Structural organization and chromosomal localization of the human ...

European Journal of Endocrinology (2000) 143 267±271

ISSN 0804-4643

EXPERIMENTAL STUDY

Structural organization and chromosomal localization of the human type II deiodinase gene Francesco Saverio Celi1, Gianluca Canettieri1, Daniela Mentuccia1, Laura Proietti-Pannunzi1, Angela Fumarola1, Rosanna Sibilla1, Valentina Predazzi2, Marina Ferraro2, Mario Andreoli1,3 and Marco Centanni1,3 1

I Cattedra di Endocrinologia, Dipartimento di Medicina Sperimentale e Patologia, 2Dipartimento di Genetica e Biologia Molecolare, UniversitaÁ degli Studi di Roma `La Sapienza', Roma, Italy and 3Istituto di Medicina Sperimentale, CNR, Roma, Italy

(Correspondence should be addressed to F S Celi, I Cattedra di Endocrinologia, Dipartimento di Medicina Sperimentale e Patologia, UniversitaÁ degli Studi di Roma `La Sapienza', Viale Regina Elena, 324, 00161 Roma, Italy; Email: [email protected])

Abstract Objective: The selenoenzyme type 2 iodothyronine 50 deiodinase (DII) catalyzes the conversion of thyroxine into its active form tri-iodothyronine (T3), modulating thyroid hormone homeostasis in a local, tissue-speci®c manner. The amphibian, rodent and human cDNAs encoding this enzyme have been recently cloned and expressed. At present, little information regarding the genomic structure of mammalian DII is available. Design and methods: The complete structure, including intron±exon junctions, of the human DII (hDII) gene was obtained by long PCR and rapid ampli®cation of cDNA ends (RACE). Chromosomal assignment of the hDII gene was performed by ¯uorescence in situ hybridization using a highly speci®c probe. Results and conclusions: Our data demonstrated that hDII is a single copy gene located on chromosome 14, position 14q24.3. The gene spans over 15 kb, and the 7 kb transcript is encoded by three exons of 149 bp, 273 bp and 6.6 kb separated respectively by two 274 bp and 7.4 kb introns. A restriction map of the hDII gene is also reported. These data will help in further studies of the role of DII in the maintenance of peripheral thyroid hormone homeostasis. European Journal of Endocrinology 143 267±271

Introduction The prohormone thyroxine (T4), which represents the main product of the thyroid gland, is converted within the gland and at a target tissue level into its active form tri-iodothyronine (T3), or into its inactive metabolite, reverse T3 (rT3) by the action of a family of selenoproteins, the deiodinases (1). Like other selenoenzymes, the deiodinases are characterized by the presence of a selenocysteine in the catalytic domain. The selenocysteine is encoded by a UGA codon which, in the presence of a speci®c element in the 30 untranslated region, the selenocysteine insertion sequence (SECIS), interacts with a selenocystein-tRNA and other components of the translational machinery (2) allowing the incorporation of the selenocysteine instead of being read as a stop codon. Mutations of critical nucleotides in the SECIS element virtually abolish the incorporation of selenocysteine and the enzymatic activity (3). The three known isoforms of deiodinase play different physiological roles: while the thyroid hormone inactivating pathway (50 -deiodination) is mostly catalyzed by q 2000 Society of the European Journal of Endocrinology

type 3 deiodinase and to some extent by type I deiodinase, the activating pathway (50 -deiodination) is catalyzed by type 1 and 2 deiodinases (4). The former is expressed primarily in liver and kidney and appears to be an important factor in the maintenance of circulating T3 levels. The expression of type 2 deiodinase (DII) is tissue speci®c and highly regulated. Its activity has been demonstrated in brown adipose tissue, brain, pituitary gland and placenta (1) where T3 produced by DII is utilized locally, thus generating a sort of autocrine pathway (4). The expression and activity of DII are stimulated by the hypothyroid state and in brown adipose tissue by adrenergic stimuli suggesting an important role in the thermoregulation via the interaction with the uncoupling proteins (5). Interestingly, DII is expressed in human but not rat thyroid, and its activity is stimulated in patients with Graves' disease, probably via the thyroid-stimulating hormone (TSH) receptor signaling pathway (6). The stimulation of DII activity by the hypothyroid state and its inhibition by high levels of thyroid hormones, most likely through a post-translational mechanism (7), Online version via http://www.eje.org

