from several man-made environments such as hot water pipes, compost piles, and sewage treatment plants ... Solar System, are cold habitats. Over eighty .... The Problem of Maintaining Enzyme Activity at Low Temperatures. Microbes ...... 0.01% of the chromogen 5-bromo-4-chloro-3-indolyl-β-D galactopyranoside (X-Gal).
The Pennsylvania State University The Graduate School Eberly College of Science
Structure and Function Relationships in the Cold-active Beta-galactosidase, BgaS, Examining Theories of Enzyme Cold-adaptation
A Thesis in Biochemistry, Microbiology, and Molecular Biology by James A. Coker
Submitted in Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy
December 2004
The thesis of James A. Coker was reviewed and approved* by the following:
Jean E. Brenchley Professor of Microbiology and Biotechnology Thesis Adviser Chair of Committee
Allen Phillips Professor Emeritus of Biochemistry
James G. Ferry Stanley Person Professor and Director, Center for Microbial Structural Biology
Squire Booker Assistant Professor of Biochemistry and Molecular Biology
Robert F. Roberts Associate Professor of Food Science
Robert A. Schlegel Professor of Biochemistry and Molecular Biology Head of the Department of Biochemistry and Molecular Biology
*Signatures are on file in the Graduate School
ii
Abstract There have been many attempts to understand the mechanisms that determine the activity and stability of enzymes at extreme temperatures. Previous studies often compared enzymes from mesophiles and thermophiles and speculated that the observed differences were factors involved in adaptation to a certain temperature range. Most of these studies concluded that gross structural changes such as the quantity of certain amino acids or the total number of hydrogen bonds are responsible for the adaptation of optimal activity to temperature extremes. However, these studies have compared similar enzymes from distantly related organisms leaving one to wonder if the differences noted are from an adaptation to temperature or merely the result of genetic drift. In this dissertation, I present an analysis of the cold-active -galactosidase (BgaS) from the Arthrobacter sp. SB. A study of the primary sequence and modeled structure of BgaS showed that many of the proposed adaptations for optimal activity in the cold did not hold true for this enzyme. Consequently, I decided to alter the BgaS enzyme to determine the contributions of specific amino acids to activity and stability at low temperatures. I first examined the area of BgaS that aligned with the domain five mobile loop of the LacZ -galactosidase of Escherichia coli. In LacZ this area (residues 794-803) aids the binding of substrate and alterations at residue 794 increased the catalytic efficiency of the enzyme with lactose. However, when similar mutations were made in bgaS, they caused either a complete loss or a decrease of activity showing that although this area is also important for BgaS function the alterations affect the enzymes differently.
iii
To further explore the low temperature activity of BgaS, I screened for second site revertants of a null mutant resulting from a G803D change. Restoration of activity was accomplished with the addition of only two mutations (E229D and V405A). Separation of these two mutations into a wild type background yielded an enzyme with a three fold increase in catalytic efficiency with little effect on the thermostability. This shows that small and subtle changes to the enzyme can further increase the activity at low temperatures. I also explored the thermostability of BgaS through directed mutagenesis and directed evolution studies. The rational mutagenesis targeted the C-terminal portion of BgaS, an area in LacZ known to affect thermostability. From this study, I discovered that a single cysteine to glycine or cysteine to serine mutation resulted in an increase in thermal optimum for BgaS and in another closely related enzyme. The directed evolution study primarily targeted the active site in an attempt to create a more active version of BgaS. One mutant obtained from this screen, with a single alteration in amino acid sequence, created an enzyme with more activity and a 3.3 fold increase in the time it remained active at 30C, compared to BgaS. Through the combination of mutational analysis and biochemical characterization, I have shown that the introduction of a limited number of amino acid changes are sufficient to alter the activity and/or thermal properties of an enzyme whereas previous studies have suggested that multiple alterations would be required. I have also increased the thermal optimum of three closely related enzymes by altering one amino acid. Considering the large size of the -galactosidase subunit, the finding that one change in the C-terminal 25 residues has any effect on the enzyme, not to mention an up to 20C
iv
increase in temperature optimum, is quite interesting. Taken as a whole, this work illustrates that small, unpredicted changes in the amino acid sequence of even large enzymes can have dramatic effects on their thermostability and/or activity.
v
Table of Contents Pages List of Figures
ix
List of Tables
xi
Acknowledgements
xiii
Chapter 1.
1
Introduction
Microbial diversity at extreme temperatures
2
Adaptations of microorganisms to low temperature
4
The problem of maintaining activity at low temperatures
6
Enzyme activity at lower temperatures
7
Adaptations to cold-temperatures based on structure analysis
8
Limitations of current knowledge about cold-active enzymes
10
Glycosyl Hydrolases
11
Lactose Intolerance
14
Thesis organization
16
References
19
Chapter 2.
Biochemical Characterization of a -galactosidase with a Low
Temperature Optimum Obtained from an Antarctic Arthrobacter Isolate
29
Abstract
30
Introduction
31
Materials and Methods
34
Results
40
Discussion
61 vi
References
Chapter 3.
65
Directed Mutagenesis of the 803 Region of the BgaS Enzyme
72
Abstract
73
Introduction
74
Materials and Methods
76
Results
80
Discussion
87
References
89
Chapter 4.
Mutational analysis of the cold-active -galactosidase from Arthrobacter
sp. SB reveals new sites affecting low temperature activity
91
Abstract
92
Introduction
93
Materials and Methods
96
Results
101
Discussion
116
References
120
Chapter 5.
Directed mutagenesis of the C-terminal cysteine of the BgaS,
BgaS7 and B7-15 enzymes
125
Abstract
126
Introduction
128
Materials and Methods
130
Results
133
vii
Discussion
148
References
151
Chapter 6.
