Gene Structure of Human Prostaglandin D2 Synthase. 23203 constructed from ..... gelsolin (24) and argininosuccinate synthase genes with the gene most likely ...
THEJOURNAL OF BIOLOGICAL
CHEMISTRY
Vol. 267, No. 32, Issue of November 15, pp. 23202-23206,1992 Printed in U.S. A.
0 1992 by The American Society for Biochemistry and Molecular Biology, Inc.
Structure and Chromosomal Localization of the Human Genefor a Brain Form of Prostaglandin D2 Synthase* (Received for publication, March 26, 1992, and in revised form, May 8, 1992)
David M. White$, DanielD. Mikolg, Rafael Espinosall, Brian Weimerj, Michelle M. Le Beaullll, and Kari Stefansson#** From the $Department of Biochemistry and Molecular Biology, §Departments of Neurology and Pathology (Neuropathology), and the VDepartment of Medicine (Sectionof HernatologylOncology), University of Chicago, Chicago, Illinois 60637
We have cloned and characterized the human gene for the 21-kDa brain form of prostaglandin D2 synthase. The gene was isolated from a human genomic X library and spans3600 base pairs.It consists of seven exons and six introns. Southern blotanalysis indicates that there is a single copy of the gene in the haploid genome. The transcriptional startsite was mapped to a G residue 74 base pairs 5‘ ofthe ATG initiation codon. A TATA box-like element (ATAAATA)is situated 21 base pairs upstream of the mRNA start site. The gene was mapped to chromosome 9 bands q34.2q34.3. The gene bears close resemblance to the genes for murine major urinary protein and ovine &lactoglobulin.
body of evidence linking PGDz to sleep induction in rats and monkeys. Prostaglandin Hz is the highly reactive precursor to PGDz with a half-life in solution of approximately 30 min at physiologic pH. It decomposes to a mixture of primarily PGD, and PGEZ (14). This lability has made identification of specific PGD, synthases difficult. Several proteins have been shown to accelerate this reaction, including serum albumin, members of the glutathione-S-transferase family of enzymes (15, 16), and an 85-kDa cytosolic protein isolated from rat brain by Shimizu et al. (17). Hayaishi and co-workers (18, 19) have identified a brain-specific prostaglandin Dz synthase (PDS), a 190-amino-acid protein that is homologous to members of the lipocalin superfamily. In an immunohistochemical study, Urade et al. (20) demonstrated that staining with anti-PDS antibodies is primarily neuronal in the brain of 1-2-week-old Prostaglandins are arachidonic acid metabolites that have rats, whereas in the adult rat most of the staining is observed a wide variety of biological functions (1,2). Prostaglandin Dz in oligodendrocytes. The appearance of this protein in the (PGDJ’ is a potent inhibitor of platelet aggregation in vitro maturing oligodendrocyte may therefore be an important and is involved in smooth muscle contraction/relaxation (3). marker for the terminal differentiation of the oligodendrocyte. Our interest in this protein arose from our attempts to unPGD, has been implicated in a variety of CNS functions derstand eventsandproteins involved in oligodendrocytic including synaptic transmission (4), hypothalmic control of temperature (5), recovery from seizures (6, 7), and release of development. Here, we report on the isolation and characterluteinizing hormone (8). One of the more intriguing aspects ization of the human gene for PDS and its close structural of the postulated role of PGD, in CNS function is the part it resemblance to the genes for murine major urinary protein (MUP) and ovine &lactoglobulin (OVBLG). We have also may play in sedation and sleep induction. PGD, has both a localized the gene to the long arm of chromosome 9 bands sedative effect and is capable of inducing sleep in rodents and cats (9). The connection between PGDz and sleep is further q34.2q34.3, which is within the region to which subsets of strengthened with the observation that CNS levels of PGD, mutations in bothtuberous sclerosis and familial torsion are significantly elevated in patients in advanced stages of dystonia have been mapped (21-24). sleeping sickness (10). Ina series of elegant experiments, MATERIALS ANDMETHODS Hayaishi and co-workers (11-13) have produced a significant
* This work was supported in part by grants from the National Multiple Sclerosis Society and the National Institutes of Health (to K. S.), National Institutes of Health Training Grant HL 07237 (to D. M. W.), Public Health Service Grant CA 42557 (to J. D. Rowley), and Public Health Service Grant CA40046 (to M. M. L.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement’’ in accordance with 18U.S.C. Section 1734 solelyto indicate this fact. The nucleotide sequence(s)reported in thispaper has been submitted to the GenBankTM/EMBL Data Bank with accessionnumber(s) M98537, M98538, and M98539. 11 Scholar of the Leukemia Society of America. To whom correspondence should be addressed Dept. of Neurology, University of Chicago, 5841 S. Maryland Ave., Chicago, IL 60637. The abbreviations used are: PGD,, prostaglandin Dz; PDS, prostaglandin De synthase; PGH,, prostaglandin HZ;OMgp, oligodendrocyte myelin glycoprotein; MUP, murine major urinaryprotein; OVBLG, ovine @-lactoglobulin;HXB, hexabrachion; CNS, central nervous system; bp, base pair(s); kb, kilobase pairs; FITC, fluorescein isothiocyanate. ++
Isolation of the PDS cDNA and Probe Generation-The PDS cDNAs were cloned from a human fetal spinal cord expression library by virtue of the protein’s reactivity with a polyclonal antiserum raised against the oligodendrocyte-myelin glycoprotein (OMgp) (25). A Xgtll cDNA library derived from spinal cord of a 1-day-old child (American Type Culture Collection) was probed with a polyclonal rat antiserum raised against OMgp (26). Four positive cDNA clones were plaque purified and subcloned into pBluescript KS (Stratagene). After characterizing and sequencing the overlapping cDNA clones, we discovered that they encode a protein distinct from OMgp. One of the cDNA subclones, BlC, was chosen as atemplate for probe synthesis because a small truncation at the3’ end had resulted in the loss of the lengthy polyadenylate sequence found on the other clones. The cDNA insert was excised at the flanking EcoRI sites and was isolated from agarose gels using DE81 ion-exchange paper (Whatman). The probe was generated by incorporation of [cY-~’P]~CTP through random priming (27) of the cDNA insert using an oligolabeling kit (Pharmacia LKB Biotechnology Inc.) followed by purification through a G-25 (Pharmacia) spin column. The probe was used in the Northern and Southern blot analysis as well as in the screening of the genomic library. recombinant X library was Isolation of the GenomicClones-A
