Rueda et al. Microb Cell Fact (2016) 15:59 DOI 10.1186/s12934-016-0457-z
Microbial Cell Factories Open Access
RESEARCH
Structural and functional features of self‑assembling protein nanoparticles produced in endotoxin‑free Escherichia coli Fabián Rueda1,2,3, María Virtudes Céspedes3,4, Alejandro Sánchez‑Chardi5, Joaquin Seras‑Franzoso1,2,3,9, Mireia Pesarrodona1,2,3, Neus Ferrer‑Miralles1,2,3, Esther Vázquez1,2,3, Ursula Rinas6,7, Ugutz Unzueta3,4, Uwe Mamat8, Ramón Mangues3,4, Elena García‑Fruitós1,2,3,10 and Antonio Villaverde1,2,3*
Abstract Background: Production of recombinant drugs in process-friendly endotoxin-free bacterial factories targets to a lessened complexity of the purification process combined with minimized biological hazards during product applica‑ tion. The development of nanostructured recombinant materials in innovative nanomedical activities expands such a need beyond plain functional polypeptides to complex protein assemblies. While Escherichia coli has been recently modified for the production of endotoxin-free proteins, no data has been so far recorded regarding how the system performs in the fabrication of smart nanostructured materials. Results: We have here explored the nanoarchitecture and in vitro and in vivo functionalities of CXCR4-targeted, selfassembling protein nanoparticles intended for intracellular delivery of drugs and imaging agents in colorectal cancer. Interestingly, endotoxin-free materials exhibit a distinguishable architecture and altered size and target cell penetra‑ bility than counterparts produced in conventional E. coli strains. These variant nanoparticles show an eventual proper biodistribution and highly specific and exclusive accumulation in tumor upon administration in colorectal cancer mice models, indicating a convenient display and function of the tumor homing peptides and high particle stability under physiological conditions. Discussion: The observations made here support the emerging endotoxin-free E. coli system as a robust protein material producer but are also indicative of a particular conformational status and organization of either building blocks or oligomers. This appears to be promoted by multifactorial stress-inducing conditions upon engineering of the E. coli cell envelope, which impacts on the protein quality control of the cell factory. Keywords: Protein engineering, Recombinant proteins, Nanoparticles, Nanomedicine, Biomaterials, Biodistribution, E. coli, Endotoxin-free strains Background The physiological diversity of microorganisms makes them suitable platforms for the cost-effective fabrication of a diversity of substances and macromolecules, including emerging nanostructured materials such as metal deposits, polymeric granules, functional amyloids and viruses or virus-like protein assemblies [1]. Being highly *Correspondence:
[email protected] 1 Institut de Biotecnologia i de Biomedicina, Universitat Autònoma de Barcelona, Bellaterra, Cerdanyola del Vallès, 08193 Barcelona, Spain Full list of author information is available at the end of the article
versatile, environmentally friendly and fully scalable, microbial fabrication is in many aspects more convenient than chemical synthesis [2–4]. Microbial cells, namely bacteria and yeast, have been exploited as factories for the production of many protein drugs that have been approved for use in humans. Historically, Escherichia coli was the pioneering cell factory for protein production because of the well-known genetics and metabolism. However, the presence of endotoxins in the cell envelope of Gram-negative bacteria poses an up to now unsolvable obstacle in the use of this organism for drug production
