Structural Characterizations of Metal Ion Binding Transcriptional Regulator CueR from Opportunistic Pathogen Pseudomonas aeruginosa to Identify Its Possible Involvements in Virulence Angshuman Bagchi
Applied Biochemistry and Biotechnology Part A: Enzyme Engineering and Biotechnology ISSN 0273-2289 Volume 175 Number 2 Appl Biochem Biotechnol (2015) 175:649-656 DOI 10.1007/s12010-014-1304-5
1 23
Your article is protected by copyright and all rights are held exclusively by Springer Science +Business Media New York. This e-offprint is for personal use only and shall not be selfarchived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”.
1 23
Author's personal copy Appl Biochem Biotechnol (2015) 175:649–656 DOI 10.1007/s12010-014-1304-5
Structural Characterizations of Metal Ion Binding Transcriptional Regulator CueR from Opportunistic Pathogen Pseudomonas aeruginosa to Identify Its Possible Involvements in Virulence Angshuman Bagchi
Received: 30 March 2014 / Accepted: 15 October 2014 / Published online: 24 October 2014 # Springer Science+Business Media New York 2014
Abstract Pseudomonas aeruginosa is an opportunistic pathogen present in the environment. It is responsible behind a variety of diseases specifically the multidrug-resistant nosocomial infections and chronic lung infections in cystic fibrosis patients. One of the vital genes of the organism responsible for its multidrug-resistant behavior is the gene PA3523 which codes for the multidrug efflux transporter. The expression of PA3523 is regulated by the dimeric transcription factor CueR having helix-turn-helix DNA binding motif. So far, there have been no previous reports that depict the characterization of CueR protein from P. aeruginosa from a structural point of view. In the present work, an attempt has been made to characterize CueR protein by structural bioinformatics approach. The dimeric structure of CueR was built by comparative modeling technique. The dimeric model of CueR was then docked onto the corresponding promoter region of the PA3523 gene encoding the multidrug efflux transporter. The docked complex of promoter DNA with CueR protein was subjected to molecular dynamics simulations to identify the mode of DNA-protein interactions. So far, this is the first report that depicts the mechanistic details of gene regulation by CueR protein. This work may therefore be useful to illuminate the still obscure molecular mechanism behind disease propagation by P. aeruginosa. Keywords Transcriptional regulation . Molecular modeling . DNA-protein docking . Molecular dynamics simulations . Protein-DNA interactions
Introduction Pseudomonas aeruginosa is a gram-negative bacterium found mostly in soil, water, and inside a number of host organisms. This organism is an opportunistic pathogen particularly known as the causative agent of multidrug-resistant nosocomial infections. It is also the main cause behind chronic lung infections in patients diagnosed with cystic fibrosis. The effect of P. aeruginosa in cystic fibrosis patients is so severe that its establishment in the patients’ A. Bagchi (*) Department of Biochemistry and Biophysics, University of Kalyani, Kalyani, Nadia, India e-mail:
[email protected]
Author's personal copy 650
Appl Biochem Biotechnol (2015) 175:649–656
lungs is likely to be a permanent fixture of the patient’s life [1–10]. Recently, a P. aeruginosa strain with increased capability of antibiotic resistance was identified [7]. The most important characteristic of P. aeruginosa is the resistance against multiple drugs. One of the vital genes of the organism is the gene PA3523 which codes for the multidrug efflux transporter [11]. The expression of PA3523 is controlled by the transcription factor CueR. CueR is a transcriptional regulator having helix-turn-helix DNA binding motif, and it acts as a dimer in the presence of metal ions like Cu [12]. The CueR protein behaves similarly as MerR type transcriptional regulators. The C-terminal part of the CueR protein senses the particular environmental stimulus such as heavy metal ions. It was previously observed that the CueR gene coding the CueR protein is activated by the Las quorum-sensing system. Previous studies also revealed that the CueR-targeted promoter regions have a 19-bp spacer between the −10 and −35 regions. The CueR-targeted promoters also possess a characteristic dyad symmetry. The position of the promoter with respect to the start codon was also highly conserved. However, the dyad symmetry of the promoter region did not interfere with DNA binding by the CueR protein. The absence of metal ion prevents the formation of an open complex by CueR and RNA polymerase. However, the presence of metal ion induces a conformational change in CueR protein and thereby helps the protein to form the open complex with the help of RNA polymerase [13]. However, till date, no reports regarding the molecular mechanism of regulation of PA3523 gene by CueR protein are available. In the present scenario, an attempt has been made to explore the molecular mechanism of the involvements of CueR in the regulation of PA3523 gene expression. The computational model of CueR protein has been built as no structures of CueR protein from P. aeruginosa were available. The dimeric model of the CueR protein has been built and then docked with the known promoter DNA region of the PA3523 gene. The interactions between the DNA and the CueR protein were analyzed after molecular dynamics simulation of the DNA-protein complex. This computational analysis of the interactions between the promoter DNA and CueR protein is the first report that analyzes the involvements of the amino acid residues of CueR protein in the regulation of bacterial gene expression. This report would therefore pave the pathway for future genetic studies to identify the roles of the individual amino acids of CueR protein in bacterial gene regulation. The interaction analysis would also be useful to develop new drugs aiming to attack the important amino acid residues of CueR protein involved in binding to promoter DNA regions during the PA3223 gene expression.