268

F S Celi and others

demonstrate that this enzyme plays a critical role in the maintenance of local thyroid hormone homeostasis. Some authors hypothesized that a DII de®cit could result in some rare forms of pituitary thyroid hormone resistance (8). A 1.9 kb cDNA containing the open reading frame of human DII (hDII) has been recently cloned and expressed (9). Northern blot analysis demonstrated that the full length transcript is approximately 7 kb with a wider-than-expected pattern of expression. In fact, the message has also been detected in skeletal muscle, myocardium and thyroid (10). More recently we localized the hDII gene on chromosome 14q24.3 by radiation hybrid screening and demonstrated that the coding region spans two exons separated by a 7.4 kb intron (11). The chromosomal assignment of hDII has also been con®rmed by ¯uorescence in situ hybridization (12). Recently, Leonard and coworkers presented data from well designed experiments against the actual functionality of the transcripts encoding mammalian DIIs (13). However, very recently the full-length cDNAs of hDII and mouse DII have been cloned and expressed (14, 15), clearly demonstrating that mammalian DIIs are indeed selenoenzymes. While the genomic organization and chromosomal localization of the human type 1 and 3 deiodinase genes have been reported (16, 17), the genomic structure of the hDII gene has still to be completely determined. In this report we present the complete structure of the hDII gene and its chromosomal localization which was determined by ¯uorescence in situ hybridization.

Materials and methods Genomic clones Two overlapping genomic P1 clones containing the entire hDII gene (clones 12258 and 12259) were purchased from Genome System (St Louis, MO, USA); the screening was performed using, as a probe, a 325 bp PCR product whose sense primer 50 TAAGAGGGTGA AGGGGAACCAG30 is located on exon 1 and antisense primer 50 CCTGGTCCCCAGCATATGAGC30 is located within the previously described intron (11). The clones were digested with HindIII, BamHI and EcoRI (Boehringer, Monza, Italy) and subcloned in pBluescript KS II (Stratagene, La Jolla, CA, USA). Sequence analysis of the subclones was performed on both strands using an automated sequencer (ABI, Foster City, CA, USA).

50 RACE The 50 untranslated region of hDII was characterized by 50 rapid ampli®cation of cDNA ends (RACE) using a commercially available kit (Life Technologies, San Giuliano Milanese, Italy) according to the manufacturer's instructions. Brie¯y, 750 ng placental RNA was reverse transcribed using the antisense primer www.eje.org

EUROPEAN JOURNAL OF ENDOCRINOLOGY (2000) 143

50 AACCAGCTAATCTAGTTTTCTTTCATCTCTTGCTG30 within exon 2; the cDNA was treated with RNAse H, puri®ed and tailed with an oligonucleotide (50 RACE abridged anchor primer). The PCR was then performed using the antisense primer 50 CTTTCATTTCCAAGCA CCTATGAGACTGTGGCAGAG30 localized at 394 bp from the ATG and a sense primer (abridged universal ampli®cation primer) with varying concentrations of denaturing agent and Advantage GC cDNA Taq polymerase (Clontech, Palo Alto, CA, USA) according to the manufacturer's instructions. The PCR program consisted of an initial denaturation of 94 8C for 2 min, followed by 35 cycles of 55 8C for 30 s, 72 8C for 4 min, 94 8C for 20 s, and a ®nal extension step of 72 8C for 10 min. Ten microliters of the PCR products were electrophoresed on a 1% agarose gel, blotted and hybridized with 50 CTTTACCCTTTCATTGTCTCTATG30 [32P]-radiolabeled probe. The blot was then washed at high stringency and autoradiography was performed. The hybridizing band was electroeluted, reampli®ed, subcloned in pCR II (Invitrogen, San Diego, CA, USA) according to the manufacturer's instructions and sequenced on both strands.

30 RACE The characterization of the 30 untranslated region was carried out with a commercially available 30 RACE kit (Life Technologies) according to the manufacturer's instructions. Brie¯y, 750 ng placental RNA was reverse transcribed with Superscript RT II using oligo-(dT) adapter antisense primer according to the manufacturer's instructions; the cDNA was then ampli®ed using an antisense primer (abridged universal ampli®cation primer) and 50 TGAGTTGAAGAAATTATACGTACATA CACACATACATAC30 sense primer located 175 bp 30 to the end of clone Z44085 (9) with varying concentrations of denaturing agent and Advantage GC cDNA Taq polymerase (Clontech) according to the manufacturer's instructions. The PCR program consisted of an initial denaturation of 94 8C for 2 min, followed by 35 cycles of 55 8C for 30 s, 72 8C for 4 min, 94 8C for 20 s, and 55 8C for 1 min and a ®nal extension step of 72 8C for 10 min. Ten microliters of the PCR products were then electrophoresed on a 1% agarose gel, blotted and hybridized with a 50 TATCCTCAGCTGCTGGGGGAGGT30 [32P]-radiolabeled probe whose sequence is 27 bp 30 to the RACE sense primer. The blot was then washed at high stringency and autoradiography was performed. The hybridizing 1.1 kb band was then electroeluted, reampli®ed, subcloned into pCR II (Invitrogen) according to the manufacturer's instructions and partially sequenced. A second round of RACE using 50 GCAC ATTCACACTGTTGTCCTTAAAATTCCCC30 sense primer located at the 30 end of the 1.1 kb RACE product using the same conditions previously described was then performed. The PCR program consisted of an initial denaturation of 94 8C for 2 min, followed by 35 cycles of