23202
23203
Gene Structure of Human Prostaglandin D2Synthase constructed from human genomic DNAisolated from peripheral blood lymphocytes of a single individual. The genomic DNA was partially digested with MboI prior to ligation into the Lambda Fix I1 vector (Stratagene) andpackaging using the Gigapack I1 (Stratagene) packaging mix. P2PLK bacteria infected with the X library were plated, and plaque lifts were obtained using Colony/Plaque Screen (Du Pont) membranes. The library was screened using the probe described above, and six positive clones were plaque purified. After an initial restriction enzyme analysis, three of the six inserts were excised using XbaI and subcloned into pBluescript KS. Sequencing of the GenomicClones-An oligonucleotide-directed approach was used to determine the exon/intron boundaries. Oligonucleotides were designed according to the sequence of the PDS cDNA clone, BlC, and synthesized on an Applied Biosystems 381A automated synthesizer. Sequencing was performed on single- or double-stranded DNA using the dideoxy method of chain termination (28) and Sequenase polymerase (U. S. Biochemicals). Regions of intense secondary structure were resolved using 8% polyacrylamide gels that contained 40% formamide and 7 M urea. Exon/intron boundaries were determined by sequence comparisons between the genomic and B1C cDNA sequences. Sequence analysis was performed using the Seqed and Bestfit programs of the University of Wisconsin Genetics Computer Group Sequence Analysis Software genetics program (29).Intron sizes were determined by direct sequencing, restriction analysis, and/or polymerase chain reaction analysis. Southern Blot Analysis-7 pg of DNA was digested to completion with restriction endonuclease and electrophoresed in a 0.7% agarose gel. The DNA wascapillary blotted onto GeneScreenPlus membranes (Du Pont) and prehybridized and hybridized a t 65 "C following the manufacturer's instructions. The probe was generated as described above. After an overnight hybridization the membrane was washed twice in 1%SDS, 0.1 X SSC a t 65 "C for 30 min and was exposed to x-ray film for 2 days at -70 "C with the use of intensifying screens. Northern Blot Analysis-Total RNAwas isolated from human brain using the guanidinium thiocyanate method of Chomczynski and Sacchi (30). 10 pg of total RNA was electrophoresed through 1% agarose gels containing 3% formaldehyde. The RNA was capillary blotted onto a Gene Screen nylon membrane (Du Pont) and UV crossed-linked to the membrane. Prehybridization and hybridization were performed at 42 "C in a 50% formamide buffer. The probe was prepared as described above. After an overnight hybridization the blot was washed following the same procedure as for the Southern blots. The membrane was exposed to x-ray film for 4 days at -70 "C with the use of intensifying screens. Primer Extension Analysis-Total RNA, isolated as described above, was used in the extension reactions. Two primers, PDS34:CGACGTCCTCTTACCGATGAGT (+64 to +85) and PDS17: GTGTGCGACACCTACCCTGAC (+87 to +107) were end(7000 Ci/mmol, ICN) and labeled by incubation with [Y-~*P]ATP polynucleotide kinase (Boehringer Mannheim) at 37 'C for 45 min. Unincorporated [Y-~'P]ATPwas removed with a G-25 spin column followed by ethanol precipitation of the labeled primer. The primers had a specific activity of 3 X 10' cpmlpg. 35 pg of total RNA or 50 pg of yeast tRNA control were coprecipitated with 3 X lo6 cpm of the primer. The pellet was resuspended in 20 pl of hybridization buffer (50 mM NaC1, 50 mM Tris.Cl, pH 8.4 and 6 mM MgClZ), denatured at 80 "C for 4 min, and slowly cooled to 50 "C. Hybridization was continued for an additional 2 h after which the reaction volume was increased to 50 pl and contained 10 mM dithiothreitol, 400 p~ dNTPs and 20 units of RNasin (Promega) inhybridization buffer. 8 units of avian myeloblastosis virus reverse transcriptase (Boehringer Mannheim) was added and thesamples were incubated at 42 "C for 30 min. The products were treated with RNase A (Sigma) at room temperature and recovered by ethanol precipitation. Samples were resuspended in 6 pl of TE (Tris-EDTA) and 9 pl of formamide loading buffer and were denatured a t 95 "C for 3 min before loading, Singlestranded DNA derived from a genomic subclone (G4CS86) containing the 5' end of the gene, and flanking region wassequenced by standard methods with the primers used in the extension reactions. The extension products and the corresponding sequencing reactions were electrophoresed side by side on a sequencing gel. Fluorescence in Situ Chromosomal Hybridization-Human metaphase cells were prepared from phytohemagglutinin-stimulated peripheral blood lymphocytes. The 17-kb genomicDNA insert from genomic subclone G4CXA, which contains the PDS gene, was used as the PDS probe. The 15-kb hexabrachion (HXB) genomic DNA probe 44R10 (31) and a repetitive DNA probe derived from pericentromeric P-satellite sequences of chromosome 9 (pHur98, kindly
provided byR. K. Moyzis, Los Alamos National Laboratory) were cohybridized with the PDS probes in some experiments. The ABL probe (c-hu-abl) is a 35-kb cosmid (pCV105) clone containing the 3'coding sequences of the human ABL oncogene (kindly provided by C. A. Westbrook, Dept. of Medicine, University of Chicago). The procedure used for fluorescence in situ hybridization is a modification (32) of the method described by Lichter et al. (33). Biotin-labeled probes were prepared by nick translation using Bio-11-dUTP (Enzo Diagnostics). Hybridization was detected with fluorescein isothiocyanate (F1TC)-conjugated avidin (Vector Laboratories), and chromosomes were identified by staining with 4,6-diamidino-2-phenylindoledihydrochloride (DAPI). For dual-color fluorescence, probes were labeled by nick translation with Bio-11-dUTP or with digoxigenin11-dUTP (Boehringer Mannheim). The biotin-labeled probe is detected with FITC-avidin, whereas the digoxigenin-labeled probe is detected with rhodamine-conjugated sheep anti-digoxigenin antibodies (Boehringer Mannheim). The slides were examined using an FITC/rhodamine double-band pass filter (Omega Optical).
