Structural Variations of Staphylococcal Cassette Chromosome mec ...

2 downloads 0 Views 1MB Size Report
Jan 5, 2011 - type t008 and multilocus sequence type 8 (ST8, clonal complex. 8), and harbor staphylococcal cassette chromosome mec. (SCCmec) type IVa.
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 2011, p. 3932–3935 0066-4804/11/$12.00 doi:10.1128/AAC.00012-11 Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Vol. 55, No. 8

Structural Variations of Staphylococcal Cassette Chromosome mec Type IVa in Staphylococcus aureus Clonal Complex 8 and Unrelated Lineages䌤 Peter Damborg,1* Mette Damkjær Bartels,2 Kit Boye,2 Luca Guardabassi,1 and Henrik Westh2,3 Department of Veterinary Disease Biology, Faculty of Life Sciences, University of Copenhagen, Stigbøjlen 4, 1870 Frederiksberg C, Denmark1; MRSA Knowledge Center, Department of Clinical Microbiology, Hvidovre Hospital, Kettegaard Alle´ 30, 2650 Hvidovre, Denmark2; and Department of Diagnostic Sciences, Faculty of Health Sciences, University of Copenhagen, Copenhagen, Denmark3 Received 5 January 2011/Returned for modification 29 March 2011/Accepted 16 May 2011

PCR mapping of staphylococcal cassette chromosome mec type IVa and adjacent mobile elements in 94 methicillin-resistant Staphylococcus aureus (MRSA) strains identified two primary structures (A and B) that could be further classified into two (A1 and A2) and five (B1 to B5) variants, primarily based on structural differences in the orfX-J3 region. While spa type t008 (USA300) invariably contained the A variants, other spa types belonging to clonal complex 8 and unrelated lineages generally contained B variants. These findings have important implications for the typing and identification of MRSA strains containing B variants. MRSA strains isolated at Hvidovre Hospital are routinely spa typed, SCCmec typed, and screened by PCR for detection of ACME-specific (arcA and opp3AB) and PVL-specific (lukS-PV and lukF-PV) genes (4, 5, 6, 8, 10, 12). For this study, we selected 94 MRSA isolates obtained between 2003 and 2010 from patients with health care-associated or CA MRSA in the greater Copenhagen area. All isolates contained SCCmec IVa and belonged to spa types where arcA had been detected. A representative number of isolates was selected on the basis of the relative isolation frequency of each spa type. When available, arcA-negative isolates were included for each spa type. Ninety-one isolates had spa types belonging to CC8, primarily t024 (n ⫽ 50) and t008 (n ⫽ 25). Three arcA-positive isolates had spa types related to other MRSA lineages, i.e., CC1, CC5, and CC30. Most isolates were epidemiologically unrelated, except for 36 isolates from persons living or working at nine nursing homes with multiple cases of MRSA. These 36 isolates were included based on the same criteria as other isolates but with the purpose of studying within-outbreak variability. They represented approximately one-third of all MRSA isolates and half of all spa types obtained from these nursing homes between 2003 and 2010. We investigated all isolates by PCR mapping using previously described primers targeting the SCCmec IVa prototype (3, 7, 13) and novel primers targeting the new orfX-J3 elements identified by our previous work (2) (Table 1; Fig. 1). PCRs were performed with a final volume of 20 ␮l using the DreamTaq Green PCR Master Mix (Fermentas, Helsingborg, Sweden) and purified DNA from each isolate. The cycling conditions for PCRs 1, 3 to 6, and 9 were initial denaturation at 94°C for 4 min, followed by 25 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 60 s and a 5-min final elongation step at 72°C. The cycling conditions for PCRs 2, 7, and 8 were identical, except that annealing temperatures of 55°C (PCRs 2 and 7) and 54°C (PCR 8) were used. We identified two main SCCmec IVa structures, A and B (Table 2; Fig. 1). Structure A had the dcs region typical of the

