17 Since PASTA domains are not known in eukaryotic cells and are specific for bacteria, they are often proposed as possible targets in new antibiotic therapies against resistant bacteria.18 However, whether the ability to interact with either b-lactams or muropeptides is a general property of PASTA domains is still to be elucidated. Mtb has been reported to have two genes that encode class A PBPs, PonA1 and PonA2. PonA2, which contains one PASTA domain, was shown to be important for the adaptation of Mtb in response to acidification, a typical mechanism used by macrophages against bacteria.19 Similarly, PonA2 homolog in M. smegmatis was found to be important for bacterial adaptation in response to starvation or anaerobiosis.20 To understand if the PASTA domain of PonA2 could play a role as a target for b-lactam antibiotics and/or as a sensor of muropeptides in the bacterial milieu, as observed for the Ser/Thr kinases PrkC and PknB,3,16,17,21 we determined its Nuclear Magnetic Resonance (NMR) structure and explored its binding properties toward the b-lactam antibiotics cefuroxime and cefotaxime, the muroBiopolymers

713

peptides L-Ala-gamma-D-Glu-mDAP and MurNAc-L-Alagamma-D-Glu-mDAP, and polymeric PGN. Results confirm a high conservation of the PASTA domain fold but highlight different behaviors and roles of these domains, likely depending on their specific surface residues.

RESULTS Structural Features of PonA2-PASTA In PonA2 sequence, four distinct regions can be identified: a transmembrane helix, a transglycosylase domain, a transpeptidase domain, and a C-terminal PASTA domain (Figure 1A). Based on sequence analysis, we have cloned and expressed the C-terminal PASTA domain of PonA2 (PonA2-PASTA, residues 700–764). PonA2-PASTA fold and stability were first evaluated using UV circular dichroism (CD) spectroscopy (Figure 1B). CD spectra witness a good degree of structural integrity of the domain. The analysis of thermal denaturation curves evidences that secondary structure of PonA2-PASTA is thermally stable, with a melting temperature (Tm) of 42 C (Figure 1C). Consistent with CD data, the 1H-15N heteronuclear single quantum coherence (HSQC) spectrum of 15N-labeled PonA2-PASTA domain shows a good dispersion of signals, indicative of a well-folded structure (Figure 2A). The 3D model shows a global topology consisting of an a-helical segment approaching a three stranded b-sheet (Figure 2B). The N-terminal helix, from Val12 to Ala22, is well defined by a dense set of Nuclear Overhauser Effect (NOE) effects. Extended conformation is found in the traits Ala27-Ser32 (b1), Gly40-Thr45 (b2) and, Val57-Ser62 (b3). The Root Mean Square Deviation (RMSD) values measured on backbone atoms (10 structures) of b1, b2, and b3 strands are all < 0.11 6 0.06 A˚. The orientation of helix a1, determined by NOE contacts between side chains from pre-helix (Ala8-Gly9) and b2 residues (Val42-Val43), is parallel to the strand b2. Phe24 and Tyr39, the only aromatic residues in the sequence, are both localized in loop regions. Numerous unambiguous long range NOEs involving Phe24 aromatic protons and Val4, Leu19, Gly39, and Val57 side chains define the structure of the hydrophobic core. N- and C-terminus residues Ser2 and Asn63 participate in the long range NOEs network with loop nuclei. Backbone flexibility was tested by analyzing relaxation measurements performed on 15N backbone nuclei (Supporting Information Figure S1A–S1D). {1H}-15N heteronuclear NOEs are uniform along the sequence (average value 0.82 6 0.05), except for the more flexible residues R3 (0.71), G9 (0.75), Q50 (0.73), I52 (0.75), and C-terminal residue I65 (0.64). 15 N R2/R1 ratios show an average value over the sequence of 3.27 6 0.37 with the maximum mean value in correspondence to a-helix (3.59 6 0.17), and mean values of 3.49 6 0.31,

714

Calvanese et al.

FIGURE 2 (A) [1H,15N]-HSQC spectrum of PonA2-PASTA. (B) Cartoon representation of the best 40 CYANA structures of PonA2PASTA. FIGURE 1 (A) Definition of domain boundaries in PonA2, as predicted by Protein Family Database (PFAM). (B) CD spectrum and (C) thermal unfolding of PonA2-PASTA.

to those of STPKs (Table II and Supporting Information Table S1).

