Structure and Expression of the infA Operon Encoding Translational ...

THEJOURNAL O F BIOLOGICAL CHEMISTRY (0 1991 by The American Society for Biochemistry

Vol. 266, No. 25, Issue of September 5 , pp. 16491-16498, 1991 Printed in U.S.A

and Molecular Biology, Inc.

Structure and Expressionof the infA Operon Encoding Translational Initiation Factor IF1 TRANSCRIPTIONALCONTROL

BY GROWTHRATE* (Received for publication, April 16, 1991)

Helen S. CummingsS, John F. Sands$, Patricia C. Foreman, Jeri Fraser, and John W. B. Hershey From the Department of Biological Chemistry, School of Medicine, University of California, Dauis, California 95616

The cellular levels of the three translational initiation factors, IF1, IF2, and IF3, increase as a function of growth rate in parallel with those of ribosomes. Therefore both ribosomal and initiation factor gene expression is under metabolic control. To address how expression of the Escherichia coli gene for IF1, infA, is regulated, a 3-kilobase region of the genome surrounding infA was sequenced. The 5’ and 3’ termini of in vivo infA transcripts were defined by S1 nuclease mapping, and mRNA size was measured by Northern blot hybridization. The infA gene istranscribed by two promoters, P1 and Pz,which generate transcripts of 525 and 330 nucleotides, apparently ending at the same p-independent terminator. Analyses of operon and protein fusions to lacZ demonstrate that neither infA transcription nor translation is affected by high cellular levels of IF1. However, Pz, but not P1, increases in activity as a function of the growth rate of the cell and is the dominant promoter in rich medium. Therefore, metabolic control of infA expression occurs exclusively at the level of transcription by the Pzpromoter.

bolic control of ribosome or initiation factor synthesis have not yet been elucidated. An approach to studying the coordinate control of initiation factor gene expression is toclone and characterize the operons containing these genes. infB,the gene for IF2, is present at 68 min in a complex operon that begins with a tRNA gene, metY, and encodes thetranscriptionalterminationfactor NusA as well as three other proteins of unknown function (46). Regulation of the infB operon is complex and poorly understood but does not appear to involve autogenous feedback controls with IF2 (7). infC,the gene for IF3, is found at 38 min and also is in a multicistronic operon that includes thrS, rpml, and rplT (8). IF3 inhibits the translation of its own mRNA by an autogenous feedback mechanism (9), but how its promoters are controlled remains unclear. The gene and mapped to forIF1, infA, has beencloned,sequenced, about 20 min (IO),but its operon structure and expression have not yet beenelucidated. This report addresses these issues and describes a metaboliccontrol mechanism operating on one of its promoters. MATERIALSANDMETHODS

Bacteriological Methods, Growth Conditions, and Enzymatic Assays-The Escherichia coli strains, X-bacteriophages, M13 bacteriophage, andplasmids used inthis work are described inTable I. The protein components of the translational machinery comprise nearlyhalf the proteinsof rapidly growing bacterial Physiological experiments generally were conducted as described by (11) by using the minimal MOPS medium of Neidhardt et al. cells, and their synthesis is precisely regulated. The rate of Miller (12) containing0.4% glucose, glycerol, or acetate as the carbon source synthesis of ribosomes increases with growth rate (metabolic supplemented either with the auxotrophic amino acids required by control) and is proportional to the rate of synthesis of its the bacterial strain (40 pg/ml) or with a total amino acid mix (each rRNA (1).Ribosomal protein synthesis is tightly coupled to 40 pg/ml). LB medium was used to obtain maximal growth rates. The rRNA synthesis inlarge part by autogenous regulationat the media were supplemented with the relevant antibiotics: 25 Fg/rnl Forinduction of theptar level of translation (1). The synthesisof other translational chloramphenicol, 100pg/mlampicillin. promoter, a concentration of 1 mM isopropyl l-thio-8-D-galactopycomponents such as aminoacyl-tRNA synthetases and the ranoside was used.@-Galactosidase activity was assayed in cells soluble factors also is regulated precisely, some by metabolic permeabilized by treatment withchloroform and sodium dodecyl controls (2). Thecellular levels of the three initiation factors sulfate and expressed in Miller units (11). IFl,’ IF2, and IF3 are proportional growth to rate (3),implying Construction of lac2 Fusions-The two infA promoters were fused that the genes encoding these proteins also are under meta- either independently or together to the lac2 structural gene to generate operon fusions. The DNA containing the infA promoter (P,) bolic control. The molecular mechanisms underlying metaand 18 bp of 5”untranslated leader (residues 1062-1182 in Fig. 1) was amplified by the polymerase chain reaction. The upstream primer * The work was supported in partby Grants NP70,GM40082, and (5’-GGCCGAATTCGCCTCGGACGATTGCCG-3’) containedthe INT-8612363 from the American Cancer Society, National Institute region 1062-1079 preceded by an EcoRI cleavage site; thedownstream of Health, and the NationalScience Foundation. The costsof publi- primer (5’-CCCGGGATCCGTAACCAACTCTGCCACCG-3’) was cation of this article were defrayed in part by the payment of page complementary to the region 1163-1 182 and containeda RamHI site. charges. This article must therefore be hereby marked “aduertiseThe reaction mixture in 50 pl contained 1 ng of denatured DNA from ment” in accordance with 18 U.S.C. Section 1734 solely to indicate pTH2 (lo), 1 p~ each oligonucleotide primer, 200 p~ each dNTP, this fact. and 2.5 units of AmpliTaq DNApolymerase (U. S. Biochemical $ Supported by National Institutes of Health Individual National Corp.). A reaction cycle was 1 min a t 94 “C, 1 min a t 55 “C, and 1.5 Research Service Award Fellowship GM 10914. min at 72 “C. After 30 cycles the amplified DNA was cut with EcoRI f Supported by National Institutes of Health Training Grant in and BamHI andcloned into thepolylinker of the single-copy plasmid Genetics GM07467. pJEL126 (13),which contains the lac2 structuralgene, yielding pOF’ Theabbreviations used are:IF,initiationfactor;ORF, open P1. The Pz promoter fusion comprised the region 1275-1404, amplireading frame; kb, kilobase(s); bp, base pair(s); MOPS, 4-mOrphO- fied by polymerase chain reaction with primers 5”CCCGGGAATTlinepropanesulfonic acid. CAAGCTTAGCCGTGTGTTTTCGG-3’ (corresponding to 1275-