One of the most widespread community-associated (CA) methicillin-resistant Staphylococcus aureus (MRSA) clones is USA300 (14, 16). This clone has become the most common cause of CA MRSA infections in North America (15) and has recently spread to western Europe, including Denmark (14). USA300 isolates are characterized by a common pulsed-field gel electrophoresis (PFGE) pattern, generally belong to spa type t008 and multilocus sequence type 8 (ST8, clonal complex 8), and harbor staphylococcal cassette chromosome mec (SCCmec) type IVa. In addition, USA300 isolates typically contain the arginine catabolic mobile element (ACME) and the lukS-PV and lukF-PV genes encoding Panton-Valentine leukocidin (PVL) (5, 14, 16). Genotypic differences were recently shown among Danish health care-associated MRSA isolates belonging to clonal complex 8 (CC8) and resembling USA300 by PFGE. In particular, t024 isolates were PVL negative and inconsistently carried ACME, whereas all t008 isolates carried both elements (9). A study evaluating the sensitivity and specificity of a commercial PCR-based kit for MRSA detection failed to identify 85% of Danish t024 MRSA isolates due to a structural variation in the orfX J3 region of SCCmec IVa (1). Wholegenome sequencing of two t024 isolates identified a novel J3 region containing two unique clusters of open reading frames (ORFs). One of the isolates contained two additional direct repeats between J3 and orfX. These direct repeats delimited a region containing an SCC element followed by an ACME II variant (SCCmec IVa variant B1, Fig. 1) (2). Based on these findings, we decided to further investigate the J3 region and adjacent structures of SCCmec IVa in a large collection of MRSA isolates.

* Corresponding author. Mailing address: Department of Veterinary Disease Biology, Faculty of Life Sciences, University of Copenhagen, Stigbøjlen 4, 1870 Frederiksberg C, Denmark. Phone: 45 35332725. Fax: 45 35332755. E-mail: [email protected]. 䌤 Published ahead of print on 6 June 2011. 3932

VOL. 55, 2011

SCCmec IVa VARIANTS IN STAPHYLOCOCCUS AUREUS

3933

FIG. 1. Schematic drawing of SCCmec composite elements detected in the present study. “A” structures have prototype SCCmec IVa (11), and “B” structures have SCCmec IVa with the novel J3 region characterized by two unique clusters of ORFs (reg1 and reg2) (2). A1 (SCCmec IVa), A2 (SCCmec IVa with ACME I downstream), B1 (SCCM1, ⌿SCCarc, SCCmecIVa [2B]; J1, subtype 1-specific ORFs; J3, subtype 3-specific ORFs for M1), and B2 (SCCmec IVa [2B]; J1, subtype 1-specific ORFs; J3, subtype 3-specific ORFs for M1) have been previously described (2, 5, 11) and fully sequenced (GenBank accession numbers NC_003923, NC_007793, HM030720, and HM030721). B3 and B4 are proposed structures of new SCCmec IVa composite elements based on PCR mapping and partial sequencing. Approximate targets of PCRs 1 to 9 are shown by broken lines.

3934

DAMBORG ET AL.

ANTIMICROB. AGENTS CHEMOTHER.

TABLE 1. Primers used in the study PCR no. and primer

Amplicon Reference size (bp)

Sequence (5⬘–3⬘)