Materials and Methods Sequence Analysis and Homology Modeling of CueR The amino acid sequence of CueR protein was obtained from GenBank (id: NP_253466.1) and was used to search the Brookhaven Protein Data Bank (PDB) [14] using the software BLAST [15] to find suitable template(s) for homology modeling. The best match from the BLAST search result was found to be the X-ray crystal structure of the Cu(I) form of CueR from E. coli (pdb code: 1Q05, Chain B) with 48 % sequence identity, 100 % query coverage, and E-value of 4×10−38. A homology model of the CueR protein was built using the software tool Modeller [16] with the B chain of 1Q05 as template. The modeled structure of the CueR protein was then superimposed on the crystal template without altering the coordinate system of atomic positions in the template. The root mean squared deviation (RMSD) for the superimposition was 0.4 Å. The model of the CueR protein was then energy minimized in two steps. In the first step, the modeled structure was minimized without restraints. In the
Author's personal copy Appl Biochem Biotechnol (2015) 175:649–656
651
second step, the energy minimization was done by fixing the backbone of the modeled protein to ensure proper interactions. All energy minimizations were done using conjugate gradient (CG) with CHARMM force fields [17] until the structures reached the final derivative of 0.1 kcal/mol. In order to crosscheck the validity of the modeling result, the model of CueR protein was again energy minimized using CG with consistent valence force fields (CVFF) [18] until the structures reached the final derivative of 0.1 kcal/mol. The structures of the CueR proteins obtained after energy minimizations using CHARMM and CVFF force fields looked exactly the same. When the backbone atoms of the energy-minimized models of the CueR proteins were superimposed, the RMSD value was found to be 0.0 Å indicating identical structures. Validation of the Model of CueR Protein Regarding the main chain properties of the modeled protein, no considerable bad contacts nor Cα tetrahedron distortions nor hydrogen bond (H-bond) energy problems were found. There were no side chain distortions as observed by measuring the side chain torsion angles. The Zscores calculated using the PROSA [https://prosa.services.came.sbg.ac.at/prosa.php] web server showed that the predicted homology model was well inside the range of typical native structures. The residue profiles of the three-dimensional model were further checked by VERIFY3D [19]. PROCHECK [20] analyses were performed in order to assess the stereochemical qualities of the models, and Ramachandran plots [21] were drawn. No residues were found to be present in the disallowed regions of the Ramachandran plots. Building the Model of the Promoter DNA In order to find the interactions between promoter DNA and the CueR protein, the nucleotide sequence of the promoter region for the gene PA3523 from P. aeruginosa was extracted. For this purpose, the database CollecTF [12] was used. The database CollecTF showed the following nucleotide sequence to be the promoter DNA sequence: GGGTTGACCTTGCCAAGGTGTCAAGGTCGATAAC The nucleotide sequence was used to build the model of the corresponding DNA region using the CHARMM software tool and then subjected to energy minimizations using both CHARMM and CVFF. The resulting energy minimized structure was used for docking studies. Molecular Docking Simulation It is known that CueR binds to DNA as a homodimer [12]. Thus, a model of CueR homodimer was built by superimposing the models of CueR onto the two chains of its crystal template 1Q05 which is itself a homodimer. The homodimeric model of CueR so obtained was subjected to energy minimization as per the protocol previously mentioned in the section “Sequence Analysis and Homology Modeling of CueR.” In order to elucidate the mode of binding between the promoter DNA and CueR, the models of the protein and the DNA were docked using the software PatchDock [22]. The docked structure of the DNA-protein complex that yielded the best score was selected and analyzed visually using the DS modeling software suite. The docked complex was then energy minimized as per the protocol previously mentioned in the section “Sequence Analysis and Homology Modeling of CueR.”