Binding to b-Lactams 3.19 6 0.33, 3.10 6 0.36 for b1, b2, b3 strands, respectively. The first two loops show similar motility, with R2/R1 ratios of 3.13 6 0.18 (residues 23–26) and 3.37 6 0.23 (residues 33–39) while a lower mean value, 3.04 6 0.20, is observed for the largest loop of the sequence (residues 45–56). The N-terminal trait (residues 3–11) shows the lowest mean R2/R1 ratio, 2.94 6 0.29. Globally, PonA2-PASTA relaxation profile is consistent with a compact domain with a more flexible, albeit still well structured, N-terminal tail. Relevant structural parameters and statistics, evaluated by protein structure validation suite (PSVS), are given in Table I. The topology of PonA2-PASTA is typical of PASTA domains, consisting of an N-terminal a-helix followed by a three strand b-sheet with b1b3b2 arrangement.13,21 Interestingly, superposition of the NMR structure of PonA2-PASTA with most similar available structures shows a higher structural similarity with PASTA domains of STPKs than to that of PBP2x family (Table II). This finding well correlates with the lower sequence identity of PonA2-PASTA with PASTA domains of PBP2x, compared

The crosspeaks distribution in protein [1H-15N] HSQC maps represents an efficient way to detect structural changes in response to molecular binding.22 To test the possible ability of PonA2-PASTA to interact with b-lactam antibiotics, we performed titrations with the two b-lactams cefuroxime and cefotaxime (Supporting Information Figure S2), using ligand:protein ratios up to 100. In all cases, we observed no significant chemical shift perturbations in the [1H-15N]-HSQC spectra upon ligand addition, this indicating that PonA2PASTA is unable to bind b-lactam antibiotics. This result, which was also confirmed using isothermal titration calorimetry (ITC) (data not shown), differs from that observed for PASTA1 region of PBP2x, which was found to bind cefuroxime. However, the crystal structure of PBP2x complex (pdb code 1qmf) shows that the cefuroxime molecule bound to PASTA1 also interacts with TP domain (Figure 3A). Ligand binding is stabilized by interactions with hydrophobic residues from both domains and by hydrogen bonds with the TP residues Pro424 and Arg426. The hydrophobic residues of PBP2x-PASTA1 involved in drug binding, for example, Gly647, Ala650, Val662, Biopolymers


715

Table I PSVS Statistics for the Ensemble of 10 Structures Calculated for PonA2-PASTA (Residues 3–65) NOE based distance constraints Totala Intraresidue [i 5 j] Sequential [ji 2 jj 5 1] Medium range [1 0.5 A˚ RMS of distance violation/constraint Maximum distance violation Dihedral angle violations/structure 1–10 >10 RMS of dihedral angle violation/constraint Maximum dihedral angle violation RMSD values All backbone atoms All heavy atoms Ramachandran plot (%) Most favored region Additionally allowed region Generously allowed region Disallowed region a

465 189 133 38 105 87 552

26.4 7.8 13.3 0.13 A˚ 1.17 A˚ 10.8 0 0.74 4.70 0.4 A˚ 0.8 A˚ 89 11 0 0

Distance constraints which excluded fixed intraresidue distances.

are structurally equivalent in PonA2-PASTA to the polar Asp13, Arg16, and Thr30, respectively (Figures 3B and 3C). In addition, binding of b-lactams to the isolated PASTA domain of PBP2x has never been proven. Consistently, we observed by docking experiments that the binding mode observed in the X-ray structure of PBP2x does not rank among best solutions (data not shown).