1 cR1 insert orf

AAGAATTGAACCAACGCATGA CTTTGATAAGCCATTCATTC

326

7 This study

975

This study

ins-orf-M299

ATATAGGTGAGAGTATGATAA GTGAG GCTATCAATCTGTCCTCAAA

325

This study

Insert_IS431 IS431F

GTAAATGAACTGCAGCTATTG CTTCTGGTTGGAATGTGTGG

939

This study

IS1272F1 IS1272R1

GCCACTCATAACATATGGAA CATCCGAGTGAAACCCAAA

415

DCS F2 DCS R1

CATCCTATGATAGCTTGGTC CTAAATCATAGCCATGACCG

342

cR1 ins-orf-M299

AAGAATTGAACCAACGCATGA GCTATCAATCTGTCCTCAAA

395

7 This study

cR1 AAGAATTGAACCAACGCATGA DR2/IR2_R2 ACCTTTATTCGTTACGCCC

606

7 This study

DR2/IR2_F2 ins-orf-M299

764

This study

2 DR2/IR2_F2 GATTTTCCCAACCGCACC DR2/IR2_R2 ACCTTTATTCGTTACGCCC 3 DR3/IR3_F2

4

5 3

6 13

7

8

9 ACCTTTATTCGTTACGCCC GCTATCAATCTGTCCTCAAA

SCCmec IVa prototype, and structure B had the novel J3 region comprising two unique clusters of ORFs (2). This variation in J3 has important implications for MRSA diagnostics, since only J3 of structure A is targeted by one of the commercially available PCR kits for MRSA detection (1). Variants of

A (A1 and A2) and B (B1 to B5) were defined for the purpose of this study based on the observed structural variations in the regions immediately down- and upstream of SCCmec, respectively (Fig. 1). B5 had the novel J3 region, but the organization of orfX-J3 could not be discerned based on PCR results (Table 2). Elements from J3 were not detected in five isolates, which were therefore considered nontypeable (NT1 and NT2, Table 2). Further analysis of SCCmec composite elements in B5, NT1, and NT2 was attempted by standard- and long-range PCRs using various combinations of primers from Table 1. However, the structures could not be deduced, possibly due to mutations in primer binding sites or because of the presence of novel variants. Further studies sequencing the entire SCCmec composite elements of isolates representing NT1, NT2, and B5 are warranted. The SCCmec IVa cassette originally discovered by Ma et al. (11) was identified in four isolates (A1 variant), and the same cassette followed by ACME I (A2 variant), which is characteristic of USA300 (5), was detected in 28 isolates (Fig. 1). The majority (92%) of the t008 isolates were assigned to variant A2 (Table 2; Fig. 1), thus supporting the notion that spa type t008 is strongly associated with USA300 (17). Most of the other isolates possessed B variants. In addition to the two variants recently described by our group (B1 and B2), two closely related new variants (B3 and B4) were described for the first time in this study. B variants were detected in 92% of the t024 isolates but not in t008 isolates (Table 2). Interestingly, B1 and B3 were detected in both CC8 and non-CC8 isolates (Table 2), suggesting either horizontal transfer of these large composite elements or convergent evolution across S. aureus lineages. B3 differed from B1 only by the lack of ccrAB4. We hypothesized that this difference was due to an excision or insertion of SCCM1 between DR1 and DR2 (Fig. 1). Sequencing of the 606-bp amplicon generated from this region (PCR 8) confirmed this hypothesis, since DR2 was adjacent to orfX in the B3 variant (Fig. 1). Similarly, B4 differed from B1 only by the

TABLE 2. Description of the two SCCmec IVa structures (A and B) detected by PCR mappinga ACME gened

spa type(s) (no. of strains) SCCmec IVa variant

Strain used as referenceb

A1 A2

MW2 FPR3757

B1

M1

B2 B3 B4 B5 NT1f NT2f

M299 M15 M1298 M289 M620 M220

CC8

t008 (2), t064 (2) t008 (23), t068 (1), t121 (1), t211 (1), t3980 (1), t5098 (1) t024 (17), t430 (3), t351 (1), t842 (1), t2555 (1) t024 (11) t024 (16), t430 (1), t846 (1) t024 (2)

Other CCc

t012 (1) t127 (1) t979 (1)

t024 (3) t024 (1), t064 (1)