© 2016 Rueda et al. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/ publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Rueda et al. Microb Cell Fact (2016) 15:59
[5]. Lipopolysaccharide (LPS) removal increases the complexity of protein purification processes, and it is recognized that LPS, even in low amounts, is a common contaminant of complex protein complexes such as bacteriophages [6] and also of plain recombinant proteins [7]. In fact, contaminant LPS and other cell envelope components are responsible for wrongly attributed biological effects of recombinant proteins tested in biomedical assays, and for poor biocompatibility (some examples can be found in [8–10]). In this context, Gram-positive bacteria, yeast and mammalian cells are endotoxin-free alternatives to E. coli, and their prevalence in protein drug production has steadily increased [11, 12], although not absent of problems. Very recently [13], endotoxin-free E. coli strains have been developed by fine multi-step mutagenesis as a way to merge the versatility of E. coli as an advantageous protein production platform in the absence of endotoxic contaminants in its products. Those strains have been proved efficient in the production of diverse soluble protein species [13] and also of inclusion bodies intended as smart topologies [14] or as functional amyloids for intracellular protein release [15]. We wanted here to explore how the production, functionalities and nanoarchitecture of a complex, virus-like protein nanoparticle (T22-GFPH6) designed as drug carrier [16] would be affected by the use of this particular fabrication platform. These particles are formed by a self-organizing, CXCR4-targeted polypeptide that accumulates, in the assembled form, in tumoral tissues of colorectal cancer animal models [16, 17]. Accumulation in tumor is promoted by the N-terminal peptide T22, which is a potent ligand of the cell surface cytokine receptor CXCR4 [16]. CXCR4 is overexpressed in colorectal cancer cells and linked to tumor aggressiveness [18]. The combination of the highly cationic T22 peptide with the C-terminal histidine tail in a modular protein promotes the self-assembly of the whole construct, favored by the bipolar charge distribution of the building block surface [19]. Recently, we have observed that strain-dependent genetic features of the producing bacteria impact on tumor targeting and on the whole-body biodistribution of the oligomeric construct upon its systemic administration [20]. Then, we were interested in dissecting the structure and activities of these tumor-homing nanoparticles when produced in endotoxin-free E. coli cells, whose complex genetic development might have resulted in relevant physiological shifts.
Methods Strains, plasmids and media
T22-GFP-H6 is a tumor-targeted modular protein that self-assembles as toroid nanoparticles of about 12 nm of
Page 2 of 12
diameter. These oligomers are fully stable in vivo upon tail vein administration in colorectal cancer mice models [17] and accumulate intracellularly in primary tumor and in metastatic foci [16]. T22-GFP-H6 protein nanoparticles were produced in the KPM22 L11-derivative [21], endotoxin-free strain KPM335 (msbA52, ΔgutQ, ΔkdsD, ΔlpxL, ΔlpxM, ΔpagP, ΔlpxP, ΔeptA, frr181) and its parental K-12 strain BW30270 (CGSC#7925– MG1655; F−, rph+, fnr+) with a wild-type LPS. The design of KPM335, based on the incorporation of nonreverting deletions of seven genes to disrupt Kdo biosynthesis and modifications of lipid IVA, prevents the strain from regaining the potential to synthesize normal LPS or endotoxically active lipid IVA derivatives through acquiring mutations. Also, E. coli K-12 MC4100 ([araD139], (argF-lac)169, λ—relA1, rpsL150, rbsR22, flb5301, deoC1, pstF25 StrepR) and BL21 Origami B [F− ompT hsdSB(r− B R m− B ) gal dcm