RESULTS
Organization of the PGDz Synthase Gene-A human genomic library constructed from peripheral blood lymphocyte DNA was screened using a probe derived from the human PDS cDNA clone B1C. Three distinct X clones, lA, 4C, and 5B,were isolated, and each contained the entire PDS gene. To determine theintronlexon boundaries, oligonucleotide primers were made according to thecDNA sequence and used to sequence the genomic subclones. A comparison of these genomic sequences to the cDNA sequences allowed intron/ exon boundaries to be established. The gene consists of seven exons ranging in size from 23 to 184 bp and six introns that range in size from 90 to 784 bp. The sizes of the first and sixthintrons, which were not completely sequenced, were determined with polymerase chain reaction and confirmed with restriction analysis. The sizes and relative positions of the exons and introns aswell as a restriction map of the PDS gene are given in Fig. 1. Northern and Southern Blot Ana1ysis"In order to determine if there are multiple forms of the PDS message in the brain, total RNA from adult human brain was used in a Northern blot analysis. When hybridized with a PDS cDNA probe (Fig. 2),a single hybridizing band was observed at approximately the expected size for the PDS mRNA (0.9 kb) (19).
Human genomic DNA from a single individual was used to produce Southern blots. When probed with the PDS cDNA probe (Fig. 2), all hybridizing bands were consistent with the restriction map constructed from the genomic clones. These observations suggest a single copy of the PDS gene in the haploid genome. Sequence of the PGD2 Synthase Gene-The nucleotide sequence of the PDS gene is shown in Fig. 3. The first exon is split between coding (114 bp) and noncoding (74 bp) sequences. The sixth exon is quite small (23 bp)and ends precisely at the stop codon. The seventh andfinal exon is 163 bp and is entirely noncoding. A polyadenylation signal (AATAAA) is found 18 bp upstream from the polyadenylation 11 111
I %A
432 188
" L
I
J.~
IV
v
140 11
_
~
~
~
Ill
~
~
~
VI1
f l " * L~J-" ~
23
102
Ilrn n I
~
VI
" ' "f
-23."
I63
*,9;NNI
~
.
~ l~ l ~l s~ " " I ~- ~ f ~ I ~ ~~ ~! ~ . ~ . . !~ . ~ l k"
I kh
,
FIG. 1. Structure of the PDS gene. The boxes represent exons and the lines introns. Numbers below the boxes are exon sizes in bp. The shaded portion of the boxes represents the coding portion of the exons. Numbers above the lines represent the intron sizes in bp. Roman numerals refer to the exon number. The location of several restriction sites are shown below.
Gene Structure of Human Prostaglandin D2Synthase
23204
product that maps to the same G residue 74 bp upstream of the initiating ATGwasobserved when the extension was performed using the 22-base primer PDS34 that covers coding as well as noncodingregions (bases +64 to +85) (Fig. 4). These observations are consistentonly with the sequence of the genomic clones. Chromosomal Localization of the PGD, Synthase Gene-To determine the chromosomallocalization of the PDSgene, we performed fluorescence in situ hybridization of a biotin-labeled PDS genomic probe to normal human metaphase chromosomes. Fluorescent signals from biotin-labeled probes are visualized as discrete green-yellow dots on unstained chromosomes; specific signal is frequently observed on all four chromatids. Hybridizationof the genomic PDS probe resulted in specific labeling only of chromosome 9 (Fig. 5). Specific labeling of 9q34.2-q34.3 was observed on three (five cells) or FIG.2. Northern and Southern Blot Analysis. A, Northern all four (20 cells) chromatids of the chromosome 9homologues blot of human brain total RNA. 10 pg of total RNA was electrophoresed through 1% agarose gels containing formaldehyde. The RNA in 25 cells examined. Similar results were obtained in three probes. was capillary blotted and hybridized with a probe generated from a additionalhybridizationexperimentsusingthese full-length cDNA clone. The PDS message is the band below the 18 Thus, the PDS gene is localized to chromosome 9, bands S ribosomal band. i?, Southern blot analysisof the human PDSgene. q34.2-q34.3. 