PVL

Profile according to PCRs 1 to 9

0 1

1/0e 1/0e

000011000 000011000

1

0

0

111110000

0 1 0 1 0 0

0 0 0 0 0 0

0 0 0 0 0 0

0 0 1 0 1 0

ccr allotype arcA

opp3AB

ccrAB2 ccrAB2

0 1

ccrAB2 and ccrAB4 ccrAB2 ccrAB2 ccrAB2 and ccrAB4 ccrAB2 ccrAB2 ccrAB2

0 0 0 0 0 0

0 1 0 1 0 0

1 1 1 1 0 0

1 1 1 1 1 1

0 0 0 0 0 0

1 0 0 0 0 0

0 1 0 0 0 0

0 0 1 0 0 0

a A1 and A2 correspond to the prototype SCCmec IVa cassette and the ACME I-positive variant associated with USA300, respectively. B1 and B2 were described recently (2), and B3, B4, and B5 are novel variants identified in this study. b MW2 and FPR3757, isolated in Japan and in the United States, respectively, were kindly provided by T. Ito. The remaining standards were Danish clinical MRSA isolates from Hvidovre Hospital, Hvidovre, Denmark. c spa types not associated with CC8: t012 (CC30), t127 (CC1), and t979 (CC5). d Possession of both arcA and opp3AB suggests the presence of ACME I, which is typical of the S. aureus USA300 lineage. Possession of only arcA suggests the presence of the recently described ACME II variant ⌿SCCarc (2). e 50% and 83% of the isolates with variants A1 and A2 were PVL positive, respectively. f Isolates without any apparent loci in J3 were considered nontypeable (NT1 and NT2).

VOL. 55, 2011

SCCmec IVa VARIANTS IN STAPHYLOCOCCUS AUREUS

TABLE 3. Distribution of novel SCCmec IVa variants in MRSA CC8 isolated from nine nursing homes Nursing home

spa type (no. of strains)

1

t024 (5) t430 (3) t351 (1) t846 (1) t024 (4) t842 (1) t024 (5) t024 (5) t024 (2) t024 (2) t024 (1) t2555 (1) t024 (3) t024 (2)

2 3 4 5 6 7 8 9

SCCmec IVa variant(s)

B1, B1 B1 B3 B1 B1 B1, B1, B4 B3 B1 B1 B1 B1,

B3

B3 B2, B3, NT1

NT1

Time of isolation

2003–2008 2004–2006 2004 2009 2003–2009 2005 2003–2009 2004–2007 2007–2009 2004 2005 2007 2004–2006 2006–2008

lack of ⌿SCCarc. Sequencing of the 764-bp amplicon generated from this region (PCR 9) proved that excision or insertion of ⌿SCCarc had taken place between DR2 and DR3 (Fig. 1). These results are in favor of our previously described hypothesis that B2 derived from B1 by excision of ⌿SCCarc and SCCM1 (2). The results also indicate that possession of more than the usual two direct repeat regions flanking SCCmec may lead to a greater variety of recombination events and consequently more variants. Further experiments are needed to elucidate which factors influence mobilization of ⌿SCCarc and SCCM1. Analysis of the 36 isolates originating from nine nursing homes with multiple cases of MRSA showed that in some facilities a single clone occurred over several years, whereas in others different spa types and SCCmec IVa variants developed over the years. In nursing home 1, the B1 variant of SCCmec IVa was detected in three spa types belonging to CC8 (Table 3). This may be suggestive of evolutionary changes in region X of spa or horizontal transfer of composite SCCmec elements between closely related lineages. Detection of both variants B1 and B3 in t024 isolates within three nursing homes (1, 3, and 4, Table 3) may suggest that B3 was generated in one of these places by deletion of SCCM1, followed by transmission in local hospitals or through staff or residents moving between these nursing homes. A less likely explanation would be that the same excision or insertion event happened in all three nursing homes. Overall, a clear pattern of local SCCmec evolution could not be discerned, since strain isolation dates did not suggest gradual replacement of one variant by another. The present study reveals a wide dispersal of novel SCCmec IVa structures in CC8 and other MRSA lineages in the greater Copenhagen area. The B variants probably evolved from a common ancestral structure through ccr-mediated excision of the mobile elements between J3 and orfX. The variability in the structure of this region has important implications for the typing and identification of MRSA, since strains carrying B