Author's personal copy 652
Appl Biochem Biotechnol (2015) 175:649–656
Molecular Dynamics Simulation The molecular dynamics simulation (MD) of the DNA-protein complex was performed using the CHARMM module of the DS modeling software suite. The initial coordinates were extracted from the energy minimized structure of the promoter DNA-CueR docked complex. The complex was placed in an orthorhombic box having dimensions preventing self-interactions. The system was solvated with adequate water molecules at the typical density of water at 298 K and 1.0 atm utilizing single point charge (SPC) model. The whole system was energy minimized keeping the temperature constant to the body temperature of 310 K using NPT dynamics protocol. A 100-ns dynamics run was then performed for the DNA-protein complex. The modes of binding interactions between CueR and the corresponding promoter DNA were then analyzed using the DS modeling software suite.
Results and Discussions Structure of CueR from P. aeruginosa The structure of CueR was built using 1Q05, Chain B as the template. The amino sequences of CueR and 1Q05, Chain B showed 48 % sequence identity. The DNA binding region of the protein was present at the N-terminus and comprised of two helix-turn-helix motifs (amino acid residues Ile3 to Glu22 for the first helix-turn-helix motif and Glu41 to Gln71 for the second helix-turn-helix motif) joined by a two-stranded anti-parallel beta sheet. A long ten-turn alpha helix followed the N-terminal region of the protein joined by loop regions. This long helix was basically responsible for dimerization of the CueR proteins serving as the dimerization interface between the two CueR monomers (Fig. 1). The CueR protein from P. aeruginosa is known to have metal binding sites [12]. Sequence alignment of CueR protein from P. aeruginosa with 1Q05, Chain B, revealed the presence of the metal ion binding region in the CueR protein from P. aeruginosa. The sequence alignment was presented in Fig. 2. The metal ions were found to be bound to the CueR protein from P. aeruginosa by getting coordinated to the Cys112 and Cys120. The metal ion binding region was present at the Cterminal end of the CueR protein from P. aeruginosa.
Fig. 1 Cartoon representation of the dimeric model of CueR protein from Pseudomonas aeruginosa. The long helices (marked as dimerization helix) from both the monomeric chains of the CueR protein responsible for dimerization are shown in green and cyan. The DNA and metal binding domains are also marked
Author's personal copy Appl Biochem Biotechnol (2015) 175:649–656
653
Fig. 2 Sequence alignment of CueR protein from Pseudomonas aeruginosa with 1Q05, Chain B. Color code: bold blue, first helix-turn-helix motif; bold black second helix-turn-helix motif; bold red the metal binding Cys residues; bold brown the entire metal ion binding region
Interaction with Promoter DNA It is known that transcription factor CueR interacts with DNA as a dimer. In order to analyze the interactions between CueR and its promoter DNA region, a dimeric model of CueR was generated. The resulting dimeric model was docked onto the model of the promoter DNA region to find the DNA-protein interactions. The docked complex was subjected to MD simulation after energy minimization. The progress and completion of the MD simulation process were monitored by plotting a graph of RMSD of the backbone atoms of the docked complex vs time periods of the MD simulation runs (Fig. 3). The resulting complex was then analyzed to find probable modes of bindings between the DNA and the protein (Fig. 4). Mainly, the amino acid residues from the second helix-turn-helix DNA binding motifs of both the chains of CueR were found to be involved in the interactions. Most of the interactions between the DNA and the protein were found to be ionic and polar in nature involving the polar side chains of the amino acids of the CueR protein. Notable among them were the amino acid residues Arg51, Arg54, and Lys65 from the second helix-turn-helix DNA binding motif of the CueR protein; they were found to interact with their positively charged side chains with the negative DNA backbone. However, Asp43, His45, Asp55, and