7 pg of genomic DNA was digested to completion with the indicated T o determine the localization of the PGD, synthase gene enzyme and electrophoresed through 0.7% agarose gels. DNA was capillary blotted and was hybridized with a probe generated from a relative to the ABL oncogene (9q34.2) (35), the HXB gene (9q33-q34) (36), and the centromere, we used dual-color flufull-length cDNA clone. The higher molecular weight band in the orescence in situhybridization. Biotin-labeled PDS and HXB RglI digest is the resultof incomplete cutting. probes were cohybridized with a digoxigenin-labeled ABL probe. The HXB probe hybridized to 9q33, whereas the signals site. Four of the six introns that were completely sequenced for the ABL and the PDS probes were observed at 9q34.2are included in Fig. 3. The intronic 5' and 3' acceptor and q34.3. The chromosome 9 centromere was identified with a donor splice sites follow the GT/AG consensus (34) (Table probeforpericentromeric@-satellite sequences. The ABL I). The gene measures approximately 3600 bp with the exons signal (detected with rhodamine) was centromeric to the PDS occupying 810 bp or 23% of the gene. signal, indicating that the order of these genes is cen-HXBA comparison of the sequences of the PDS gene to our ABL-PDS-tel. cDNA clone, BlC, reveals no differences between either the Relationship between the PGD, Synthase Gene andthe coding regions or the 3'-non-coding regions. The coding and Genes for Mouse Major Urinary Protein and Ovine /3-Lacto3"noncoding regions of the previously published cDNA se- globulin-The deduced amino acid sequence of PDS places it quence (19) differ from the gene sequence presented here a t in a superfamily of proteins that Pervaiz andBrew (37) have 38 separate bases, resulting in a discrepancy of eight amino termed the lipocalins. The lipocalins are small secretory proacidsand a 10-bpinsertion immediately upstream of the teins usually involvedin the transport of hydrophobic ligands. polyadenylation signal. The5'-untranslated region of the of the PDSgene to othermembers We compared the structure cDNA clone B1Ccontains a deletion and aninversion involvof the lipocalin family whose gene structures areknown. TWO ing bases5-65 as compared to thegenomic sequences. When members of this superfamily have gene structures very similar compared to the gene, the 5'-untranslated region of the preto that of PDS: mouse major urinary protein (MUP)(38)and viously reported cDNA contains two insertions of 11 and 3 ovine @-lactoglobulin (OVBLG) (39). A diagrammatic combp. In a preliminary search for polymorphisms in the PDS parison of the structures of the three genes is shown in Fig. gene, Southern blots of genomic DNA from peripheral blood cells of 20 adults that hadbeen digested with NcoI and Sac1 6. Among the common features are: 1) a first exon that is split between coding and noncoding sequences. 2) The sizes were hybridized with the PDS cDNA probe. We found no of the second through fifth exons in the PDS gene closely evidence of polymorphisms (data not shown). resemble the sizes of these exons in the MUP and OVBLG Mapping the Transcriptional Start Site-The differences between thecDNA clone BlC, thepreviously reported cDNA genes. Their sizes vary among these three genes by five or sequence, and the 5'-untranslated region of the gene called fewer bp. 3) The sixth exonof each is quite small (23-46 bp) codon. 4) The seventh exon is in general for further examination. We reasoned that the size of the and contains the stop the largest and is entirely noncoding. The coding region of primer extension product could be used to confirm that the coding sequence the PDSgene has a 42% identity to the MUP genomicclones represent the actual form of the PDS 5'untranslated region. Two primers were designed such that and a 44% identity to the OVBLG-coding sequence. A comone of them (PDS17) was common to all three sequences andparison of the 3"noncoding regions of the PDS gene to the the other (PDS34) would correctly hybridize to the genomic MUP and the OVBLG genes reveals a 42 and 45% identity, sequences only. The primer extensionswere performed using respectively. The 5"untranslated region of the PDS gene is total RNA from adult human brain as a template. Using the 37% identical to MUP and50% identical to the OVBLG 5'21-base primer PDSl7 that is complementary tonucleotides untranslated regions. The rat congener of the MUP genefamily are the LYZ" +87 to +107, a product of 107 bp was obtained. The product was electrophoresed alongside a dideoxy sequencing ladder globulin genes. When the PDSgene sequences are compared globulin (40,41) we find generated using the primer PDS17 and the genomic subclone to the genomicsequencesfor rat G4CS86 that contains the 5' end of the gene as well as 5'- a 42% identity both for the coding and 3"noncoding portions flanking sequences. A singleband was observeda t a G residue and a 32% identity for the 5"untranslated part of the genes. The intron phasing, i.e. the position within the codon a t 74bpupstream of the initiating ATG (Fig. 4). An 85-bp :\ .
I3
Gene Structure of Human Prostaglandin
1 44
AGGCCCCGGACACCCGCTCTGCTGCAGGAGA
D2 Synthase
23205