Binding to PGN Fragments PASTA domains were also previously proposed to act as sensors of muropeptides and mediate complex mechanisms like Table II Comparison of PonA2-PASTA with Closest PASTA Domains STPK class STPK class PknBPrkCPASTA3 PASTA3 Sequence identity vs. PonA2-PASTA (%) RMSD vs. PonA2-PASTA (A˚)

Biopolymers

PBP class PBP2x_ PASTA1

38.5

25.0

11.5

1.9

1.6

2.1

FIGURE 3 (A) Detail of PBP2x-cefuroxime complex (1QMF) focusing the interactions of the cefuroxime molecule (KEF, in cyan) with TP and PASTA1 domains. (B and C) Ribbon representation of PBP2x-PASTA and PonA2-PASTA, respectively. Examples of structurally equivalent residues in the two domains, among those involved in PBP2x-PASTA drug binding, are drawn in stick representation.

bacterial revival from dormancy.15,16 In this scenario, hydrolysis of the PGN hydrolases is the first step, that has the twofold effect to alter the mechanical properties of the cell wall and produce specific PGN fragments.3–5 To investigate whether a similar muropeptide-sensing mechanism is mediated by PonA2-PASTA, we analyzed its possible binding to L-Alagamma-D-Glu-mDAP (Tri-DAP) and MurNAc-L-Ala-gammaD-Glu-mDAP (M-Tri-DAP), two muropeptides typically used to mimic the PGN peptide stem. Using NMR titration experiments, we observed that the addition to PonA2-PASTA of increasing concentrations (ligand:protein ratios up to 100) of either Tri-DAP or M-TriDAP induced no significant chemical shift perturbations in the [1H-15N]-HSQC spectra. To bounce the typical experimental limitations of single techniques, we further adopted complementary approaches, like surface plasmon resonance (SPR) and ITC. As a result, we observed no significant Response Units (RU) variation in all SPR assays (Figure 4). Consistently, ITC experiments showed no heat of complex formation on addition of either Tri-DAP or M-Tri-DAP at concentrations up to the millimolar range (Figure 4). We conclude that PonA2-PASTA is unable to bind either Tri-DAP or M-Tri-DAP at elevated concentrations (Figure 4).

716

Calvanese et al.

FIGURE 4 (A) Overlay of SPR sensograms recorded using M-Tri-DAP to PonA2-PASTA molar ratios in the range 0–100. (B) ITC experiment of PonA2-PASTA with M-Tri-DAP (ligand:protein molar ratio of 20).

PGN Binding Assays To determine whether PonA2-PASTA may act by directing the protein on intact PGN, we tested its ability to associate with polymeric PGN fractions. Since PASTA domains are commonly considered as b-lactam binding modules and b-lactam molecules emulate the structure of the D-Ala-D-Ala sequence in the peptide stems of PGN, we analyzed the binding of PonA2PASTA to both DAP- (from Bacillus subtilis) and Lys-type (from Micrococcus luteus) PGN, which share the D-Ala-D-Ala sequence and differ in the third amino-acid residue of their peptide stems. In both cases, incubation of PonA2-PASTA with polymeric PGN did not cause a significant amount of protein to separate with the insoluble fraction after centrifugation, but PonA2PASTA remained in the supernatant as unligated protein (Figure 5). Differently, clear binding was observed with both PGN types in our positive controls, the catalytic domain of the cell division protein RipA from Mtb.4 These data clearly show that PonA2PASTA is unable to bind to either DAP-type or Lys-type PGN.

DISCUSSION A combination of experimental and computational approaches was used to gather insights into the structure

and binding properties of the PASTA domain of the PBP PonA2 from Mtb. Beside elucidating the structural properties of this domain, our main interest was to understand if this domain may be a possible target for muropeptides or b-lactam antibiotics. Indeed, it was previously shown that b-lactam antibiotic cefuroxime binds one of the two PASTA domains of the penicillin binding protein PBP2x from S. peumoniae.13,22 However, if this is a general property of PASTA domains is hitherto not clear. PASTA-containing proteins have been often proposed as interesting targets for b-lactam antibiotics, to be considered in the future for the design of new antimicrobials. We determined the NMR structure of PonA2-PASTA and confirmed that the PASTA fold is highly conserved, in spite of the low sequence identities existing among PASTA domains that can be as low as 5%. In addition, we observed that PonA2-PASTA is unable to bind the b-lactam antibiotics cefuroxime and cefotaxime. NMR titration studies together with ITC and SPR experiments also show that PonA2-PASTA does not bind either of the two muropeptides Tri-DAP and M-Tri-DAP (Figure 4) or to polymeric PGN (Figure 5). These data differ from those previously observed for PASTA domains of the Ser/Thr kinases PrkC and PknB.16,17 On the other hand, we previously showed that only one of the three PASTA domains of PrkC is able to Biopolymers