lacY1 ahpC (DE3) gor522::Tn10 trxB (Kan , TetR)] (Novagen, Darmstadt, Germany) were used for protein production as controls. KPM335, BW30270 and MC4100 were transformed with plasmid pTrc99a, whereas Origami B was transformed with a pET22bderived plasmid. All expression plasmids contained the T22-GFP-H6 DNA sequence optimized by the codon usage of E. coli and have been described previously [20]. Bacteria were always grown in Lysogeny Broth (LB) rich media [22]. Part of the protein was produced with the assistance of the Protein Production Platform of CIBERBBN/IBB, at the UAB (http://www.nanbiosis.es/unit/ u1-protein-production-platform-ppp/). Competent cells and transformation
Cultures were grown overnight at 37 °C with shaking at 250 rpm and used as a 1/100 inoculum in 50 ml of LB. After reaching an optical density (OD550) between 0.2 and 0.4, MC4100, BW30270 and Origami B cultures were centrifuged (4000×g) at 4 °C for 15 min. Pellets were resuspended in 12.5 ml of cold and sterile 50 mM CaCl2 and incubated for 45 min in an ice bath. Cells were centrifuged again as described above and resuspended in 1.25 ml of cold and sterile 50 mM CaCl2 in glycerol (15 % v/v) to prepare aliquots of 200 µl and stored at −80 °C. To transform the cells, 40 ng of plasmid DNA were added to the competent cells. The mixtures were incubated on ice for 30–60 min, warmed up to 42 °C for 45 s and placed on ice for 30 s. After incubation, 800 µl of LB media were added, and transformed cells were incubated at 37 °C for 1 h. Finally, the cells were plated on LB-agar plates containing the corresponding antibiotic. In the case of KMP335 strain, cells were grown to an OD550 between 0.2 and 0.4, placed on ice for 20 min and sedimented by centrifugation (3100×g, 4 °C, 20 min). The pellets were centrifuged and resuspended successively in 40, 20 and
Rueda et al. Microb Cell Fact (2016) 15:59
10 ml of H2O (ice-cold and sterile), followed by a wash with 5 ml of 10 % glycerol (ice-cold and sterile). The final pellet was resuspended in 1 ml of 10 % glycerol (icecold and sterile) to prepare 50-µl aliquots for storage at −80 °C. Electrocompetent KPM335 cells were transformed by electroporation in pre-chilled 0.2 cm electroporation cuvettes using 50 µl of competent cells and 40 ng of plasmid DNA. Cells were pulsed using a Gene Pulser MX cell electroporator (Bio-Rad, Hercules, CA, USA) at 25 µF, 200 Ω, 2500 V and 4.7–4.8 ms. Immediately after the pulse, 800 µl of LB medium were added, and the mixture was incubated at 37 °C for 1 h. Cells were plated on LB-agar plates containing ampicillin (100 µg/ ml) and incubated at 37 °C overnight. Protein production and purification
Overnight cultures were inoculated in 500 ml of LB media with 100 µg/ml ampicillin in 2-L flasks. Streptomycin (at 30 µg/ml) was also added to MC4100 cultures, and tetracycline (100 µg/ml) and kanamycin (33 µg/ml) to Origami B cultures. Each culture was grown at 37 °C and 250 rpm to an OD550 of about 0.5 before isopropylβ-d-thiogalactoside (IPTG) was added to 1 mM to induce recombinant gene expression. T22-GFP-H6 was produced overnight at 20 °C with shaking (250 rpm) in all cases. After overnight production, cultures were centrifuged (3280×g, 4 °C, 40 min), and the cell pellets were resuspended in 20 mM Tris–HCl, pH 8.0, containing 500 mM NaCl, 20 mM imidazole (buffer A), and an EDTA-free protease inhibitor cocktail (Complete EDTA-free, Roche Diagnostics, Indianapolis, IN, USA). Intra-cellular protein was extracted by cell disruption using a French press (Thermo FA-078A) at 1100 psi, and purified by His-tag affinity chromatography using a 1-ml HiTrap Chelating HP column (GE Healthcare, Piscataway, NJ, USA) in an ÄKTA purifier FPLC (GE Healthcare). Protein separation was achieved with a linear imidazole gradient from 20 mM to 500 mM, by diluting 20 mM Tris–HCl, pH 8.0, plus 500 mM NaCl and 500 mM imidazole (buffer B) in buffer A, and fractions were collected and dialyzed against 166 mM NaHCO3, pH 7.4. The amount of protein was determined by Bradford’s assay [23], and the integrity of the protein was analyzed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by Western blot analysis as described below. Western blot analysis