Asp61 from the same helix-turn-helix DNA binding motif of CueR were also found to be interacting with the DNA phosphate backbone via their main chain atoms. The first helix-turnhelix motif of CueR acted as helper to the second helix-turn-helix motif to bind the DNA. The side chains of the positively charged amino acid residues (viz., Lys8, Lys9, Lys15, and Arg18) from the first helix-turn-helix motif of CueR were found to repel the positively charged amino acid residues Arg51, Arg54, and Lys65 from the second helix-turn-helix DNA binding motif of the CueR protein. This helped the amino acid residues from the second helix-turn-helix DNA binding motif of the CueR protein to come in contact with the DNA. The metal ion
Fig. 3 Plot of RMSD vs time scale of MD simulation. The linear region in the plot represents no further change in the RMSD values
Author's personal copy 654
Appl Biochem Biotechnol (2015) 175:649–656
Fig. 4 Cartoon representation of DNA-CueR interactions. The important DNA binding amino acid residues are presented as sticks. The H-bonding is presented as a dotted line
binding region in the CueR protein also could help in DNA binding by the second helix-turnhelix motif. This metal ion binding region being a flexible loop would drag the DNA with the help of the positively charged metal ion towards the second helix-turn-helix motif of the CueR protein. However, the amino acid residues from the long helix which was basically present in the dimerization interface of CueR proteins were not involved in DNA binding.
Conclusion In this work, an attempt has been made to analyze the molecular mechanism of the regulation of the gene PA3523 coding for the multidrug efflux transporter from P. aeruginosa. P. aeruginosa is an opportunistic pathogen responsible for multidrug-resistant nosocomial infections and chronic lung infections in cystic fibrosis patients. The expression of the gene PA3523 is controlled by the protein CueR. In order to analyze the molecular mechanism of the gene regulation process, a homology model of the CueR protein from P. aeruginosa was built. Since the protein acts as a dimer, a dimeric model of the CueR protein was generated. This dimeric model was energy minimized and docked onto the model of the corresponding promoter DNA region. The docked complex after energy minimization was subjected to MD simulation. The MD simulation results showed that mainly the second helix-turn-helix motif of the CueR protein was involved in direct DNA binding. The first helix-turn-helix motif and the metal ion binding region of the CueR protein acted as helpers to the second helix-turn-helix motif. The MD simulations also identified the amino acid residues from the second helix-turn-helix motif of CueR protein responsible for DNA binding and interactions. So far, this is the first report that elucidates the mode of DNA binding and regulation by CueR protein from P. aeruginosa. This study would therefore pave the pathway for future genetic and mutational studies to identify the roles of the amino acids of the CueR protein in the regulation of the gene PA3523. Future drug development endeavors may target these amino acid residues of the CueR protein
Author's personal copy Appl Biochem Biotechnol (2015) 175:649–656
655
to abolish its capability to bind to the promoter DNA region to initiate the gene expression process in highly pathogenic P. aeruginosa. Acknowledgments The author is grateful to the BIF Center, Department of Biochemistry and Biophysics, University of Kalyani, for providing the necessary equipment and workstation to carry out the experiments. The author would like to acknowledge the DST-PURSE program 2012-2015 going on in the Department of Biochemistry and Biophysics, University of Kalyani, and the DBT (project no. BT/PR6869/BID/7/417/2013) for the infrastructural support. The suggestions by the anonymous referee for the betterment of the manuscript are duly acknowledged. Conflict of Interest None