Human type II deiodinase structure

269

Figure 1 Genomic structure of the hDII gene. (A) Homology between human (top, hDII SECIS) and mouse (bottom, mDII SECIS) SECIS elements, the homologous bases are shown in capital letters, the critical bases for selenocysteine incorporation are underlined and shown in italics. (B) Long PCR of the genomic DNA (gDNA) and placental RT (cDNA) hDII. The primer location is shown in C (see text for details). (C) Schematic representation of the hDII gene, the coding region is shown in lightly hatched grey; the SECIS element is shown in black, the long PCR primer location is represented with two arrows. (D) Splice junctions of the of hDII gene: the open reading frame sequence is reported in upper case, the intron sequence in lower case and the junctions in italics.

60 8C for 1 min, 72 8C for 3 min, 94 8C for 1 min, and a ®nal extension step of 72 8C for 10 min. Ten microliters of the PCR products were electrophoresed on a 1% agarose gel, blotted and hybridized with [32P]-radiolabeled 50 ACTGGGGAAAAGGATGATGG30 probe whose sequence is located 82 bp 30 to the RACE primer. The blot was washed at high stringency and autoradiography was performed. The 1.3 kb hybridizing band was electroeluted, reampli®ed, subcloned into pCR II-TOPO according to the manufacturer's instructions (Invitrogen) and sequenced on both strands. The sequence was submitted to GenBank, accession number AF123661.

Long PCR Long PCR on 20 ng genomic DNA and 5 ml placental cDNA (see above) was performed using the sense primer 50 GCATGCTGACCTCAGAGGGACTGCGCTGCGTCTGG30 whose sequence is located on exon 1 and the antisense primer 50 GCACACATAGCACTCAGCACCAATATGATAA CACTC30 located at the 30 end of clone 23964 (GenBank accession number AF007144, see Results and Discussion for details) with Takara LA Taq (Takara, Shiga, Japan) according to the manufacturer's instructions.

The PCR program consisted of an initial denaturation of 94 8C for 4 min, followed by 14 cycles of 98 8C for 20 s, 68 8C for 20 min, followed by 16 cycles of 98 8C for 20 s, 68 8C for 20 min (15 s auto-elongation each cycle), and a ®nal extension step of 72 8C for 10 min. The resulting 13.2 kb genomic and PCR product was subcloned into pCR II Topo (pCR II hDII) (Invitrogen) according to the manufacturer's instructions.

Chromosomal localization Chromosomal localization was determined by in situ hybridization on karyotypically normal human cells. Brie¯y, pCR II hDII was linearized with NotI and used as a probe for chromosomal localization that was carried out on metaphase spreads obtained by standard methods from short-term lymphocyte cultures from a healthy donor. The slides were pretreated with DNasefree RNase (100 mg/ml) in 2 ´ SSC at 37 8C for 1 h. Chromosomal DNA was denatured by incubation in 70% formamide in 2 ´ SSC for 2 min at 70 8C, quenched in ice-cold 70% ethanol and dehydrated through a 70%, 90% and 100% ethanol series. For each slide 300 ng dCTP-Cy3-labeled (Amersham Pharmacia Biotech, www.eje.org

270

F S Celi and others

Figure 2 Chromosomal localization of hDII gene by ¯uorescence in situ hybridization (FISH). Metaphases of karyotypically normal blood lymphocytes were hybridized with pCRII hDII vector labeled with Cy3 and p14.1 alphoid sequence labeled with biotin (see text for explanations) then counterstained with DAPI. Both chromosomes with symmetrical Cy3 signals (white arrow) were identi®ed as chromosomes 14 by the chromosome speci®c alphoid sequence (grey arrows). The metaphase clearly shows that pCRII maps only to the long arm of chromosome 14 demonstrating that hDII is a single copy gene.