yet a l a T h r H - 3 H i s T h r Leu Trp Xet Gly Leu Ala LeU Leu Gly Val Leu GlY ATG G C T ACT CAT CAC ACG CTG TGG ATG GGA CTG GCC CTG CTG GGG GTG CTG GGC
19 Asp Leu Gln Ala A l a Pro Glu Ala Gln Val S o r Val Gln P r o Asn Phe G l n Gln ASP LYS 128 GAC CTG CAG GCA GCA CCG GAG GCC CAG GTC TCC GTG CAG CCC AAC TTC CAG CAG GAC 9tg.ggggCttcct9c9tc.C GlY
39 188
cccl.gqqctacaggaccctgtca
Leu
Phe
E X O N I1
. . .6 9 0 b p . . g t c c g g a q g g t c c g g q c c g a c g g c g g ~ t g g g g g t c ~ c t ~ g c ~TTC ~ C ~ 9CTG
GGG
A r g Trp CGC TOG
44 Phe S e r Ala Gly Leu Ala S e r Asn S e rS e r Trp Leu Arg Glu Lya Lys Ala Ala Leu S*r Net CyS LyS S e r Val V . 1 TTC AGC GCG GGC CTC GCC TCC AAC TCG AGC TGG CTC CGG GAG M G AAG GCG GCG TTG TCC Arc TGCM G TCT GTG
204
70 202 85
329 98
366
s e r Thr Phe Leu AI GCC CCT GCC ACG GAT GGT GGC CTC AAC CTG ACC TCC ACC TTC CTC AGg t g g g . C a g C g g q C l g g t q g g t t t C t g g g ~ C 9 9 9 9 t A l a Pro Ala Thr Asp Gly Gly Leu Asn Leu Thr
EXON 111 g ~ yThr s AGlu sn Cys Gln Arg Thr Not Gln Leu LOU ccagggac~ccc~cqggcct~acccctgaccctgaggtcacccacctacG a gA M AAC CAG TGT GAG ACC CGA ACC ATG CTG CTG CAG
P r o Ala Gly S e r Leu Gly S e r Tyr S e r Tyr Arg S o ? P r o H CCC GCG GGG TCC CTC GGC TCC TAC AGC TAC CGG AGT ccc c g t g a g t g g g g c c t c c a c c g g c c c t g g g a g c c t g g g g g a c a C t t 9 C C 9 qg~cgactctgggccagccccctgccccggagatccatggggtggggggtgatggctgccccacc~gcgtc~gaggcaa~ggccaggcctgggcgtgact acc~~tg~~caagtgttaqggacagaqagagagacccttcctccaggggqttggatcctctctggagcccaccattgtcttgtcaggcccccttccctgccctctg
gagttttccccaataagcacagcccccaaggcccctc~tatgcctccatcccaattctcctccccaggacccaggggtttcctcactccacctggga~tg gctcc~cqgqga~acctcttcacttccggttctggtca~gcgacttctgcggctgcaccagg~atcctggttttctgagcctggctcccccqttctggtt tgggqacaqqgttcacaggctgtqcag~cgagagcagggcactggctggagagcagccgggtgggggagcatcccgggcc~gccgagggctg~gtgcccc
111 406
E X O N IV is Trp Gly S * r c a a ~ g c c c a c a g q t g c ~ c c c c t t c c c t g a a g c a g a g g t g a g g t t t g g g g g g c t g g t c c c c g a c ~ g g g t t g t c t c t t g g g t t c c c aAgC T G G G G C A G C
115 Thr Tyr s e r Val S e r Val Val Glu Thr Asp Tyr Asp Gln Tyr Ala Leu Leu Tyr S e r Gln Gly S o r Lys Gly P r o 417 ACC TAC TCC GTG TCA GTG GTG GAG ACC GAC TAC GAC CAG TAC GCG CTG CTG TAC AGC CAG GGCM G AGC GGC CCT 140 Gly Glu Asp Phe Arg Net Ala Thr Leu Tyr 5 492 GGC GAG GAC TTC CGC ATG GCC ACC CTC TAC 150 523
A
qtacgtgccccgtqgacqccgcccacacgc~ggcctgaccag~ggggggctccCC~~9
EThr X O N v eGln r A r g Thr P r o A r g &la Glu a c c c ~ g g g c a g g g c ~ c a c a g c ~ t c c c c c t c c g c t g ~ g g c c a g c t c c g t c t c c ~ c c c t g t c cGC c a gCGA ACC CAG ACC CCC AGG GCT GAG
159 Leu Lys Glu Lys Phe Thr A l a Phe Cys Lys Ala Gln Gly Phe Thr G1U Asp Thr 11. Val Ph* Leu P r o Gln M 549 TTA M G GAG AAA TTC ACC GCC TTC TGC AAG GCC CAG GGC TTC ACA GAG GAT ACC ATT GTC TTC CTGC CCC 183 Thr A 621 ACC G
qtgaqgqgtcctaactgatggggagaggatcaaggtcagatt~gaggcaggcaggcagtctcctgactgggggaggc~gagggg~ggaggtgg
ccccgcctgctcgaggcctgggcagggacagagggggtg~gtgttcaagtcagaacctccctcccgcagccccttc~tgaggagccccctccatgggg~c atggag~ccagqcgcccactctgtgccaggccccagcagctcccaggatgtggggcttc~gcctggtggggggc~atgggataggggtgcc~tggg~tac agggg~acc~cc~tactgggctc~gc~cagcctcctaggggtggacagcctgctcttggc~gaggtgg~gaa~g~ccctctctttgtttcc~gtgccc~g ggagaggtqgq~ggtg~tgqgggatctgtgcagtttgggggctc~gtca~ag~cg~gctctgcgttacggg~ggaacagga~gcccagtgggaaa~ttgg 184 625
E X O N VICys s p Lys Gln Glu Met Thr End c c t a a q t c t g g g g t t c t g ~ c g a c a g c c c c t g g c t t c t t t c t t g g c a g AT AAG TGC ATG ACG GAA C M TAG gtgagccact
...5 5 0 b p . . g g g t ~ g ~ c t g c ~ g t c c t c c ~ t ~ c t a g c t t t c g g t c a c a
ccattc~ttcattcattcattcattcattcattcattcattcaacacacatc E X O N VI1
640
cccctzaq
740
CGGCTCCCCGCCAAAGCACCCCTGCCCACTCGGGCTTCATCCTGCACAATAAACTCCGGAAGCAAGTCAGT ctqqctcctggctgtctqcqctgtc.tc.
G A C T C C C C A G G G C T G A A G C T G G G X T C C C G G C C X G C C X G G T G C C C C T G C C C
-
cccqtcctgqqcctggcctggcc~cccggacctccccctcta.aatctc.gcctgacgtca.c..agga.c
FIG. 3. Nucleotide sequence of the human PDS gene. The nucleotide sequence of the exons and flanking intronic regions are presented. Capitalized sequences are present in the cDNA. Sequences that are underlined are noncoding in the cDNA. The deduced amino acid sequence is above the coding sequence. The bored sequence is the TATA box-like element and the polyadenylation signal is double underlined. The upper of the two numbers refers to the amino acid residue number, the lower refers to the nucleotide number in the cDNA. The numbers within the sequence represent the approximate size of the intronic sequences not included in the figure.