16491

infA Operon Encoding IF1

16492

TABLE I Name genotype

E. coli IBPC5321 RY566

JMlOl CSR603 BL322 BL321 Bacteriophage X ASKS107 XRS45 XPF-35 XOF-P1 M13 bacteriophage M13mp19-3:2 Plasmids pBR322 pRS415 pMBL1034 pJEL122 pJEL126 pPF10-10 pPF-35 POF-P1 pOF-P2 POF-PlP2 pACYC184 pcc-1 pcc-2 pTB7 pTH2 pEBS4 DEBAS

E. coli, bacteriophage X, M13 bacteriophage, and plasmids Relevant

RefJorigin

F-, thi-1, argG6, argE3, his-4, mt2-I, xyl-5, tsx29?, rpsL, Alacx74 F- lacp ZAM15 Y+, pro+/A(lac-pro), thi, nalA, supE, bf%, hR(XcZ857, rrnB P1-lacZ fusion) thi, A(lac-proAB), [F-traD36, proAB, lacZqZAM15] F-, recAI, uvrA6, phr-1, leuB6, proA2, argE3 thi-1, ara-14, lacY1, galK2, xyl-5, mtl1, rpsW1, tsx-33, X-, supE44 thi-I, argH, sup44 thi-I, argH, sup44, rnc105 imm21, ninR, lacZ imm21, nin.5, id+, b1a'-lacZ,, XSKSlO7, infA-lacZ protein XRS45, infA-lacZ operon fusion

7 21 22 18

23 23 M. Springer 13 This work This work

M13mp19 derivative containing infA genomic sequence (bp 970-1513) generated from a Bal-31 digestion

This work

Tet', Amp' AmpR,Tl,, lacZ, lacy, lacA AmpR,lacZ, lacy AmpR,R1 ori, XPRpromoter, cZ857, copA,B, 'lac2,lacy,' lacA AmpR,Rlori, XPRpromoter, cZ857, copA, B, 'trpA, 'lacZ, lacy, lacA pMLB1034, infA-lacZ protein fusion pJEL122, infA-lacZ protein fusion pJEL126, infA-lacZ operon fusion pJEL126, infA-lacZ operon fusion pJEL126, infA-lacZ operon fusion Tet', CamR p'""-infA, Amp' pACYC184, pt""-infA,Cam' pBR322, Amp', 2.9-kb BglII fragment containing infA pBR322, AmpR,2.1-kb HindIII fragment containing infA pACYC184, TetR,6-kb EcoRI fragment containing infA uEBS4 lackine a 1.5-kb Bel11 frament

24 13 25 15 15 This work This work This work This work This work 28 Footnote 3 This work 10 10 10 10

1294) and 5'-CCCGGGATCCTCTGGGGTATCACTACC-3' (13851404), followedby cleavage with EcoRI and BamHI and inserting into pJEL126 to yield pOF-P2. The PJPZ promoter fusion (pOFPlP2) encompassed the region 962-1404 and was constructed similarly by using the same downstream primer as for Pz and the upstream primer 5'-GGCCGAATTCGGTAAGCTTATCGACTGCCC-3' (962988). For some fusions the constructs also were cloned intothe polylinker of pRS415 (14) which contains the lac2 structural gene. For example, an infA-lac2 fusion in pRS415 was moved into XRS45 (14) by in vivo recombination to yield XOF-P1 (see Fig. 6). Three independent isolates of X-phage were generated from three independent isolates of each operon fusion in pRS415, and each group produced virtually identical levels of @-galactosidaseactivity. Stable monolysogens of the XOF phages were made in the Alac E. coli strain IBPC5321 (7). The DNAs from each of the recombinant XOF phages and from the polymerase chain reaction amplifications cloned into pJEL126 were partially sequenced to verify the correctness of the fusion junction and thePCR-amplified regions. The infA-lac2 protein fusion was constructed as follows. A recombinant M13mp19 phage generated by Bal-31 deletion during the sequencing of the infA gene (10) contains E. coli genomic DNA from 970 to 1513 (Fig. I), which includes the PI and Pz promoters, the 5'untranslated leader, and the structural gene through the 35th codon. The region was excisedfrom the M13 phage by digestion with HindIII and EcoRI, and the fragment was inserted together with a 730-bp PstI-Hind111fragment frompBR322 intopMLB1034 (15), previously digested with PstI and EcoRI, to give pPF10-10. The EcoRI-BamHI fragment from pPF10-10 was sequenced to confirm that theinfA and lacZcoding regions were fused in-frame. The EcoRI fragment of pPF10-10 containing the infA region was ligated into the single-copy plasmid pJEL122 (13) to give pPF-35 (Fig. 6). pPF-35 was digested with HindIII and Sad, the gel-purified fragment was inserted into the HindIII-Sac1 sites of XSKS107, and the resulting phage, XPF-35 (see Fig. 6), was formed by in vitro packaging. Infection of strain IBPC5321 generated stable monolysogens of XPF-35.