References 1. Lyczak, J. B., Cannon, C. L., & Pier, G. B. (2000). Establishment of Pseudomonas aeruginosa infection: lessons from a versatile opportunist. Microbes and Infection, 2, 1051–1060. 2. Emerson, J., Rosenfeld, M., McNamara, S., Ramsey, B., & Gibson, R. L. (2002). Pseudomonas aeruginosa and other predictors of mortality and morbidity in young children with cystic fibrosis. Pediatric Pulmonology, 34, 91–100. 3. Hart, C. A., & Winstanley, C. (2002). Persistent and aggressive bacteria in the lungs of cystic fibrosis children. British Medical Bulletin, 61, 81–96. 4. Cheng, K., Smyth, R. L., Govan, J. R. E., Doherty, C., et al. (1996). Spread of beta-lactam resistant Pseudomonas aeruginosa in cystic fibrosis clinic. The Lancet, 348, 639–642. 5. Workentine, M., & Surette, M. G. (2011). Complex Pseudomonas population structure in cystic fibrosis airway infections. American Journal of Respiratory and Critical Care Medicine, 183, 1581–1583. 6. Smith, E. E., Buckley, D. G., Wu, Z., Saenphimmachak, C., & Hoffman, L. R. (2006). Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proceedings of the National Academy of Science, 103, 8487–8492. 7. Winstanley, C., Langille, M. G. I., Fothergill, J. L., Kukavica-Ibrulj, I., Paradis-Bleau, C., et al. (2009). Newly introduced genomic prophage islands are critical determinants of in vivo competitiveness in the Liverpool Epidemic Strain of Pseudomonas aeruginosa. Genome Research, 19, 12–23. 8. Klockgether, J., Cramer, N., Wiehlmann, L., Davenport, C. F., & Tümmler, B. (2011). Pseudomonas aeruginosa genomic structure and diversity. Frontiers in Microbiology, 2, 150. 9. Carter, M. E. K., Fothergill, J. L., Walshaw, M. J., Rajakumar, K., & Kadioglu, A. (2010). A subtype of a Pseudomonas aeruginosa cystic fibrosis epidemic strain exhibits enhanced virulence in a murine model of acute respiratory infection. Journal of Infectious Diseases, 202, 935–942. 10. Salunkhe, P., Smart, C. H. M., Morgan, J. A. W., Panagea, S., Walshaw, M. J., et al. (2002). A cystic fibrosis epidemic strain of Pseudomonas aeruginosa displays enhanced virulence and antimicrobial resistance. Journal of Bacteriology, 187, 4908–4920. 11. Winsor, G. L., Rossum, T. V., Lo, R., Khaira, B., Whiteside, M. D., Hancock, R. E. W., & Brinkman, F. S. L. (2009). Pseudomonas genome database: facilitating user-friendly, comprehensive comparisons of microbial genomes. Nucleic Acids Research, 37, D483–D488. 12. Kılıç, S., White, E. R., Sagitova, D. M., Cornish, J. P., & Erill, I. (2014). CollecTF: a database of experimentally validated transcription factor-binding sites in Bacteria. Nucleic Acids Research, 42(D1), D148–D155. 13. Thaden, J. T., Lory, S., & Gardner, T. S. (2010). Quorum-sensing regulation of a copper toxicity system in Pseudomonas aeruginosa. Journal of Bacteriology, 192, 2557–2568. 14. Berman, H. M. (2008). The protein data bank: a historical perspective. Acta Crystallographica. Section A, 64, 88–95. 15. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215, 403–410. 16. Sali, A., & Blundell, T. L. (1993). Comparative protein modelling by satisfaction of spatial restraints. Journal of Molecular Biology, 234, 779–815.
Author's personal copy 656
Appl Biochem Biotechnol (2015) 175:649–656
17. Brooks, B. R., Bruccoleri, R. E., & Olafson, B. D. (1983). CHARMM: a program for macromolecular energy, minimization, and dynamics calculations. Journal of Comparative Chemistry, 4, 187–217. 18. Eisenberg, D., Lüthy, R., & Bowie, J. U. (1997). VERIFY3D: assessment of protein models with threedimensional profiles. Methods in Enzymology, 277, 396–404. 19. Dauber-Osguthorpe, P., Roberts, V. A., Osguthorpe, D. J., Wolff, J., Genest, M., & Hagler, A. T. (1988). Structure and energetics of ligand binding to proteins: E. coli dihydrofolate reductase-trimethoprim, a drugreceptor system. Proteins: Structure, Function, and Genetics, 4, 31–47. 20. Laskowski, R. A., MacArthur, M. W., Moss, D. S., & Thornton, J. M. (1993). Procheck—a program to check the stereochemical quality of protein structures. Journal of Applied Crystallography, 26, 283–291. 21. Ramachandran, G. N., Ramakrishnan, C., & Sasisekharan, V. (1968). Stereochemistry of polypeptide chain configurations. Journal of Molecular Biology, 7, 95–96. 22. Schneidman-Duhovny, D., Inbar, Y., Nussinov, R., et al. (2005). PatchDock and SymmDock: servers for rigid and symmetric docking. Nucleic Acids Research, 33, W363–W367.