3935

variants of SCCmec IVa cannot not be detected by current commercial PCR kits targeting the orfX J3 region. Our PCR mapping approach targeting the unique regions in J3 and upstream of SCCmec can be used for the subtyping of CC8 isolates diverging from the typical USA300 clone by lacking the opp3 gene cluster, being PVL negative, and having spa types other than t008. This work was funded in part by a grant from Fondation Idella (Vaduz, Liechtenstein). REFERENCES 1. Bartels, M. D., et al. 2009. A common variant of staphylococcal cassette chromosome mec type IVa in isolates from Copenhagen, Denmark, is not detected by the BD GeneOhm methicillin-resistant Staphylococcus aureus assay. J. Clin. Microbiol. 47:1524–1527. 2. Bartels, M. D., L. H. Hansen, K. Boye, S. J. Sørensen, and H. Westh. 2011. An unexpected location of the arginine catabolic mobile element (ACME) in a USA300-related MRSA strain. PLoS One 6:e16193. 3. Boye, K., M. D. Bartels, I. S. Andersen, J. A. Moller, and H. Westh. 2007. A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I-V. Clin. Microbiol. Infect. 13:725–727. 4. Diep, B. A., et al. 2008. The arginine catabolic metabolic element and staphylococcal chromosomal cassette mec linkage: convergence of virulence and resistance in the USA300 clone of methicillin-resistant Staphylococcus aureus. J. Infect. Dis. 197:1523–1530. 5. Diep, B. A., et al. 2006. Complete genome sequence of USA300, an epidemic clone of community-acquired meticillin-resistant Staphylococcus aureus. Lancet 367:731–739. 6. Harmsen, D., et al. 2003. Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting by using novel software for spa repeat determination and database management. J. Clin. Microbiol. 41:5442–5448. 7. Ito, T., Y. Katayama, and K. Hiramatsu. 1999. Cloning and nucleotide sequence determination of the entire mec DNA of pre-methicillin-resistant Staphylococcus aureus N315. Antimicrob. Agents Chemother. 43:1449–1458. 8. Kondo, Y., et al. 2007. Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrob. Agents Chemother. 51:264–274. 9. Larsen, A. R., et al. 2009. Two distinct clones of methicillin-resistant Staphylococcus aureus (MRSA) with the same USA300 pulsed-field gel electrophoresis profile: a potential pitfall for identification of USA300 communityassociated MRSA. J. Clin. Microbiol. 47:3765–3768. 10. Larsen, A. R., M. Stegger, and M. Sorum. 2008. spa typing directly from a mecA, spa and pvl multiplex PCR assay—a cost-effective improvement for methicillin-resistant Staphylococcus aureus surveillance. Clin. Microbiol. Infect. 14:611–614. 11. Ma, X. X., et al. 2002. Novel type of staphylococcal cassette chromosome mec identified in community-acquired methicillin-resistant Staphylococcus aureus strains. Antimicrob. Agents Chemother. 46:1147–1152. 12. Milheiric¸o, C., D. C. Oliveira, and H. de Lencastre. 2007. Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: ‘SCCmec IV multiplex’. J. Antimicrob. Chemother. 60:42–48. 13. Oliveira, D. C., and H. de Lencastre. 2002. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 46: 2155–2161. 14. Otter, J. A., and G. L. French. 2010. Molecular epidemiology of communityassociated meticillin-resistant Staphylococcus aureus in Europe. Lancet Infect. Dis. 10:227–239. 15. Tenover, F. C., and R. V. Goering. 2009. Methicillin-resistant Staphylococcus aureus strain USA300: origin and epidemiology. J. Antimicrob. Chemother. 64:441–446. 16. Vandenesch, F., et al. 2003. Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence. Emerg. Infect. Dis. 9:978–984. 17. Yamamoto, T., et al. 2010. Community-acquired methicillin-resistant Staphylococcus aureus: community transmission, pathogenesis, and drug resistance. J. Infect. Chemother. 16:225–254.