717

FIGURE 5 Binding assays to PGN. Left panel refers to experiments with DAP-type PGN from B. subtilis: Lanes 1, 2, and 3 contain PonA2-PASTA in the supernatants (unbound) and in two successive washes, respectively. Lane 4 refers to treatment of PGN pellet with SDS 2%. Lanes 5–8 contain equivalent experiments using the cell division protein RipA332–472 as positive control. Right: Corresponding experiments carried out using Lys-type PGN from M. luteus.

bind muropeptides,16 this suggesting that binding properties do not necessarily correlate with folding characteristics. Although the importance of the PASTA domain on PonA2 function is still to be clarified, our results point to a structural role and not necessarily muropeptide sensing or PGN binding roles. Likely, the role of PonA2 in adaptation of Mtb cultures to the stationary phase20 is not to be ascribed to the sensing of muropeptides by the PASTA domain, but to more complex and indirect phenomena. Consistently, it was shown that important characteristics of mycobacteria, like the electrostatic nature of the surface, differ depending on the growth phase.20 In this respect, the proven importance of PonA2 in ensuring Mtb survival at low pH19 may make this protein essential to dormancy adaptation. Finally, we conclude that the role traditionally assigned to PASTA domains, considered as “b-lactam binding domains”14 or as muropeptide sensors3,16,17 cannot be generalized. Despite a strong structure conservation between PonA2-PASTA and other PASTA domains, specific properties of PASTA domains as b-lactam or muropeptide binders strongly depend on surface residues, which are widely variable.

MATERIALS AND METHODS Cloning, Expression, and Purification The region encoding amino acids G700 to I764 of PonA2 was amplified by Polymerase Chain Reaction (PCR) using genomic DNA of Mtb as template (H37Rv strain) and the following oligonucleotides as primers (ponA2 forward: CATGCCATGGGCTCACGGGTACCAAGC; ponA2 reverse: CCCAA GCTTATCAGATGCCGTTGCTGATCTGG). NcoI/HindIII-digested fragments were cloned into the pETM-11 vec-

Biopolymers

tor. The plasmid was used to transform E. coli Star BL21(DE3) competent cells. Transformed cells were cultured overnight in LuriaBertani broth with 50 mg ml21 kanamycin at 37 C. For the production of isotope-labeled sample (15N/13C), the culture was seeded in 1:100 volume ratio either in 1 l of minimal media (M9) containing (422 mM Na2HPO4, 220 mM KH2PO4, 85.5 mM NaCl, 186.7 mM of 15 N ammonium chloride, 1 mM MgSO4, 0.2 mM CaCl2, 1 ml Thiamine 40 mg ml21, and 0.3% final of 13C-glucose). Culture was grown at 37 C in a shacking incubator, induced with 0.7 mM Isopropyl bD-1-thiogalactopyranoside (IPTG), and grown at 22 C for 18 h for protein production. E. coli cells were harvested by centrifugation at 6000 rpm for 20 min, and the pellet was resuspended in a buffer containing 300 mM NaCl, 50 mM Tris-HCl, 10 mM imidazole, 5% (v/v) glycerol and complete protease inhibitor cocktail, pH 8, and lysed by sonication on ice. The cell lysate was centrifuged at 16,500 rpm at 4 C for 30 min, and the supernatant was loaded on Ni21-derivatized HisTrap columns (GE Healthcare). A linear gradient of imidazole (5–300 mM) was applied to elute the protein, which was then dialyzed against a buffer containing 150 mM NaCl, 50 mM Tris-HCl, 5% glycerol, pH 8.0 at 4 C for 4 hours and then digested with Tobacco Etch Virus endopeptidase (TEV) protease to remove the 63 His tag. This sample was further purified by a second Ni21 affinity chromatography and gel filtration on Superdex75 with a buffer containing 150 mM NaCl, 50 mM Tris-HCl, pH 8. The protein was concentrated using a centrifugal filter device (Millipore) with a cut-off of 3 kDa, and the concentration was determined using the Pierce BCA Protein Assay Kit. The fresh concentrated protein (1 mM) was dialyzed against the NMR buffer containing 30 mM sodium phosphate buffer pH 6.5. 15 N/13C labeled protein was prepared with 5% of sodium azide and 10% of deuterated water for NMR experiments.