TABLE I Structure of the enonlintron junctions Exonic nucleotides are capitalized. The predicted amino acid is given below each codon. 5’ Junction
Exon
G CTC
tcgccgcag
TTC Phe
CTC CAGCTG
CTG GGG Leu Gly c a c c c a c c t a c o g G AAA AAC CAG g LYS A s n Gln t t g g g t t c c c a g AC TGG GGC AGC is Trp GlySer c t g t c c c a g GC CGA ACC CAG erArg Thr Gln ATG t t c t t t c t t g g c a g AT AAG TGCACG Cys Met SPLYS accctcag GAC TCCCCACAA
3’ Junction
I I1 I11 IV V
VI VI1
Gln TTC Phe CGG Arg ACC Thr
ccc
GAC Asp CTC Leu AGT Ser CTC Leu CAA
AAG Lys AG Ar CCC Pro TAC Tyr ACC Thr
Pro Gln GAA CAA Thr Glu Gln GTC AGT
Gene Structure of Human Prostaglandin Dz Synthase
23206
which the intron interrupts the exon, is conservedin the genes of the lipocalin family (39). The PDS gene possesses A C (i .I' I this same conserved intron phasing (Fig. 6) whereby the first and sixth intron interruptbetween codons, the third through fifth introns interrupt between the first and second base of the codon, and the second introninterrupts between the second and third baseof the codon. When the deduced amino acid sequences of PDS, MUP, and OVBLG are aligned to maximize their sequence similarities (Fig. 7), we find that the location of the introns within the primary structure of the proteins is conserved as well. PDS contains the conserved amino acids and spacings that are a hallmark of the lipocalins. PDS shares 24% identity and 46% similarity(accountingfor conservative substitutions) with MUP and 23% identity and49% similarity with OVBLG. A comparison of the deduced amino acid sequences of PDS to a2, globulin shows that they are 28% identical and 48% FIG. 4. Primer extension. Radiolabeled primers complimentary similar. In Fig. 7,we have also aligned the PGD, synthase to nucleotides +87 to +lo7 (PDS17) or +64 to +85 (PDS34) were hybridized to 35 pg of total RNA isolated from human gray matter. sequence withthat of thehumanretinol-bindingprotein of the superThe annealed primerswere extended with avian myeloblastosis virus which is one of the best characterized members reverse transcriptase and the products sized on a 6% polyacrylamide family and whose tertiary structure has been crystallographdenaturing gel. A , primer PDS17 yieldeda 107-base product(lane I ). ically solved (42). A dideoxy sequencing reaction was carried out on a genomic clone containing the sequences around the start site using primer PDS17 DISCUSSION and run as a size marker (lanes A , C, G, and 2'). R, primer PDS34 yielded an 85-base product (lane 2). A dideoxy sequencing reaction In this studywe report the structureof the PDS gene. The was carried out on the same genomic clone as above using primer gene is small (3.6 kb) and iscomposed of seven exons andsix PDS34 of which the ddCTP reaction(lane C ) and the ddGTP reaction a G (lane G ) were run as a size markers. The start site was identified as introns.We mapped the transcriptional start site to residue 74 bp upstream of the ATG initiation codon and a single band at a G residue 74 bp upstream of the initiating ATG. located a TATA box like element (ATAAATA) 21 bp 5' from the transcriptional startsite. Given the structural integrityof the gene and its high sequence similarity to the cDNA for PDS we have concluded that this is the gene for PDS. Southern blot analysis indicates that thereis a single copy of the PDS gene inthehaploid genome. Northern blot analysis detected only one message in total RNA from adult human brain that hybridizes to the PDS cDNA. A comparison of the exonsof the PDS gene to thepreviously published cDNA sequence (19) aswell as to ourcDNA clone "
3
Intron 1
FIG. 5. Chromosomal localization of the PDS gene. A and H , in situ hybridization of a biotin-labeled PDS probe and a biotinlabeled chromosome 9-specific /3-satellite probeto human metaphase cells from phytohemagglutinin-stimulated peripheralblood lymphocytes. A , counterstained with DAPI. R, detection of the probe with FITC-conjugated avidin. The chromosome 9 homologues are identified witharrows; specific labelingwas observed at the 9qh centromeric region and a t 9q34.2-q34.3. C, partial karyotype of a chromosome 9 homologue illustrating specific labeling at 9q34.2-q34.3 (arrow).
PC",
;n
7":
"I1
1.1"
IX8
MUP
*)!LC, IU
I*
I
)
t)
.
~.
IO? 20
RBP
"q"" 116
,k"-
r: IC11
71
r.
Intron 3
1)
!-I Ill
-,,
."
I E
22.10
~
82
,-.!28l. ~
7.1
46
K
T.1 .........M K M L L L L C L G L T L V C V H A E E A M S T G,NV ~ K . . .MKCLLLALG. LALACGVQAI IVTQ. . . . .T M K C L D I Q K h v ~ 1 @ @ ...................... E R D C R V S SSFTYAM. FTKI~N~
Intron 5 OVRLC
.@TQ L@$S . Intron 2
PGDZQ MUP OVBLG
161
:-',"p
OVBLG
MATHHTLWMGLALLGVLGDLQAAPEAQVS..
:
,'
-)I
1
1112
I II
71
I)
32
.,12.-.
117
1:
2 3
lhl
i
$2
77
PGDZ MUP
111s
..
,90
~nn
42 I Ih
FIG. 6. Comparison of the structure of the PDS gene to the MUP and OVBLG genes. The boxes representexons with the shaded regions representing the coding portions of the gene. Numbers below the exom are exon sizes in bp. The lines connecting the boxes represent the introns. The position within the codon at which the intron interrupts is given above the line where 3:1indicates an intron that interrupts between adjacent codons, 2:3 an interruption between the second and third base of a codon, and 1:2indicates anintron that interrupts between the first and second base of a codon.
OVBLG
FIG. 7. Comparison of the aminoacid sequences.The deduced amino acid sequence for human PDS was aligned against those for MUP, OVBLG, and retinol-binding protein so as to maximize the conservedresiduesbetweenthem. The keyconservedresiduesare boxed. The intron positions are indicated by the thick oertical lines. The dots indicate gaps that wereintroduced to achievemaximal alignment. The deduced amino acids for PDS are numbered on the right.