Separated fractions were subjected to 10 % SDS-PAGE according to Laemmli’s method [24]. Protein was transferred to nitrocellulose membranes (GE Healthcare, Piscataway, NJ, USA) that were blocked overnight with 5 % skim milk in PBS. After blocking, membranes were
Page 3 of 12
incubated with anti-GFP antibody (1:500, sc-8334, Santa Cruz Biotechnology, Santa Cruz, CA, USA), followed by incubation with a secondary HRP-conjugated anti-rabbit IgG (H + L) antibody (Bio-Rad, Hercules, CA, USA) at a dilution of 1:2000. Protein bands were visualized with a solution of 25 % cold methanol, 0.2 % H2O2 and 0.65 mg/ml of 4-chloronaftol in PBS, and images were obtained using a GS800 Calibrated Densitometer scanner (Bio-Rad). Fluorescence intensity
Fluorescence intensity of T22-GFP-H6 was determined in a Varian Cary Eclipse fluorescence spectrometer (Agilent Technologies, Mulgrave, Australia) at excitation and emission wavelengths of 450 and 510 nm, respectively. Particle size and zeta potential
Size distribution and zeta potential of nanoparticles were measured by dynamic light scattering (DLS) at 633 nm (Zetasizer Nano ZS, Malvern Instruments Limited, Malvern, Worcestershire, UK). Samples were analyzed by triplicate averaging of fifteen single measurements. Mass spectrometry (MS) analysis
Purified protein was diluted 1:2 with H2O MilliQ and dialyzed against 50 mM of NH4HCO3 for 1.5 h. After dialysis, protein was mixed with a matrix of 2.6 dihydroxyacetophenone (1:1), and 1 µl of the mixture was deposited on a ground steel plate. Samples were analyzed using a lineal method in an UltrafleXtreme MALDI-TOF instrument (Bruker Daltonics, Bremen, Germany) with ion acceleration of 25 kV. Circular dichroism (CD)
CD measurements were carried out in a Jasco J-715 spectropolarimeter at 25 °C and 10 µM protein in 160 mM NaHCO3, pH 7.4. CD and high-tension (HT) voltage spectra were obtained over a wavelength range of 200– 250 nm at a scan rate of 50 nm/min, a response time of 0.5 s, and a bandwidth of 0.5 nm. Electron microscopy
To visualize the ultrastructure of protein nanoparticles by transmission electron microscopy (TEM), 2 µl of purified protein (0.2 mg/ml) were placed on carbon-coated copper grids for 1 min. Excess of sample was bloated and 2 µl of 1 % w/v uranyl acetate were added for negative staining. Samples were immediately visualized in a TEM Jeol JEM-1400 (Jeol Ltd., Tokyo, Japan) equipped with a Gatan CCD Erlangshen ES1000 W camera (Gatan Inc, Abingdon, UK) and operating at 80 kV. Ultrastructural analyses of nanoparticle morphology were complemented with imaging in a nearly native state with a
Rueda et al. Microb Cell Fact (2016) 15:59
Field Emission Scanning Electron Microscope (FESEM). For that, protein samples were directly deposited over silicon wafers (Ted Pella, Reading, CA, USA), air dried and observed with a high resolution in-lens secondary electron detector through a FESEM Zeiss Merlin (Zeiss, Oberkochen, Germany), operating at 2 kV. Analysis of cell internalization