CD CD spectra were recorded with a Jasco J-810 spectropolarimeter equipped with a Peltier temperature control system (Model PTC-423S). Molar ellipticity per mean residue, [h] in deg cm2 dmol21, was

718

Calvanese et al.

calculated from the equation: [h] 5 [h]obsmrw(10lC)21, where [h]obs is the ellipticity measured in degrees, mrw is the mean residue molecular mass (100.45 Da), C is the protein concentration in g l21, and l is the optical path length of the cell in cm. Far-UV measurements (190–260 nm) were carried out at 20 C using a 0.1-cm optical path length cell and a protein concentration of 0.2 mg ml21.

PonA2-PASTA sample at the concentration of 200 mM by NMR experiments recorded at 298 K and 600 MHz. Seven relaxation delays were used both for R1 (0.01, 0.05, 0.1, 0.3, 0.6, 0.8, 1 s) and R2 (0.01, 0.03, 0.07, 0.09, 0.13, 0.15, 0.19 s) measurements. 15N-{1H} heteronuclear steady state NOEs were measured with recycling time of 5 s and 3 s of proton saturation period.

PonA2-PASTA Homology Modeling

NMR Binding Studies

The template for modeling PonA2-PASTA domain was identified in the PDB using the HHpred program.23 Best template was the structure of the PASTA domain from PknB of Mtb (PDB ID: 2kui, residues 493–558, sequence identity 36%, E-value of 1.9 3 10215). The molecular models of PonA2-PASTA was built using Modeller6v2.24

Binding studies were performed by means of a series of 2D [1H-15N] HSQC experiments acquired on 200 mM PonA2-PASTA solutions at different values of ligand:protein ratio (0–10). Cefuroxime, cefotaxime, M-Tri-DAP, and Tri-DAP titrations were performed by sequential additions of microvolumes of ligand solutions, up to a ligand:protein ratio of 100.

NMR Analysis All NMR experiments were recorded at 298 K on Inova 600 MHz spectrometer (1H-15N experiments), equipped with a cryogenic probe optimized for 1H detection, or Varian Inova 500 MHz (1H-13C-15N triple resonance experiments), using the standard pulse sequences. NMR samples consisted of approximately 1.4–1.8 mM either unlabeled or uniformly 15N or 15N-13C doubly labeled protein dissolved in 30 mM sodium phosphate (pH 6.4), 0.02% sodium azide, and 10% 2 H2O. 1H chemical shifts were directly referenced to the methyl resonance of 3-(Trimethylsilyl)propionic-2,2,3,3-d4 acid sodium salt (TSP), while 13C and 15N chemical shifts were referenced indirectly to the absolute 13C/1H or 15N/1H frequency ratios. The 1H-15N-HSQC spectra were recorded with a number of complex points (cp) and acquisition times equal to 128 cp and 64 ms for 15N (F1 dimension) and 1024 cp and 146 ms for 1H (F2 dimension). The assignment of 1H and 15N resonances was achieved using a suite of heteronuclear 2D and 3D spectra: 1H-15N-HSQC, 3D [1H, 15NH]-TOCSY-HSQC, and 3D [1H, 15NH]-NOESYHSQC. The assignment was extended to 13C resonances and globally assessed by analyzing HCCH-TOCSY and triple resonance (HNCO, HNCACB, CBCA(CO)NH) experiments. NMR experiments were processed using the software Varian (VNMR 6.1B). The CARA program was used to analyze and assign the spectra.25 Globally, the NMR analysis of the double labeled (15N-13C) PonA2PASTA allowed us to confidently assign 98% of the resonances. The structure calculation was performed by CYANA 2.1 program26 starting from 150 random conformers. 3D structure of PonA2-PASTA was determined based on 465 experimental NOE constraints and 87 constraints on / and u torsion angles as obtained on the basis of backbone (HN, 15N, 13Ca, 13C0 , 13Cb) chemical shifts using TALOS1. The 40 conformers with the lowest final CYANA target function values (TF average value 5 1.68 6 0.19 A˚2) showed an average backbone RMSD 5 0.73 6 0.38 A˚ and an average heavy atom RMSD 1.32 6 0.33 A˚. The N-terminal tail (residues 1–11) shows an average backbone RMSD 5 0.83 6 0.39 A˚. Structure validation was performed using PROCHECK-NMR25 and WHATIF.27 The molecular graphics program MOLMOL28 was used to perform the structural statistics analysis. Coordinates have been deposited in the PDB with accession code 2mgv. NMR data for PonA2-PASTA domain are deposited at BMRB with accession code 19605.