RESULTS

Sequence Context of infA in the Genome-In previous work we isolated the infA gene on two overlapping recombinant plasmids, pTH2 and pTB7, whose inserts together represent 3 kb of E. coli genomic DNA (10) (see Fig. 2). A sequence of 328 bp encoding IF1 was determined and mapped to about 20 min on the E. coli genomic map by conjugation and P1 transduction (10). From restriction enzyme maps of the 3-kb region we have located the IF1 gene at precisely 940 kb on the physical map (16) and defined its direction of transcriptionas counterclockwise. No other characterized geneis linked very closely to infA except for ser W, a minor serine tRNA gene located immediately downstream from infA2(10). Furthermore, no sequence information is available for this region of the genome. To define better thecontext of infA we sequenced the DNA contained in thetwo overlapping inserts of pTH2 andpTB7. The 3.0-kb sequence was determined for both strands asdescribed in thelegend to Fig. 1.The sequence extends about 1.4 kb both upstream and downstream from infA and includes serW (see Fig. 2). Analysis of the sequence leads to the identification of a number of open reading frames (ORFs) in addition to infA (see Fig. 2). These ORFs are labeled either "P" followed by the mass of the protein product whose existence is suggested by maxicell analysis (see below) or "ORF" followed by the mass of the putative protein product for which evidence is lacking. The following ORFs, oriented like infA from left to right, are detected. P-20 (residues 1-170) is a short (partial) ORF that terminates at position 170 and presumably origiH. S. Cummings, J. F. Sands, J . Fraser, and J. W. B. Hershey, manuscript in preparation.

infA Operon Encoding IF1

M

16493

A

A

r

Q

R

G

I

F

P

H

P

S

P

G

D

P

I

L

*

*

S

P

D

P

R

A

V

L

M

P

E

CTTACCAGCGTGGTATTTTTCCGT~~~TTTTCTCC~~~~TCCTC~~TCGCCCGATCCCCGCGC~~~TGCTATG~CAGMT 510 600 630 "22 I T L L V R S L K

S

L

B

l

S

R

S

*

K

R

I

H

K

R

S

P

I

R

V

T

U

N

Y

A

F

G

Q

V

l

~

UCTGCIITATCIGCCGTIFTAT~~TTTCAT~GC~~CCC=ATCG~~C~TGMTTACGCTTTTGGTCA~~~TCATTGMG 660 720

690

L

V

T

L

I

=

P

L

1170

1140

1110 E

P

I

R

N

=

S

R

9

V

T

P

l

V

~

L

~

A

P

L

Y

GILG=TGGTTIICGC=CATT~CCC=GC=GCC~=-M====~GCGTCA~~~TMCGCCU~CGTTTATCTCAC~NCCI~ATACGT~ 1200 1230 1260

FIG.1-continued.

the UAA termination codon of ORF-22. ORF-7 overlaps infA but lies in adifferentreadingframe. ItsputativeShineDalgarno region is moderately strong (GGAG) but is separated from the AUGby only 2 residues. Finally, ORF-100 (3060-2315) would be expressed in the opposite orientation, originating downstream from the reported sequence and terminating atposition 2315. We employed the maxicell assay of Sancar (17, 18) to ~ r ~ l E D L L L Y l n P H K l V I D = ~ L G G 9 D F G Vdetermine Y whether or not any of these ORFs express protein G C G C T T T C T C G A T T T C G T C C A G C * G C A G C A C C G U T G T G C G T 2910 2940 2970 products. pEBS4 carrying a 6-kb EcoRI fragment (see Fig. 2) OW-100 G P P l G l l R S Y T R R E l Y E S M O F R L L E l G L I X strongly expresses IF1 and weakly synthesizes 20- and 27A T C C C G G A G C C G C A C C M T M G ~ C G G C T G ~ ~ C G G T I T G G C T T 3000 3030 3060 kDa proteins (19). Since a 1.5-kb BglII deletion of pEBS4 FIG. 1. Sequence of infA and surroundingregion. The DNA does not express the 20-kDa protein (19) and since pTB7 sequences of the overlapping inserts of pTH2 and pTB7 (Table I and expresses the 27-kDa protein (lo),we conclude that theORFs Fig. 2) were determined for both strands by the dideoxynucleotide labeled P-20 and P-27 are situated asindicated in Fig. 2 and chain termination method (25) with a Sequenase kit (U. S. Biochemical Corp.). Either nested sets of Bal-31 exonuclease deletions or are expressed weakly in E. coli.No evidence for the expression smaller restriction fragments were sequenced in recombinant M13 of ORF-22 and ORF-7 hasbeen generated. p P S l l carries a 7phages. The DNA strand corresponding to the infA mRNA is shown kb PstI fragment (Fig. 2) that expresses a 100- and 9-kDa beginning at its 5' end, along with derived amino acid sequences proteinin maxicells (19).Deletionanalysis indicatesthat shown above for the various ORFs, with the amino acid abbreviation ORF-100 found at the 3' end of the sequence in Fig. 1encodes centered over its codon. Initiation and termination codons are boned and labeled; putative promoter -10 and -35 regions are shown by the 100-kDa protein (19). The functions of the 20-, 27-, and 100-kDa proteinsarenot known, and elucidation of the ouerlines; putative transcriptional terminators are shown by divergent arrows and a t. The coding region of ser W is boxed also. expression of their genes or those of the other ORFs has not been pursued further. IF1 Is Synthesized on Two Monocistronic mRNAs-The natesupstream of the region sequenced. P-27 (420-1121) encodes a putative protein of27 kDa (P-27) if translation DNAsequence surrounding infA was analyzed to identify begins at the first in-frame AUG (420-422). The AUG is transcriptional signalsresponsible for expressing theIF1 preceded by a moderately strong Shine-Dalgarno sequence, gene. Since a tRNA gene (serW) exists immediately downGGAG (406-409), which is separated from the AUG by 10 stream of infA, its processing to mature tRNA guarantees residues. ORF-22 extends from nucleotides 694 to 1296 and that infA mRNA expressesno otherdownstream cistron. This overlaps the P-27 coding region but in a different reading conclusion is reinforced by the presence of the P-100 gene but in the opposite orientation frame. If expressed from the first in-frameAUG (802-804) or which is expressed downstream from GUG (724-726), a protein of mass 19 or 22 kDa would (see Fig. 2). However, the P-20 and P-27 genes lie upstream direction. Thus all result. Neither initiatorregion appears favorable forribosome to infA and all are transcribed in the same binding. Directly following ORF-22 is a smaller one, ORF-7 three genes could be expressed in the sameoperon. (1299-1478), whose putative AUG initiator codon overlaps To identify possible transcriptional signals the genomic