Cologno Monzese, Italy) pCR II hDII and 20 ng bio-16 dUTP-labeled (Boehringer, Monza, Italy) p14.1 were mixed in the hybridization buffer (50% formamide in 2´ SSC, dextran sulphate 10%), and denatured for 8 min at 80 8C. Hybridization was carried out overnight at 37 8C. Post-hybridization washes were performed at high stringency. The alphoid biotin-labeled sequences were detected with avidine±¯uorescein isothiocyanate (FITC) (Vector, Burlingame, CA, USA) diluted 1:300. After counterstaining in 40 -6 diamidino-2-phenylindole (DAPI), ¯uorescent images were captured with a CCD camera (Photometrics 01) using IPLab software (Signal Analytic Corporation) and processed with a Macintosh Power 7100 using Adobe Photoshop Software. The unequivocal identi®cation of the two chromosomes 14 was achieved by cohybridization with an alphoid sequence speci®c for the centromeric regions of chromosomes 14 and 22 (18) (Fig. 2).

Results and Discussion The 50 untranslated region of hDII gene was characterized by 50 RACE. The presence of a 274 bp intron at 51 bp from the ATG was demonstrated by comparing the RACE product sequence with the one obtained from a genomic subclone. Interestingly, 83 base pairs 50 to the splice junction are within the originally published brain cDNA clone (GenBank accession number Z44085) (9); this ®nding is compatible with either an alternative www.eje.org


splicing mechanism or a cloning artifact. Two transcription start sites were mapped at 470/ 474 bp from the ATG with primer elongation experiments and an RT-PCR performed using a sense primer located immediately 30 to the transcription start site con®rmed the presence of such intron (data not shown). The sequence of the 50 UT and 803 bp 50 to the transcription start site has been submitted to GenBank, accession number AF079364. These data are in keeping with the very recent manuscript from Bartha and coworkers who demonstrated the presence of a transcription start site 708 bp 50 to the ATG and an alternative splicing of the 50 untranslated region in thyroid tissue (19). Northern blot analysis performed on placental RNA demonstrated a single 7 kb hybridizing band and no ampli®cation was obtained by a PCR performed on placental cDNA using a sense primer located immediately 30 to the 708 bp transcription start site, suggesting that a single transcript is present in this tissue (data not shown). An almost complete degree of homology, with the exception of a 32 bp deletion in the 274 bp intron, was observed by comparing our data with the recent GenBank submission, accession number AC007372, containing the entire hDII locus. The characterization of the 30 untranslated region was carried out with a commercially available 30 RACE kit in two sequential experiments using a gene walking strategy. The 1.3 kb PCR product resulting from the second experiment was subcloned and sequenced on both strands. The sequence was submitted to GenBank, accession number AF123661. A GenBank search using a 200 bp 30 end sequence demonstrated 100% homology with a cDNA clone 23964 accession number AF007144. A computerized structure analysis with RNAdraw (20) on the last 300 bp of the 23964 clone demonstrated the presence of a putative SECIS element. Interestingly, the sequence of the hDII putative SECIS element shows a high degree of homology, 85%, with the mouse SECIS element (Fig. 1A). The long PCR experiments on genomic DNA and placental cDNA resulted in a 13.2 kb genomic product and a 5.8 kb cDNA PCR product, thus demonstrating the continuity of the gene and the absence of large size introns in the 30 end of the gene (Fig. 1B). The result was con®rmed by Southern blot analysis (data not shown) and a restriction map of the hDII gene was obtained (Fig. 1C); the exon±intron splicing junctions are also reported (Fig.1D). Previous screening of two different radiation hybrid panels demonstrated that the hDII gene is located on chromosome 14, at q24.3 on a linkage integrated cytogenetic map (11). The result was also con®rmed by ¯uorescence in situ hybridization (12). In situ hybridization of hDII on normal human cells using a gene-speci®c probe containing part of exon 1, the 7.4 kb intron and most of the exon 2 demonstrated unequivocally that hDII is a single copy gene (Fig. 2). In conclusion, we now report the complete genomic

Human type II deiodinase structure


structure and chromosomal localization of the hDII gene. This data will provide further tools for the study of the molecular mechanisms of peripheral thyroid hormone metabolism in humans and possibly for molecular genetics studies of some forms of thyroid hormone resistance not due to mutations of the thyroid hormone receptor-b gene.

Acknowledgements The authors wish to acknowledge Alan R Shuldiner for his valuable guidance and comments and Professor Mariano Rocchi for the generous gift of the alphoid probe. The ®nancial support of Telethon-Italy (Grant # E.763) is gratefully acknowledged.