NMR Relaxation Measurements Backbone 15N relaxation parameters (R1, R2, and heteronuclear NOE, Supporting Information Figure S1) were obtained for 15N-labeled

SPR Experiments Real-time binding assays were performed on Biacore 3000 SPR instrument using Streptavidin-coated chip. To this aim, PonA2 was monobiotinylated reported, and biotinylation was confirmed by Liquid chromatography-mass spectrometry (LC-MS) analysis ascertaining the MW increase by 340 amu due to the biotin moiety. SPR experiments were performed with an immobilization level of 1000 RU, using previously adopted protocols.29 Stock solutions of M-Tri-DAP and Tri-DAP at 15 and 25.6 mM, respectively, were diluted in running Hepes Buffered Saline (HBS) (10 mM Hepes, 150 mM NaCl, 3 mM EDTA, pH 7.4) and injected as analyte (flow rate 20 ll/min, injection volume 90 ll) at various concentrations in the range 0.2–2.4 mM.

ITC ITC experiments were carried out to investigate the possible binding of PonA2-PASTA to Tri-DAP and M-Tri-DAP and to the b-lactam antibiotics cefuroxime, cefotaxime, and penicillin G. Two protein concentrations, 50 and 100 mM, and several ligand:protein molar ratios, from 0 to 100, were explored in 30 mM sodium phosphate buffer, pH 7.5.

PGN Binding Assays Purified PGN from Bacillus subtilis (DAP-type) and from Micrococcus luteus (Lys-type) were used to assay the ability of PonA2-PASTA to bind polymeric PGN. Purified protein (50 lg) was added to PGN (40 lg), resuspended in 125 mM NaCl, 4 mM MgCl2, 25 lM sodium phosphate, pH 6.8, and incubated for 2 h at room temperature. The mixture was centrifuged in a microfuge (14,000 rpm, 15 min) to separate the soluble and insoluble fractions. After removal of the supernatant, the pellet was washed with fresh buffer, and the mixture was centrifuged again. This procedure was repeated twice. The resulting supernatant and pellet fractions were analyzed with Sodium Dodecyl Sulphate - PolyAcrylamide Gel Electrophoresis (SDS-PAGE) with Coomassie blue staining.

G.D. and L.F. acknowledge the NMR laboratory of the Second University of Naples—Dipartimento di Scienze e Tecnologie Ambientali Biologiche e Farmaceutiche and, in particular, Dr. Gaetano Malgieri and Dr. Maddalena Palmieri for their kind collaboration.