-

v

infA Operon Encoding IF1

16494 FIG. 2. Identification of plasmids and restriction mapping. The figure shows arestriction mapof a 13-kb region of the E. coli genome surrounding infA. The cross-hatched portion on the right corresponds to Charon30 X-DNA. Plasmidinserts used for maxicell and sequence analysesare shownabove the restriction map. Restriction enzyme sites are labeled: E , EcoRI; Bg, BglII; H , HindIII; P, PstI; B1, BalI; B, RgII; M , MnlI; A , AccI; K , KpnI; X , XhoI.

pT87 I

2kb

1 6' B#II

1 6' B#II

-z -

Robe I Probe I1

966

1092

n

l

L 3 l 0 280

-Jmc+

480

me-

1413

3' Bo11 Ipc'mc+ 980 1927

1927

-

AccI

Probe I V

Ace1

Probev

1440

9' EpnI

mc'm+ BM) 967 S ' ~ i n ~ I I1

Probe 111

6' EpnI

d

BslI

DNA sequence inFig. 1 was subjected tothe computerassisted analysis of Mulligan et al. (20) which locates potential promoter sites and predicts RNA polymerase selectivity or promoter strength. The program evaluates the -10 and -35 regions as well as additional bases nearby and generates a homology score that represents the percent identity of the putative promoter with a consensus sequence. Two putative infA promoters were identified in the sequence. The first (called PI) is about 250 bp upstream of the initiator AUG with a-10 region (TATAAT) at position 1155-1160 separated by 18 bp from a -35region (TCGGCA) at position 11311136. The sequence TATAAT is identical to the consensus sequence for the -10 region (Pribnow Box) for E. coli promoters. The -35 region is in good agreement with the consensus sequence (TTGACA), differing only in the second and fourth nucleotides. The putative infA promoter has a homology score of 54.9% whereas those for infB and infC have homology scores of59.6 and 60.7%, respectively. A strong promoter, e.g. the trp-lacpromoter, has a score of 74.0%; poor homology scores ((45%) are generally found for promoters that are known to require activators for maximal expression. The second putative promoter is located in a region with a number ofweak promoter sequences. The most optimal is located 39 bp upstream of the AUG and is called Pp.The -10 region (TATCTT) at position 1364-1369 is separated by 16 bp from a -35region (CTTATT)at position 1342-1347. Homology with the consensus sequence is less than that for PI since the -10 differs at positions 2 and 5, and the -35 region differs at positions 4-6. The homology score for P2is 47%, suggesting that PIwould bethe major promoter for infA expression. Except for the two promoter sequences in front

1

3hb

6 6 l 480 3 - c -

Q

Skb

PI00

1644

971

I

pTH2

P20

34

Bindl11I

I

I

I

1kb

XhoI

PPS11

t pEBS4

FIG. 3. S1 nuclease mapping. The 3-kb region whose sequence is reported in Fig. 1 is shown inexpanded form. Open reading frames are shown by rectangular boxes andare labeled as described under "Results." Transcriptional signals are shown above the line as follows: P, promoters; t, terminators; R,,,, ribonuclease I11 processing site. S1 nuclease mapping probes are depicted below as open rectanglesand aredefined by theirrestriction enzyme cutsitesand nucleotide numbers. The solid bars below each probe indicatethe probe lengths protected from S1 nuclease digestion of total RNA from E. coli strains containing (rnc+) or lacking (rnc-) RNase 111 (from Fig. 4).

ProbeVI

of s e r W (to be described elsewhere),' no other promoterswere identified by the program. The DNA sequence analysis also predicts a transcriptional terminator between infA and ser W as well as terminatorsbetween s e r W and theP-100 gene. To define better the promoter responsible for infA transcription the 5' termini of in vivo transcripts were identified by S1 nuclease mapping. A long probe (probe I: from XhoI (34) to BglI (1644) which covers both infA and theP-27 gene) and a shorter probe (probe 11: HindIII (971) to BglI (1644)) (see Fig. 3) were labeled at the5' ends and hybridized to total RNA from both rnc+ and rnc- strains of E. coli. Both probes gave comparable results; only those from the shorter probe I1 are shown (Fig. 0 ) With . rnc+,several strong bands are seen (lanes 2-4). Of the two largest bands, the first (480 bases) maps to the promoter region PI identified by the computer program; the second (460 bases) maps just 20 bp downstream. The rnc- strain generates the larger (480 bases) but not the shorter (460 bases) form (lanes 5-7), suggesting that the shorter form is caused by RNA cleaved by RNase 111. In addition, another major band and a variety of minor bands were detected in both the rnc+ and rnc- strains. The rnc+ strain generates a strongly protected fragment of about 265 bases and minor protection of fragments of 295 and 350 bases. Some lesser bands which begin after thecoding region of infA also are seen. The rnc- strain only protects the 265- and 295base fragments, the latter only very weakly. In both strains, the 265-base fragment appearsas a doublet and maps at about position 1377, which corresponds to Pz identified by the computer. This region is unusually A/T rich (69% between nucleotides 1333 and 1383), and some of the 5' termini may be generated artifactually by S1 nuclease cleavage in melted A/T-rich regions.

infA Operon Encoding IF1 1

B

A me

16495

mc+

me

2

.