References 1 HernaÁndez A & St Germain DL. Selenodeiodinases and their role in thyroid hormone activation and inactivation. Current Opinion in Endocrinology and Diabetes 1997 4 333±340. 2 Hubert N, Walczak, Carbon F & Krol A. A Protein binds the selenocysteine insertion element in the 30 -UTR of mammalian selenoprotein mRNAs. Nucleic Acid Research 1996 24 464±469. 3 Berry MJ, Banu L, Harney JW & Larsen PR. Functional characterization of the eucariotic SECIS elements which direct selenocysteine insertion at UGA codons. EMBO Journal 1993 12 3315±3322. 4 KoÈhrle J. Thyroid hormone deiodinases: A selenoenzyme family acting as gate keepers to thyroid hormone action. Acta Medica Austriaca 1996 23 17±30. 5 Branco M, Ribeiro M, Negrao N & Bianco AC. 3,5,30 -Triiodothyronine actively stimulates UCP in brown fat under minimal sympathetic activity. American Journal of Physiology 1999 276 E179±E187. 6 Salvatore D, Tu H, Harney JW & Larsen PR. Type 2 iodothyronine deiodinase is highly expressed in human thyroid. Journal of Clinical Investigation 1996 98 962±968. 7 Burmeister LA, Pachucki J & St Germain DL. Thyroid hormones inhibit type 2 iodothyronine deiodinase in the rat cerebral cortex by both pre- and posttranslational mechanisms. Endocrinology 1997 138 5231±5237. 8 Gershengorn MC & Weintraub BD Thyrotropin-induced hyperthyroidism caused by selective pituitary resistance to thyroid hormone. A new syndrome of `inappropriate secretion of TSH'. Journal of Clinical Investigation 1975 56 633±642.

271

9 Croteau W, Davey JC, Galton VA & St Germain DL. Cloning of the mammalian type II iodothyronine deiodinase. Journal of Clinical Investigation 1996 98 405±417. 10 Salvatore D, Bartha T, Harney JW & Larsen PR. Molecular biological and biochemical characterization of the human type 2 selenodeiodinase. Endocrinology 1996 137 3308±3315. 11 Celi FS, Canettieri G, Yarnall DP, Burns DK, Andreoli M, Shuldiner AR et al. Genomic characterization of the coding region of the human type II 50 -deiodinase gene. Molecular and Cellular Endocrinology 1998 141 49±52. 12 Araki O, Murakami M, Morimura T, Kamiya Y, Hosoi Y, Kato Y et al. Assignment of type II iodothyronine deiodinase gene (DIO2) to human chromosome band 14q24.2aq24.3 by in situ hybridization. Cytogenetics and Cell Genetics 1999 84 73±74. 13 Leonard JL, Leonard DM, Safran M, Wu R, Zapp ML & Farwell AP. The mammalian homolog of the frog type II selenodeiodinase does not encode a functional enzyme in the rat. Endocrinology 1999 140 2206±2215. 14 Buettner C, Harney JW & Larsen PR. The 30 -untranslated region of human type 2 iodothyronine deiodinase mRNA contains a functional selenocysteine insertion sequence element. Journal of Biological Chemistry 1998 273 33374±33378. 15 Davey JC, Schneider MJ, Becker KB & Galton VA. Cloning of a 5.8 kb cDNA for a mouse type 2 deiodinase. Endocrinology 1999 140 1022±1025. 16 Jakobs TC, Koehler MR, Schmutzler C, Glaser F, Schmid M & KoÈhrle J. Structure of the human type I iodothyronine 50 deiodinase gene and localization to chromosome 1p 32-p33. Genomics 1997 42 361±363. 17 Hernandez A, Park JP, Lyon GJ, Mohandas TK & St Germain DL. Localization of the type 3 iodothyronine deiodinase (DIO3) gene to human chromosome 14q32 and mouse chromosome 12F1. Genomics 1998 53 119±121. 18 Archidiacono N, Antonacci R, Marzella R, Finelli P, Lonoce A & Rocchi M. Comparative mapping of human alphoid sequences in great apes, using ¯uorescence in situ hybridization. Genomics 1995 25 477±484. 19 Bartha T, Kim SW, Salvatore D, Gereben B, Tu HM, Harney JW et al. Characterization of the 50 -¯anking region and 50 untranslated regions of the cyclic adenosine 30 ,50 monophosphate-responsive human type 2 iodothyronine deiodinase gene. Endocrinology 2000 141 229±237. 20 Matzura O & Wennborg A. RNAdraw: an integrated program for RNA secondary structure calculation and analysis under 32-bit Microsoft. CABIOS 1996 12 247±249. Received 14 January 2000 Accepted 30 March 2000

www.eje.org