Gene Structure of Human Prostaglandin
D2Synthase
23207
reveals numerous differences. The GC content of the PDS OVBLG genes they were 42 and 44% identical, respectively. message is relatively high at 64% and presented several areas A comparison of each exon of the PDSgene to thecorrespondof secondary structure that proved difficult to sequence. It ing exon in the MUP and OVBLGgenes reveals that no was in these areas that the majority of the sequence discrep- particular exon is more highly or consistently conserved than ancies arose. We had the benefit of comparing our cDNA to the other six. When the PDS primary structure is compared that of Nagata et al. (19) as well as to thegenomic sequences. to the primary structures of MUP and OVBLG they are 46 Therefore, we are certain of the exonic sequences presented and 49% similar, respectively. When a similar comparison is here. Northern blot analysis demonstratesthat B1C hybrid- made to rat aZuglobulin and bovine @-lactoglobulinthe simiizes to a single message in human CNS that is the same size larity rises to 48 and 57%, respectively. The 3”noncoding as the message detected with the cDNA reported by Nagata regions of the genes were compared and found to have the et al. (19). Furthermore,underthese same conditions the same level of identity as the coding regions. The high level of human B1C probe also hybridizes to one message in rat CNS conservation found in the 3’-noncoding regions may imply a (data not shown) of the same size as themessage reported by role for these sequences in mRNA stability or translation Urade et al. (18).This occurs in spite of the fact that rat and efficiency. The lipocalins can be characterized as small, soluble, secrehuman sequences are only 71% identical. Primer extension tory proteins that bind small hydrophobic molecules (37). using primers from two different positions on the 5’end generate only one product. The lack of heterogeneity in the PDS fits well into thisclass since its substrate, PGH,, is also primer extension product argues against the existence of a small hydrophobic molecule. It differs from other members either multiple forms of the PDSmessage or of other messages of the superfamily in that it has an intracellular localization very similar to the PDS message. Thus, it is clear that the (47)and thatit has enzymatic activity. Thereareother exonic sequences reported here andthe cDNA sequences members of the lipocalin superfamily that have unique localreported by Nagata et al. (19) are the same. izations. Avian purpurin(48),aprotein with which PDS The presence in and function of PGD2 in the CNS has been shares 49% similarity, has been found associated with the or is rapidly being established for many higher mammals. Yet extracellular matrix and hasbeen implicated in the promotion little is known regarding the presence of PGDpor its function of cell-substrate adhesion in vitro, yet purpurin is still considin the human CNS. Early studiesfailed to detect the presence ered to be a retinol transporter. It is possible that PDS may of PGD, in cerebrospinal fluid or brain tissue (43) while recent also posses a functional duality in that it catalyzes the conanalysis has clearly demonstratedits presence in normal version of PGH2 toPGD2 butmay also transport theproduct humanCSF(10). The presence of the enzyme in the to a second site of action. human CNS argues for a functional role for PGD, in the The brain-specific expression of the PDS gene andthe CNS. Our data indicate that the message for PDS is indeed developmentally associated shift in its expression from neuabundant in the human brain. While there may be at least rons to oligodendrocytes may indicate that the PDS gene is one otherenzyme possessing the same function as PDS in the controlled in a tissue-specific and developmentally coordibrain (171, PDS is the first tohave been characterized exten- nate“ manner. The knowledge of the regulatory elements of sively at themolecular level. the lipocalin genes is limited. Best studied are the regulatory The PDS gene is on chromosome 9 bands q34.2-q34.3 and elements of the azu globulin gene, where glucocorticoid reis telomeric to HXBand ABL. Several of the genes that have sponse elements have been identified in the upstream region been mapped to this region are gelsolin (GSN, q34), &ami- of the gene (49). Furthermore, an in vitrofootprinting study nolevulinate dehydratase (ALAD, q34), arginosuccinate syn- has found binding of tissue-specific nuclear factors to the thetase (ASS, q34-qter), adenylate kinase (AKI, q34.1-q34.2), third intron of the azuglobulin gene (50). It is of interest that and the AB0blood groups (ABO, q34.1-q34.2) (44). the sixth intronof the PDSgene shares some of the sequence The observation that the AB0 genes and the PDS gene elements with the third intron of the azuglobulin gene. The share thesame region of chromosome 9 is of interest because cloning andcharacterization of thePDS genewillallow i t has been found that in 40% of families with tuberous analysis of the transcriptional regulation of the PDS gene in sclerosis the disease locus (TS1) is linked to the AB0 blood the brain. groups on 9q34 (21, 22). Tuberous sclerosis is an autosomal dominant disease that in the CNS is characterized by tumors Acknowledgments-We thank Drs. Pornpimol Rongnoparut and Linda S. Marton for critically reading the manuscript and Anthony and malaligned or disorganized tissue (45). Familial torsion dystonia is an autosomal dominant disease A. Fernald for technical assistance. that has been localized by genetic linkage analysis in two REFERENCES large kindreds to chromosome 9 q32-34 (23, 24). The disease 1. Smith, W. L. (1989) Biochem. J. 259,315-324 2. Shimizu, T.,and Wolfe, L. S. (1990) J. Neurochem. 