3

-

4

2904

me

1 2 5 4 - 8

1 2 9 4 6 6 7 8

616869,

-1

1542

525

330

FIG.4. S1 nuclease mapping of the 5' and 3' termini of transcripts from the infA gene. S1 nuclease mapping was performed by the method of Burton et al. (26) as described by Regnier and Portier (27). Panel A: probe 11, the 5"labeled 673-bp doublestranded DNA HindIII-BglI fragment shown inFig. 3, was hybridized to E. coli RNA prepared from rnc+ (lanes 2-4) or rnc- strains (lanes 5-7) or to tRNA(lane 8). Variable amounts of RNA were used 12.5 pg (lanes 2 and 5),25 pg (lanes 3 and 6 ) , and 50 pg (lanes 4 and 7). Control reactions contained 50 pg of tRNA (lane 8). Hybridization conditions were 52 "C for 12 h, and S1 nuclease digestion was performed a t 37 "C for 30 min. Protected DNA fragmentswere analyzed on 6% denaturing polyacrylamide gels together with the probe (lane I). Panel B: probe 111, the 5"labeled 352-bp double-stranded DNA KpnI-KpnI fragment shown in Fig. 3, was employed as in panel A. Protected DNA fragments from rm+ (lanes 2-4) or rm- (lanes 5-7) mRNA or with 50 pg of tRNA (lane 8 ) were analyzed as above. Varying amounts of RNA were hybridized with the probe: 12.5 pg (lanes 2 and 5),25 pg (lanes 3 and 6), and 50 pg (lanes 4 and 7). The probe alone is in lane I. Panel C: S1 nuclease mapping of the 3' termini of transcripts from the injA gene. Probe IV, the 3'-labeled 515-bp double-stranded Ban-AccI fragment shown inFig. 3 was used. Lanes 1-3 show the protected fragment when the probehybridized is to 12.5, 25, or 50 pg of mc+ mRNA; lanes 4-6 show the protected DNA with 12.5, 25, or 50 pg of mc- mRNA, respectively. In lane 7 the probewas hybridizedwith 50 pg of tRNA. The lengths of protected DNA fragments (number of residues) are given to the left of the autoradiographs.

FIG. 5. Northern blot analysis of infA mRNA. E. coli mRNA was prepared from r c + and m c - strains, separated by formaldehydeagarose gel electrophoresis, and transferred to a nitrocellulose filter (21) for autoradiography. TheMnlI-BglI fragment covering the structural gene for injA was used for the DNA probe (seeFig. 2). Lanes I and 2 contained 10 pg of rm+ RNA, and lanes 3 and 4 contained 10 pg of m c - RNA. The samples were either heated for 5 min at 55 "C (lanes I and 3 ) or for 1 min a t 95 "C (lanes 2 and 4). Positions of migration of 16 S (1542) and 23 S (2904) RNA and injA mRNA (525 and 330) are indicated to theleft of the figure.

extends upstream into P-20. Two low intensitybands of protected DNA were detected (results not shown) corresponding to the full-length probe and a fragment whose end maps to about residue 290 in Fig. 1 and is located about 130 bp upstream of the ORF-27 initiator AUG. Thus P-20 and P-27 appear to be linked transcriptionally, but theweak expression of this operon was not elucidated further. To map the 3' end of the infA transcript two probes, probe IV (Ban (1413) to AccI (1927)) beginning downstream of the infA promoters and extending into serW , and probe V (KpnI (1440) to AccI (1927))beginning within the structuralgene of IF1) were employed for S1 nuclease mapping (see Fig. 3). Each 3'-labeled probe generated a single band with either rnc+ or rnc- RNA (Fig. 4C), which maps at position 1692. This corresponds to the beginning of the string of Us in the Similar analyses (Fig. 4B) were performed with a very short mRNA just downstream of the putative terminator hairpin probe (probe 111: a 352-bp KpnI fragment from 1092 to 1443) structure. Since >95% of all infA transcripts endhere, either that begins within infA and extends upstream into P27. With transcriptional termination at this site is very efficient or any rnc+ RNA only two protected fragmentswere seen which map to the PI and the RNase I11 cleavage site. With the rnc- readthrough transcriptsare rapidly degraded back to the strain, only the larger form was detected. With this probe, a hairpin. When a probe originating in the coding region of Pprotected fragment that would correspond to the 265-base 27 was used (probe VI), little or no DNA protection was protected DNA (P2)seen with probe I1 would be only about observed (results not shown). This indicates that there is very 65 bases in length. It is believed that such a short fragment little transcription of P-27, consistent with S1 mapping rewould not be visualized in the gel system. However, close sults cited above. The combined S1 mapping results indicate inspection of the original autoradiograph shown in Fig. 4A that infA is transcribed from two promoters to generate an suggests the presence of several faint and diffuse bands cor- approximately 530-base transcript which is partially procresponding to about 65 bases. A summary of the S1 mapping essed by RNase I11 and a shorter, about320-base, transcript. Northern Blot Hybridization Analysis-Northern blot hyresults for the threeprobes is shown in Fig. 3. bridization analysis of total E. coli RNA was performed to Very little if any of the probes used above were protected over their full lengths (Fig. 4, A and B). This suggests that confirm the S1 nuclease mapping ofinfA transcripts (21). transcription from P-27 does not continue into infA to a Analyses of both rnc+ and rnc- strains showed a band at about significant extent. Thus theexpression of infA is not coupled 0.53 kb (Fig. 5) and aneven more intense band at 0.33 kb. It to ORF-20 and ORF-27 but rather involves a monocistronic seems likely that both RNAs correspond to those detected by mRNA. Further S1 nuclease mapping analyses were per- S1 mapping where the 5' termini map to positions 1165 and formed with another probe (a 933-bp XhoI (33) to Hind111 1377. However, it was possible that the smaller RNA could (968) fragment) whose 5"labeled end lies within P-27 and correspond to a transcript for ORF-7. To rule out thispossi-