HeLa cells were cultured at 37 °C in a humidified atmosphere with 5 % CO2 for 24 h and plated in treated 24 well plates (Nunclon surface, Nunc 150628) with MEM-α medium supplemented with 10 % fetal bovine serum (FBS) and 2 mM Glutamax (Gibco, Rockville, MD, USA). Later, medium was removed and the cells were washed with Dulbecco’s phosphate-buffered saline (DPBS). Then, 25 nM of T22-GFP-H6 in 250 µl Optipro supplemented with 2 mM l-glutamine was added. After incubation at 37 °C for 1 h, cells were treated with trypsin in DPBS (1 mg/ml) for 15 min, centrifuged at 300×g for 15 min, and pellets were resuspended in 300 µl DPBS. Samples were analyzed by flow cytometry using a FACSCanto system (Becton– Dickinson, Franklin Lakes, NJ, USA) with a 15 W aircooled argon-ion laser at 488 nm excitation for GFP. Confocal microscopy
HeLa cells were plated on a MatTek culture dish (MatTek Corporation, Ashland, MA, USA) at 150,000 cells/ plate and incubated at 37 °C for 24 h. After incubation, medium was removed to wash the cells twice with DPBS. Optipro medium supplemented with 2 mM l-glutamine and 25 nM T22-GFP-H6 were added, and cells were incubated at 37 °C for 1 h. To visualize the samples, plasma membranes and the nucleus were labeled using 2.5 mg/ml CellMask Deep Red and 0.2 mg/ml Hoechst 33342 (Molecular Probes, Eugene, OR, USA), respectively. A confocal laser scanning microscope TCS-SP5 (Leica Microsystems, Heidelberg, Germany) was used to analyze the samples, and the images were processed through the Imaris Bitplane software (Bitplane, Zurich, Switzerland). Determination of in vivo biodistribution
This study was approved by the Institutional Animal Ethics Committee. We implanted CXCR4-overexpressing SP5 human colorectal tumor line to generate subcutaneous colorectal tumors in swiss nude mice (Charles River, France) as previously described [16, 17]. When tumors reached ca. 500 mm3, mice were randomly allocated to Origami B, MC4100, KPM335, BW30270 or buffer-treated groups (N = 3–5/group). The experimental mice received a single intravenous bolus of the corresponding nanoparticle (500 μg in carbonate buffer, pH 7.4), whereas control mice received only buffer. Five
Page 4 of 12
hours after the administration, we measured ex vivo the fluorescence emitted by the nanoparticles accumulated in the whole and slice sectioned tumor and normal tissues (kidney, lung, and heart, liver and brain) using IVIS® Spectrum equipment (Perkin Elmer, Waltham, MA, USA). The fluorescence signal was digitalized, and after subtracting the autofluorescence, it was displayed as a pseudocolor overlay and expressed as Radiant efficiency. Data were corrected by the specific fluorescence emitted by the different nanoparticles. Signal difference between groups was determined by applying the non-parametric Mann–Whitney test. Histological and immunohistochemical evaluation
At necropsy, tumors were fixed with 4 % formaldehyde in PBS for 24 h and embedded in paraffin for histological and immunohistochemical evaluation. 4 µm sections, were processed as previously described [16, 17] and haematoxylin and eosin (H&E) stained for histological analysis, that was performed by two independent observers. We assessed CXCR4 membrane expression and nanoparticle cell internalization in tumor and normal tissues by IHC using primary anti-CXCR4 (1:300; Abcam, Cambridge, UK) or anti-GFP (1:100; Santa Cruz Biotechnology, CA, USA), and secondary HRP conjugated antibody, followed by chromogenic detection. We quantified the percentage of CXCR4-expressing cells in relation to the total cell number and their staining intensity, scoring each sample from 0 to 3 (where 3 is the maximal intensity) and multiplying both parameters to obtain its H-score. Representative pictures were taken using CellэB software (Olympus Soft Imaging v3.3, Tokyo, Japan) at 400×. Quantitative real‑time PCR