Biopolymers


REFERENCES 1. Morandi, M.; Sali, M.; Manganelli, R.; Delogu, G. J Infect Dev Ctries 2013, 7, 169–181. 2. Ruggiero, A.; Marchant, J.; Squeglia, F.; Makarov, V.; De Simone, A.; Berisio, R. J Biomol Struct Dyn 2013, 31, 195–205. 3. Ruggiero, A.; De Simone, P.; Smaldone, G.; Squeglia, F.; Berisio, R. Curr Protein Pept Sci 2012, 13, 756–766. 4. Ruggiero, A.; Marasco, D.; Squeglia, F.; Soldini, S.; Pedone, E.; Pedone, C.; Berisio, R. Structure 2010, 18, 1184–1190. 5. Ruggiero, A.; Tizzano, B.; Pedone, E.; Pedone, C.; Wilmanns, M.; Berisio, R. J Mol Biol 2009, 385, 153–162. 6. Correale, S.; Ruggiero, A.; Capparelli, R.; Pedone, E.; Berisio, R. Acta Crystallogr D Biol Crystallogr 2013, 69, 1697–1706. 7. Sauvage, E.; Kerff, F.; Terrak, M.; Ayala, J. A.; Charlier, P. FEMS Microbiol Rev 2008, 32, 234–258. 8. Mukamolova, G. V.; Turapov, O. A.; Young, D. I.; Kaprelyants, A. S.; Kell, D. B.; Young, M. Mol Microbiol 2002, 46, 623–635. 9. van Gunsteren, W. F.; Berendsen, H. J.; Hermans, J.; Hol, W. G.; Postma, J. P. Proc Natl Acad Sci USA 1983, 80, 4315–4319. 10. Chao, M. C.; Kieser, K. J.; Minami, S.; Mavrici, D.; Aldridge, B. B.; Fortune, S. M.; Alber, T.; Rubin, E. J. PLOS Pathogens 2013, 9, e1003197. 11. Chao, M. C.; Rubin, E. J. Annu Rev Microbiol 2010, 64, 293– 311. 12. Sung, M. T.; Lai, Y. T.; Huang, C. Y.; Chou, L. Y.; Shih, H. W.; Cheng, W. C.; Wong, C. H.; Ma, C. Proc Natl Acad Sci USA 2009, 106, 8824–8829. 13. Dessen, A.; Mouz, N.; Gordon, E.; Hopkins, J.; Dideberg, O. J Biol Chem 2001, 276, 45106–45112. 14. Yeats, C.; Finn, R. D.; Bateman, A. Trends Biochem Sci 2002, 27, 438. 15. Shah, I. M.; Laaberki, M. H.; Popham, D. L.; Dworkin, J. Cell 2008, 135, 486–496.

Biopolymers

719

16. Squeglia, F.; Marchetti, R.; Ruggiero, A.; Lanzetta, R.; Marasco, D.; Dworkin, J.; Petoukhov, M.; Molinaro, A.; Berisio, R.; Silipo, A. J Am Chem Soc 2011, 133, 20676–20679. 17. Mir, M.; Asong, J.; Li, X.; Cardot, J.; Boons, G. J.; Husson, R. N. PLOS Pathogens 2011, 7, e1002182. 18. Maestro, B.; Novakova, L.; Hesek, D.; Lee, M.; Leyva, E.; Mobashery, S.; Sanz, J. M.; Branny, P. FEBS Lett 2011, 585, 357– 363. 19. Vandal, O. H.; Pierini, L. M.; Schnappinger, D.; Nathan, C. F.; Ehrt, S. Nat Med 2008, 14, 849–854. 20. Patru, M. M.; Pavelka, M. S., Jr. J Bacteriol 2010, 192, 3043– 3054. 21. Ruggiero, A.; Squeglia, F.; Marasco, D.; Marchetti, R.; Molinaro, A.; Berisio, R. Biochem J 2011, 435, 33–41. 22. Gordon, E.; Mouz, N.; Duee, E.; Dideberg, O. J Mol Biol 2000, 299, 477–485. 23. Hildebrand, A.; Remmert, M.; Biegert, A.; Soding, J. Proteins 2009, 77 (Suppl 9), 128–132. 24. Mathur, A.; Shankaracharya; Vidyarthi, A. S. J Mol Model 2012, 18, 3021–3023. 25. Cheng, T. J.; Sung, M. T.; Liao, H. Y.; Chang, Y. F.; Chen, C. W.; Huang, C. Y.; Chou, L. Y.; Wu, Y. D.; Chen, Y. H.; Cheng, Y. S.; Wong, C. H.; Ma, C.; Cheng, W. C. Proc Natl Acad Sci USA 2008, 105, 431–436. 26. Hett, E. C.; Chao, M. C.; Steyn, A. J.; Fortune, S. M.; Deng, L. L.; Rubin, E. J. Mol Microbiol 2007, 66, 658–668. 27. Rodriguez, R.; Chinea, G.; Lopez, N.; Pons, T.; Vriend, G. Bioinformatics 1998, 14, 523–528. 28. Koradi, R.; Billeter, M.; Wuthrich, K. J Mol Graph 1996, 14, 51– 55, 29–32. 29. Poletto, M.; Vascotto, C.; Scognamiglio, P. L.; Lirussi, L.; Marasco, D.; Tell, G. Biochem J 2013, 452, 545–557.

Reviewing Editor: Stephen Blacklow