infA Operon Encoding IF1

16496

PI

infA

t

I

5’

FIG. 6. Structures of the infAlacZ operon andprotein fusions. The construction of operon and protein fusions is described under “Materials and Methods”andunder“Results.” DNA corresponding to E. coli sequence is shownin black and is drawn to scale. The locations of the i n f A promoters ( P I , P 2 )and terminator( t )are indicated. The t h i n black box representsthe infA 5’untranslated region. The length and location of the5’-untranslated region fused to a truncated trpA gene (thin open box) in pJEL126 are shown. The DNA corresponding to lac2 sequences is shown as a large open box.

PI

OF-PI PI

bcZ

I

luz

I

*cZ

I

P2

OF-PIP2 P2

OF-P2

PI

P2

infA

P

PF-35

TABLEI1 Expression of infA-laczprotein fusions in various backgrounds The monolysogen of IBPC5321 with XPF-35 and IBPC5321 carrying the single-copy plasmid pPF-35 were transformed with the plasmids listed. The plasmid pCC-2 contains infA under the control of the Tac promotercloned into pACYC184. Cultures were grown in LB medium at 37 “C for lysogenic strains andat 30 “C for the strains carrying the single-copy plasmid. Medium was supplemented with the relevant antibiotics: chloramphenicol (25 pg/ml), ampicillin (100 pg/ml), and with 1 mM isopropyl 1-thio-@-D-galactopyranosidefor strains carryingpCC-2. @-Galactosidaseactivities were measured for each culturegrowing in exponential phase. The values are theaverage of at least five independently grown cultures. The @-galactosidase units are expressed per As00 unit of bacteria as described by Miller (11).Average doubling times were 24 min for the monolysogen series and 30-39 min for the strains carrying thesingle-copy plasmid. @-Galactosidase activity

bcZ

A I

C

0.0 0.0

0.5

I .o

I .5

B

Background

No plasmid pACYC184 pcc-2

In lysogen

In single-copy plasmid

3,250 3,180 3,380

6,550 6,790 6,575

bility a Northern blot was probed with a n FokI restriction fragment (1546-2140) thatiscomplementary only tothe downstream quarter of the 525-base infA mRNA. Detection of both the0.53- and 0.33-kb bands (data not shown) strongly indicates that the 0.33-kb band is an infA transcript that is shorter at the5’ end, not the3‘ end. The intensityof the 0.33 0.0 I .o 2.0 band suggests that this RNA is either more efficiently tran” 0 scribed or that this message is more stable relative to the FIG. 7. Growth rate dependence of infA expression. Cultures 0.53-kb transcript (see “Discussion”). Expression of infA-lac2 Fusions-We constructed four infA- were grown at 30 “C in minimal MOPS medium supplemented with carbonsources as described under “Materials and Methods.” lac2 fusions to study theregulation of infA expression in vivo different The value p is the numberof doublings/h. For each, the activity at p (Fig. 6). Three are operon fusions designed to measure the = 1.0 is given the same arbitrary value, and the activities a t other efficiency of transcription from the two infA promoters. All growth rates are normalized accordingly to facilitate comparison of operon fusions are tolac2 carrying its entire ribosome binding the slopes whichwere determined by linear regression. Panel A: closed site. The OF-P1 construct contains PI thepromoter DNA and squares, PF-35; open circles, OF-P1; closed triangles, rRNA PI prothe first18 bp of the 5“untranslatedleader region of the infA moter control. Panel B: opencircles, PF-35; open squares, OF-P2; operon (position 1062-1182). The OF-P2 construct contains closed diamonds, OF-PlPZ. the Pz promoter DNA (position 1275-1404). The OF-P1P2 fusion contains the entire 5‘-untranslatedregion DNA with leader plus 35 codons of the structural gene of IF1, fused inframe to the ninth codon of the lac2 structural gene. The both promoters (position 962-1404). The DNAs containing the infA promoter(s) were obtained by amplification of the fusions were constructed in single-copy plasmids, sequenced appropriate regions of infA DNA by the polymerase chain to confirm their structures, andselectively incorporated into reaction as described under “Materials and Methods.” The X-phages as described under “Materials andMethods.” Transfourth construct isa protein fusion, PF-35, designed to meas- formed IBPC5321 cells carrying the single-copy plasmids or ure the efficiency of transcription and translation of infA.It monolysogenic strains carrying recombinant X-phages were contains both infA promoters and the entire 5”untranslated evaluated.