For isolation of total RNA, triplicate cultures of E. coli strains BW30270 and KPM335 were grown aerobically with shaking (250 rpm) at 37 °C in LB medium to the mid-exponential growth phase at an OD600 of 0.6–0.7. The bacterial cells were harvested in the presence of RNAprotect Bacteria Reagent for immediate RNA stabilization prior to RNA isolation using the RNeasy Mini Kit and on-column DNase treatment in accordance with the recommendations of the manufacturer (Qiagen). RNA concentrations were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific), and the integrity of the RNAs was verified with RNA Nano Chips in an Agilent 2100 Bioanalyzer. The Maxima First Strand cDNA Synthesis Kit was used to generate cDNA from 0.3 µg RNA following the manufacturer´s instructions (Thermo Scientific, Waltham, MA, USA). The cDNA levels of chaperone genes were then analyzed by quantitative real-time PCR (RT-qPCR) using a LightCycler 480 Instrument II with LightCycler 480 SYBR Green I Master
Rueda et al. Microb Cell Fact (2016) 15:59
Page 5 of 12
reaction mixes according to the instructions of the manufacturer (Roche Diagnostics). RT-qPCR was performed with an initial denaturation at 95 °C for 5 min, followed by 45 cycles of 10 s at 95 °C, 10 s at 60 °C, and 10 s at 72 °C. Each sample was analyzed in duplicate using 1:15 and 1:50 dilutions of the cDNAs and the gene-specific primers listed in Table 1. The primer pairs (Table 1) were designed following the rules of highest possible sensitivity and efficiency with the Primer3 2.3.4 plugin of the Geneious v9.0.5 software (Biomatters, Auckland, New Zealand). Relative expression levels of the target genes were normalized to the internal reference gene ihfB for the β-subunit of the integration host factor using the comparative 2−∆∆Ct method [25].
Results and discussion The self-assembling protein T22-GFP-H6 (Fig. 1a) was produced in the endotoxin-free strain KPM335 and its parental BW30270, as well as in MC4100 and Origami B strains, used in previous studies for the routine fabrication of T22-GFP-H6 nanoparticles. While the generation time of KPM335 has increased by about 50 % in comparison to the parental wild-type strain, no signs of instability, lysis, foaming or cell death could be observed. Table 1 Primers used for RT-qPCR Gene Primer
tig ibpA
Sequence
Amplicon length (bp)
ECtig353F
AGGGTCTGGAAGCGATCGAAG
301
ECtig653R
GGGAAGGTCACGTCGATGGT
ECibpA85F
CAGAGTAATGGCGGCTACCCT
299
ECibpA383R GCTTCCGGAATCACGCGTTC hscB
EChscB191F
CGTTAATGCGCGCGGAATATTTG
301
EChscB491R AGTTGTTCGGCACTGCTTCG hchA
EChchA398F TCGCGGATGTTGTTGCCAG
300
EChchA697R CGCCGAAGTACCAGGTGAGA grpE
ECgrpE278F
ACGAATTGCTGCCGGTGATTG
301
ECgrpE578R GCTACAGTAACCATCGCCGC groL dnaK
ECgroL583F
TTCGACCGTGGCTACCTGTC
ECgroL883R
GGGTTGCGATATCCTGCAGC
ECdnaK504F CATCAACGAACCGACCGCAG
301 300
ECdnaK803R TTTTCTGCCGCTTCTTTCAGGC clpB clpA cbpA
ECclpB426F
AATGCGTGGAGGTGAAAGCG
ECclpB725R
ATATCCAGCGCCAGTACCCG
ECclpA287F
AGTCCTCCGGTCGCAATGAG
ECclpA586R
CCAGCTCCTTCTCACGACCA
ECcbpA477F GCTGAATGTGAAGATCCCGGC
300 300 300
ECcbpA776R ACCAGACCTTTGCCTTTAACGC ihfBa a
ECihfB9F
GTCAGAATTGATAGAAAGACTTGCCACC 258
ECihfB266R
CGATCGCGCAGTTCTTTACCAG
Used for normalization of gene expression
In all cases, T22-GFP-H6 appeared as a stable full-length product showing the expected molecular mass of about 30 kDa (Fig. 1b). The steadily observed double band was probably due to different conformational species of the protein. When purified by His affinity chromatography from bacterial cell extracts, T22-GFP-H6 was eluted in two separated peaks (P1 and P2) irrespective of the strain used for production (Fig. 1c). P2 has been previously observed as the one containing protein materials more efficient in cell penetration assays [20]. MS of these P2 samples revealed the expected molecular masses of all protein variants with minor signs of proteolytic instability (more prevalent in MC4100 through the occurrence of a