5 5 , 1-15 is characterized, among other things, by involuntary muscle 3. Giles, H., and Leff, P. (1988) Prostaglandins 3 6 , 277-300 contractions resulting in abnormal postures and movements 4. Hayaishi, 0. (1983) Adu. Prost Thromb. Leuk. Res. 1 2 , 333-337 5. Ueno, R.,Narumiya, S., Ogorochi, T., Nakayama, T.,Ishikawa, Y., and (46). In one of the kindreds, recent evidence places the gene Hayaishi, 0. (1982) Proc. Natl. Acad. Sei.U. S. A. 79,6093-6097 for torsion dystonia to an 11centimorgan region between the 6. Forstermann, U., Heldt, R., Knappen, F., and Hertting, G. (1982) Brain Res. 240,303-310 gelsolin (24) and argininosuccinate synthase genes with the 7. Forstermann, U.,Seregi, A., and Hertting, G. (1984) Prostaglandins 2 7 , gene most likely located between the ABL oncogene and the 913-923 8. Kinosshita, F., Nakai, Y., Katakami, H., Imura, H., Shimizu, T.,and argininosuccinate synthase gene. The PDS gene is located in Hayiashi, (1982) Endocrinology 110.2207-2209 this region and is therefore, based on itsposition, a candidate 9. Lavchock. S.0. G.. Johnson. D. N.. and Harris. L. S. (1980) . , Pharm. Biochem. & Behauior 12,747-754 gene for torsion dystonia. The identification of polymor10. Pentreath, V. W., Rees, K., Owolabi, 0. A., Philip, K. A., and Doua, F. phisms in and around the PDS gene would allow for genetic (1990) Trans. Royal SOC.Trop. Med. Hyg. 84,795-799 mapping of the PDS gene in relationship to the tuberous 11. Onoe, H., Ueno, R., Fujita, I., Nishino, H., Oomura, Y., and Hayaishi, 0. (1988) Proc. Natl. Acad. Sci. U. S. A. 86,4082-4086 sclerosis and torsion dystonia loci. 12. Ueno, R., Kazuki, H., InouB, S., and Hayaishi, 0. (1983) Proc. Natl. Acad. The PDS gene has a structure that is almost identical to Sci. U. S. A. 80,1735-1737 13. Hayaishi, 0. (1991) FASEB J. 5,2575-2581 the MUP and OVBLG genes.When the coding regions of the 14. Nugteren, D. H., and Hazelhof, E. (1973) Biochim.Biophys.Acta 3 2 6 , PDS gene were compared to coding regions of the MUP and 448-461 ’
Gene Structure of Human Prostaglandin Dz Synthase
23208
15. Christ-Hazelhof, E., Nugteren, D. H., and Van Dorp, D. A. (1976) Biochim. Biophys. Acta 460,450-461 16. Urade, Y., Fujimoto, N., Ujihara, M., and Hayaishi, 0.(1987) J. Biol. Chem. 262,3820-3825 17. Shimizu, T., Yamamoto, S., and Hayaishi, 0.(1979) J. Biol. Chem. 2 6 4 , 5222-5228 18. Urade, Y., Nagata, A,, Suzuki, Y., Fujii, Y., and Hayaishi, 0.(1988) J. Biol. Chem. 264,1041-1045 19. Nagata, A., Suzuki, Y., Igarashi, M., Naomo, E., Hiroyuki, T., Urade, Y., and Hayaishi, 0.(1991) Proc. Natl. Acud. Sci. U. S. A. 88,4020-4024 20. Urade, Y., Kaneko, T., Fujimoto, N., Watanabe, Mizuno, N., and Hayaishi, 0.(1985)Adu. Prost. Throm. Leuk. Res. 1 6 , 549-551 21. Freyer, A. E., Connor, J. M., Povey, S., Yates, J. R.W., Chalmers, A,, Fraser, I., Yates, A. D., and Osborne, J. P. (1987) Lancet 1,659-661 22. Connor, J. M., Pirrit, L. A., Yates, J. R. W., Freyer, A. E., and FergusonSmith, M. A. (1987) J. Med. Genet. 24,544-546 23. Kwiatkowski, D. J., Nygaard, T. G., Schuback, D. E., Perman, S., Trugman, J. M., Bressman, S. B., Burke, R. E., Brin, M. F., Ozelius, L., Breakefield, X.O., Fahn, S., and Kramer, P. L. (1991) Am. J. Hum. Genet. 48, 121128 24. Kwiatkowski, D. J., Ozelius, L., Kramer, P. L., Perman, S., Schuback, D. E., Gusella, J. F.,Fahn, S., and Breakefield, X. 0.(1991) Am. J. Hum. Genet. 49,366-371 25. Mikol, D. D., Gulcher, J., and Stefansson,K. (1990) J. Cell Biol. 110,471-
33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44.
479
26. Mikol, D. D., and Stefansson, K. (1988) J. Cell Biol. 1 0 6 , 1273-1279 27. Feinberg A. P., and Vogelstein, B. (1984) Anal. Biochern. 137,266-267 28. Sanger, Nicklen, S., and Coulson, A.R. (1977) Proc. Natl. Acud. Sci. U. S. A. 74,5436-5467 29. Devereux, J., Haeberli, P., and Smithies, 0.(1984) Nucleic Acids Res. 12, 387-395 30. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162,156-159 31. Gulcher, J., Nies, D. E., Alexakos, M., Ravikant, N. A., Sturgill, M. E., Marton, L. S., and Stefansson, K. (1991) Proc. Natl. Acud. Sci. U. S. A. 88,9438-9442 32. Rowley, J. D., Diaz, M. O., Espinosa, R., Patel, Y. D., van Melle, E., Ziemin,
P.,
45. 46. 47. 48. 49. ~~
50.
S., Taillon-Miller, P., Lichter, P., Evans, G. A., Kersey, J. D., Ward, D. C., Domer, P. H., and Le Beau, M.M. (1990) Proc. Natl. Acad. Sci. u. s.A. 87,9358-9362 Lichter, P., Cremer, T., Borden, J., Manuelides, L., and Ward,D. C. (1988) Hum. Genet. 80. 224-234 Breathnach, R., and Chambon, P. (1981) Annu. Rev.Biochem. 60, 349383 Heisterkamp, N., Stephenson, J. R., Groffen, J., Hanson, P. F., De Klein, A,, Bartram, C. R., and Grosveld, G. (1983) Nature 306,239-242 Gulcher. J.. Alexakos. M.. Le Beau. M. M.. Lemons., R. S.., and Stefansson. K. (1990) Genomic; 6,616-622 ' Pervaiz, S., and Brew, K. (1987) FASEB J. 1,209-214 Clark. J. A,. Clissold. P. M.. AI Shawi.. R.., Beattie.. P... and Bishou. J. (1984) EldB0 J: 3,104511052 Ali, S., and Clark, A. J. (1988) J. Mol. Biol. 1 9 9 , 415-426 Dolan, K. P., Unterman, R., McLaughlin, M., Nakhasi, H., Lynch, K. R., and Feigelson, P (1982) J. Biol. Chem. 2 6 7 , 13527-13534 Winderickx, J., Van Dijck, P., Dirckx, L., Volkaert, G., Rombauts, W., Heyns, W., and Verhoeven G. (1987) Eur. J. Biochem. 166,521-529 Newcomer, M. E.,Jones, T. A., Aqvist, J., Sundelin, J., Eriksson, U., Rask, L.,and Peterson, P. A. (1984) EMBO J. 3 , 1451-1454 Abdel-Halim, M. S., von Holst, H., Meyerson, B., Sachs, C., and Anggird, E. (1980) J. Neurochem. 3 4 , 1331-1333 Povey, S., Falk, C., and Smith, M. (1991) Cytogenet. Cell Genet. 68,403427 Stefansson, K., Wollman, R. L., and Huttenlocher, P.R. (1988) in Tuberow Sclerosis (Gomez, M. R., ed) pp. 75-87, Raven Press, New York Fahn, S. (1988) Adu. Neurol. 60, 1-8 Urade, Y., Fujimoto, N., Kaneko, T., Konishi, A., Mizuno, N., and Hayaishi, 0. (1987) J. Biol. Chem. 2 6 2 , 15132-15136 Berman, P., Gray, P., Chen, E., Keyser, K., Ehrlich, D., Karten, H., LaCorbiere, M., Esch, F., and Schurbert,D. (1987) Cell 61,135-142 Soares. V. D. C.. Gubits. R. M.. Feieelson., P... and Costantini., F. (1987) . . Mol.'CellBiol. b, 374913758 Choy, H. A., McLaughlin, M., and Feigelson, P. (1989) J. Biol. Chem. 2 6 4 , 1754-1759