infA Operon Encoding IF1 TABLEI11

16497

clease mapping experiments fail to detect appreciable quantities of transcripts originating upstream of the infA promoter or of those extending beyond the infA terminator. Thus the transcription of infA is not linked physically to any other gene. This stands in striking contrast infB to and infC as well Promoters @-Galactosidaseactivity as to many genes encoding other translational components, which are expressed from highly complex polycistronic operons. The infA monocistronic operon is not unique among genes encoding the protein synthesismachinery, however, as + 435 920 OF-P1 + + ND 2,580 a few other genes (e.g. rpsA OF-PIP, for S I ) are monocistronic also. + ND 1,760 OF-P2 Thegeneration of mature infA mRNAtranscripts was confirmed by Northern blot analyseswhich indicate two size The protein fusion PF-35 was first employed to determine classes for the mRNA, containing about525 and 330 nucleowhether or not infA is autogenously regulated by the level of tides. The two classes were detected in cell extracts prepared IF1 in cells. The protein fusion carried on pPF-35 in strain in a number of different ways after heat treatment of the IBPC5321 expresses 6550 units of @-galactosidase activity RNA preparation and under electrophoresis conditions that (Table 11). When this strain was transformed with pCC-2, a minimize secondarystructure effects. Furthermore,both with RNA extractedfrom plasmid that overexpresses IF1 lO-2O-f0ld,~ no effect on p- forms increased in intensity in blots a strain carrying pTH2, which overexpresses IF1. The smaller galactosidase synthesis was observed. A similar result was 2-fold more abundantthanthe larger obtained with cells containing the protein fusion carried in transcriptisabout transcript, an observation consistent with the lac2 operon the monolysogenic strain carrying XPF-35 (Table 11). Overfusion experimentsin which Ps is twice as active as P1. production of IF1 in the pCC-2-transformed cells was con330-baseRNA is not a firmed by sodium dodecyl sulfate-polyacrylamide gel electro- Selective probes indicate that the phoresisanalysis(resultsnotshown).Thefailure of high transcript for ORF-7. We conclude that the two forms are cellular levels of IF1 to suppress theexpression of p-galacto- derived from theinfA gene and that both are present in intact sidase indicates that IF1 does not regulate the expression of cells. The Northern blot analyses do not resolve the larger transcript into the two sizeforms suggested by the S1 nuclease infA at either the transcriptional or translational level. analyses. Apparent cleavage of the Pl transcript by RNase I11 Theconcentration of IF1increases as the growth rate of the 5’ terminus of the Pl transcript increases (3), suggesting that infA expression may be under results in the shortening metabolic control. The operon fusions (carried on pOF-PI, by 20 nucleotides. Whether or not RNase I11 cleavage alters pOF-P2, and pOF-P1P2) and the protein fusion pPF-35) were the stabilityor translational efficiency of the transcriptis not used to determine whetheror not transcription and/or trans- known. Both the PI and P, promoters of infA possess G/C-rich lation of infA are regulated by growth rate. In addition, the lysogenic strains carryingXOF-P1 and XPF-35 were analyzed. regionsdirectly downstream from their respective -10 reAll strains were grown in minimal media supplemented with gions. Such G/C-rich sequences are typical of the promoters various carbon sources to achieve a &fold range in doubling for ribosomal RNA and ribosomal proteins and have been times, as described under “Materials and Methods.” The p- called the stringent discriminatorregion (23). However, the galactosidase activities of a control lysogen carrying a ribo- PI and P2 sequences match only marginally the consensus somal RNA promoter fused to lac2show a strong increase in sequence derived from ribosomal promoters (24): three and been expression characteristic of metabolic control of rRNA pro- two out of six matches, respectively. It has not yet moters (Fig. 7A and Table 111) (22). p-Galactosidase activity determined if infA expression is subject to stringentcontrol. The three E. coli initiation factors are present in approxiwith the PF-35 construct also increases with growth rate, but the slope of the lineis only 0.7 relative to the rDNA promoter. mately equimolar amounts in cells, a t a level of one factor each per six to seven ribosomes (3). How are the threelevels Analyses with the operon fusions demonstrate that OF-P1 changes very little with growth rate whereas OF-P2 and OF- coordinated? One possibility is that initiation factors, when P1P2 increase with a slope comparable to the rDNA promoterin excess over free ribosomal subunits, bind to their mRNAs (Fig. 7B).The results demonstrate that transcription of infA and inhibit their own translation (autogenous control). The from Pl isnotunder metabolic controlbutthat infA is infA-lac2protein fusion was used to determine if high levels of IF1 might repress infA expression, but no effect of IF1 metabolically regulated at the P2promoter. overproduction on @-galactosidase activity was detected. Therefore neither the transcription nor translation of infA DISCUSSION mRNA is affected by high levels of IF1. The effects of overThe identification of promoters and transcripts for a gene production of IF2 and IF3 on their respective gene expressions is an important early step in characterizing its expression. had been studied previously. Overproduction of IF2 does not We have generated evidence indicating that infA is tranaffect the metY promoter, nor does it alter @-galactosidase scribed asa monocistronic operon from two promoters. Idena computer- activity generatedfrom the infB-lac2 protein fusion (although tification of the infA promotersisbasedon assisted analysis of genomic sequences, on S1 nuclease map- NusA causes a small negative effect) (7).However, overproping of the 5‘ termini of in vivo transcripts, and on in vivo duction of IF3 represses infC expression at the level of protein expression of lac2 fusions. The first two methods also were synthesis (9). Thus IF3 is the only initiation factor whose gene expression is autogenously regulated. used to identify and map a terminator immediately downThe levels of translational components such as ribosomes stream of the infA coding region. Detection of 525- and 330base transcripts by Northern blot analysis is consistent with and elongation factors increase in rapidly dividing bacterial the mapping of the promoters and terminiator. The S1 nu- cells and are directly proportional to the growth rate (12). We reported Their genes are said be to under metabolic control. ,’S. Y. Choi, H. S. Cummings, P. C. Foreman,and J. W. B. Hershey, earlier that the cellular levels of all three initiation factors manuscript in preparation. also increase as a function of growth rate (3) although the Expression of infA-lacZ operon fusions Construction of the fusions is described in Fig. 6. Growth conditions and measurement of P-galactosidase activitiesare as described in Table 11. Growth rates are comuarable to those eiven in Table 11.