degradation fragment of 28.4 kDa; Fig. 1d), also confirming that the double band observed in blots (Fig. 1b) was indeed due to conformational variability instead to significant occurrence of truncated forms. Both protein yield and emitted fluorescence were significantly lower in KPM335 than in other strains (Fig. 2a), as well as the specific fluorescence emission of T22-GFP-H6 (Fig. 2b). While a moderate protein yield in recombinant KPM335 was not unexpected according to previous reports referring to different produced protein species [13], a specific fluorescence emission lower than that observed in its parental BW30270 (and in other reference strains) was indicative of a differential conformation of T22-GFP-H6 monomers or an alternate configuration of the resulting nanoparticles. The formation of nanoparticles was firstly confirmed by DLS, revealing a regular size of the material ranging between 10 and 15 nm, depending on the cell factory (Fig. 3a). Interestingly, and according to the above hypothesis of a particular organization of T22-GFP-H6 as produced in KPM335, P1 nanoparticles produced in this strain were particularly large, reaching around 75 nm in diameter (Fig. 3a). This variability did not result in appreciable modifications in the superficial charge of protein nanoparticles (Fig. 3b). The observed deviations in the size of protein materials were fully confirmed by TEM and FESEM morphometric analyses (Fig. 4). When analyzing penetrability into CXCR4+ HeLa cells in culture, a convenient in vitro model for T22-empowered nanoparticles [16], P2 materials resulted generically more efficient than P1’s (Fig. 5a). The exception found in Origami B cells is in agreement with previous observations [20], and it might be related to the less reducing cytoplasm in this bacterial strain and caused by a bottom-up impact of protein conformation on microscopic functioning of the particles in cell interfaces, associated to favored di-sulfide bridge formation in this factory. Cell penetrability of P2 particles was comparatively screened again by confocal microscopy and the enhanced performance of those produced in KPM335 fully confirmed
Rueda et al. Microb Cell Fact (2016) 15:59
c
BW30270
KPM335
MW
MC4100
b
a
Origami B
Page 6 of 12
mAU 1500
d 30649.940
Origami B Irrelevant proein peak
MC4100
1000
Origami B
KPM335 BW30270 30637.916 Peak 1
MC4100
30 % buffer B 30640.853
500
Peak 2
KPM335
20 % buffer B 30640.557 10 % buffer B 0
BW30270
min
40.0
50.0
60.0
Fig. 1 Protein production and purification. a Scheme of the modular T22-GFP-H6 building block. Sizes of boxes are only approximate and do not precisely correspond to the length of primary aa sequence. b Western blot of crude cell extracts of T22-GFP-H6-producing strains. MW indicates the molecular weight of selected markers. c His-tag affinity chromatography of T22-GFP-H6 produced in the different E. coli strains. Purification was performed using an imidazole concentration gradient. Buffer B contains 500 mM imidazole. d Maldi-TOF identification of T22-GFP-H6 produced in different E. coli strains and purified by affinity chromatography (P2)
Protein purification yield (mg)
8
b
**
Specific fluorescence (F.U/mg)
a
** 6
Origami B MC4100 KPM335 BW30270
4
*
2
0
P1
P2
P1
P2
Peak
P1
P2
P1
P2
16000
**
14000 12000 10000
**
8000 6000 4000 2000 0 P1
P2
P1
P2
Peak
P1
P2
P1
P2
Fig. 2 Quantitative analyses of T22-GFP-H6 production levels and activity. a Yield of T22-GFP-H6 produced in E. coli strains Origami B, MC4100, KPM335 and BW30270, upon purification, from 500 ml of original protein producing cultures. P1 and P2 indicate the main elution peaks 1 and 2. b Specific fluorescence of T22-GFP-H6 calculated by using the above data. Symbols mean significant differences: **p