infA Operon EncodingIF1

16498

increase per doubling of growth rate is slightly less (about 1.7fold) than thatfor ribosomes (about 2-fold). Plumbridge et al. (7) used an infB-lac2protein fusion to examine how the IF2 gene responds to growth rate changes and found that @galactosidase activity increased by only 15%when the growth rate was doubled. Comparable experiments with infC have not yet been reported. Here we report experiments with the infA-lac2protein fusion and find that @-galactosidaseactivity increased 1.7-fold per doubling of growth rate. Therefore the entire increase in IF1 levels can be attributed to theeffect on the synthesis rate of IF1. The metabolic control of infA expression is at the level of transcription since the operon fusion for the proximal promoter, P2,causes a similar increase in thelevel of @-galactosidaseactivity as growth rate increases. Experiments are in progress to elucidate further how growth rate affects transcription at thispromoter. Acknowledgments-We thank M. Springer, J. Plumbridge, P. Regnier, and M. Grunherg-Manago for helpful advice and R. Gourse for providing strain RY566. REFERENCES 1. Jinks-Robertson, S., and Nomura, M. (1987) in Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology (Neidhardt, F., ed) pp. 1358-1385, American Society of Microbiology, Wash., D. C. 2. Grunberg-Manago, M. (1987) in Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology (Neidhardt, F., ed) pp. 1380-1409, American Society of Microbiology, Wash., D. C. 3. Howe, J. G., and Hershey, J. W. B. (1983) J. Biol. Chem. 258, 1954-1959 4. Plumbridge, J. A,, Howe, J. G., Springer, M., Touati-Schwartz, D., Hershey, J. W. B., and Grunberg-Manago, M. (1982) Proc. Natl. Acad. Sci. U. S. A. 7 9 , 5033-5037 5. Ishii, S., Kuroki, K., and Imamoto, F. (1984) Proc. Natl. Acad. Sci. U. S. A. 81,409-413 6. Sands, J. F., Regnier, P., Cummings, H. S., Grunberg-Manago, M., and Hershey, J. W. B. (1988) Nucleic AcidsRes. 16,1080310816 7. Plumbridge, J. A., Deville, F., Sacerdot, C., Petersen,H. U., Cenatiempo, Y., Cozzone, A., Grunberg-Manago, M., and Her-

shey, J. W. B. (1985) E M B O J. 4,223-229 8. Springer, M., Graffe, M.. and Grunberg-Manago. - M. (1979) Mol. "

Gen. Genet. 169,337-343 9. Butler, J. S., Springer, M., Dondon, J., Graffe, M., and GrunbergManago, M. (1986) J. Mol. Biol. 192,767-780 10. Sands, J. F., Cummings, H. S., Sacerdot, C., Dondon, L., Grunberg-Manago, M., and Hershey, J. W. B. (1987) Nucleic Acids Res. 15,5157-5168 11. Miller, J. H. (1972) AduancedBacterialGenetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 12. Neidhardt, F. C., Bloch, P. L., Pedersen, S., and Reeh, S. (1977) J.Bacteriol. 1 2 9 , 378-382 13. Valentin-Hansen, P.,Albrechtsen, B., and Love Larsen, J. E. (1986) E M B O J. 5, 2015-2021 14. Simons, R. W., Houman, F., and Kleckner, N. (1987) Gene (Amst.) 53,85-96 15. Weivistock, G. M., Berman, M. L., and Silhavy, T. J. (1983) in Gene Amplificators and Analysis (Paps, T . S., ed) Vol. 3, pp. 27-34, Elsevier Science Publishing Co., Amsterdam 16. Kohara, Y., Akiyama, K., and Isono, K. (1987) Cell 50,495-508 17. Sancar, A., Hack, A., and Rupp. W. D. (1979) J. Bacteriol. 1 3 7 , 692-693 18. Rodriquez, R. C., andTait, R. C. (1983) Recombinant D N A Techniques: An Introduction, pp. 192-194, Benjamin/Cummings Press Inc., Menlo Park, CA 19. Sands, J. F. (1986) Structure and Expression of the Escherichia coli OperonsContainingProteinSynthesisInitiationFactor Genes, infA and infB. Ph.D. dissertation, pp. 109-142, University of California, Davis 20. Mulligan, M. E., Hawley, D. K., Entriken, R., and McClure, W. R. (1984) Nucleic Acids Res. 12, 789-800 21. Ausubel, F.M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1987) Current Protocols i n Molecular Biology, pp. 4.9.1.-4.9.7., John Wiley and Sons,New York 22. Gourse, R. L., de Boer, H. A., and Nomura, M. (1986) Cell 44, 197-205 23. Travers, A. A. A. (1984) Nucleic Acids Res. 12, 2605-2618 24. Lindahl, L., and Zengel, J. M. (1986) Annu. Rev. Genet. 20,297326 25. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Nutl. Acad. Sei. U. S. A. 74,5463-5467 26. Burton, Z. F., Gross, C. A., Watanabe, K. K., and Burgess, R. R. (1983) Cell 32,335-349 27. Regnier, P., and Portier, C. (1986) J. Mol. Biol. 1 8 7 , 23-32 28. Chang, A. C. Y., and Cohen, S. N. (1978) J. Bacteriol. 134,11411156