Characterization of a thermostable mutant of BgaS
153
Abstract
154
Introduction
155
Materials and Methods
157
Results
160
Discussion
168
References
169
Chapter 7.
Summary
171
APPENDIX A: Table of BgaS Mutants
174
APPENDIX B: DNA and Amino Acid Sequences of the β-galactosidase from Arthrobacter Isolate SB
175
viii
List of Figures 2.1 Rectangular phylogram of 16S rRNA gene sequence data from the Arthrobacter isolate SB and its closest relatives
42
2.2 Rectangular phylogram of family 2 -galactosidase gene sequences
45
2.3 Influence of temperature on BgaS, H-BgaS, LacZ, and H-LacZ enzymes
49
2.4 Thermostability of purified H-BgaS at 15, 30, and 37ºC
51
2.5 Arrhenius plot of the activity of the BgaS and LacZ
55
3.1 Partial alignment of LacZ with similar enzymes from the known Arthrobacter species focusing on the loop of domain five
80
3.2 Thermodependence of activity of BgaS and BgaS5
82
3.3 Thermostability of BgaS and BgaS5 at 15, 30, and 37ºC
83
4.1 Thermodependence of activity and thermostability of BgaS, BgaS6, and BgaS7
105
4.2 Lactose hydrolysis in commercial skim milk at 2.5C with BgaS, BgaS6, and BgaS7
109
4.3 Thermograms of the BgaS, BgaS6, and BgaS7 enzymes
111
4.4 SWISS-MODEL structures of the BgaS enzyme.
115
5.1 Partial alignment of LacZ and the related enzymes from known Arthrobacter species highlighting the C-terminal residues
134
5.2 Thermodependence of activity for BgaS, BgaS14, and BgaS15
137
5.3 Thermostability of BgaS, BgaS14, and BgaS15 at 30 and 37ºC
137
5.4 Thermodependence of activity for BgaS7, BgaS16, and BgaS17
140
5.5 Thermostability of BgaS7, BgaS16 and BgaS17
140
5.6 Relative activity of the -galactosidase from Arthrobacter psychrolactophilus and its C992S and C992G mutants.
146
6.1 Thermodependence of activity with BgaS, BgaS7, and BgaS19
161
ix
6.2 Thermostability of BgaS, BgaS7, and BgaS19 at 30 and 37ºC
x
163
List of Tables 2.1 Percent activity of purified H-BgaS with various nitrophenyl-derived chromogenic substrates
46
2.2 Metal studies with purified H-BgaS with EDTA and dialysis
53
2.3 Steady state kinetic parameters for purified BgaS, H-BgaS, LacZ, and H-LacZ at various temperatures using ONPG as the substrate
54
2.4 Steady state kinetic parameters for H-BgaS using lactose as the substrate
56
2.5 Amino acid compositions from family 2 glycosyl hydrolases
59
3.1 Summary of genetic analysis of the constructs encoding the aspartic acid variants
81
3.2 Percent activity of purified BgaS and its mutants with various nitrophenyl-derived chromogenic substrates
84
3.3 Kinetic parameters for purified BgaS, and G805D at various temperatures, using ONPG as the substrate
85
3.4 Kinetic parameters for purified BgaS and G805D at 15°C using lactose as the substrate
85
4.1 Specific activities of BgaS and its mutant enzymes with ONPG at 15ºC
102
4.2 Percent activity of purified enzymes with different nitrophenyl-derived chromogenic substrates.
106
4.3 Steady State Kinetic parameters for purified BgaS, BgaS6 and BgaS7 with ONPG.
107
4.4 Steady State Kinetic parameters for purified BgaS, BgaS6 and BgaS7 with ONPG
108
4.5 Ki values for purified BgaS, BgaS6, BgaS7, and LacZ with “deep” and “shallow” binding sugars
108
4.6 Results from differential scanning calorimetry with purified BgaS, BgaS6, and BgaS7
110
5.1 Percent activity of purified BgaS, BgaS7, BgaS14, BgaS15, BgaS16 and BgaS17 with various nitrophenyl-derived chromogenic substrates.
141
xi
5.2 Metal Studies with purified BgaS, BgaS7, BgaS14, BgaS15, BgaS16 and BgaS17 enzymes
142
5.3 Steady State Kinetics with purified BgaS, BgaS7, BgaS14, BgaS15, BgaS16 and BgaS17 with ONPG as the substrate
143
5.4 Ki values for purified BgaS, BgaS7, BgaS15, and BgaS17 enzymes
144
5.5 Titrations of accessible cysteines with DTNB
144
5.6. Hydrolysis of lactose in commercial skim milk
147
6.1 Percent activity of purified BgaS and its mutants with various nitrophenyl-derived chromogenic substrates
164
6.2 Metal Studies with purified BgaS7 and BgaS19 enzymes
164
6.3 Steady State Kinetics with purified BgaS, BgaS7, and BgaS19 with ONPG as the substrate
165
6.4 Steady State Kinetics with purified BgaS, BgaS7, and BgaS19 at 15C with lactose as the substrate
166
6.5. Titrations of accessible cysteines with DTNB
166
xii
Acknowledgements There are many people who deserve thanks and acknowledgements for all their support, aid (emotional and monetary), etc. If you are reading this and are not mentioned below then I apologize. I would first like to thank my advisor, Dr. Jean Brenchley, for all her support over the past six years. I would also like to thank her for helping to hone my scientific thinking and continually reinforcing the idea that clear thinking leads to clear writing and clear speaking. I also want to thank the members of the Brenchley lab for all their input, both scientific and personal, into all aspects my graduate career. Thanks Johnna, Kevin, Pete, Jen, Nick, Vanya, Stephanie, Turfy, Michael and Adrienne. I’ll always remember all the fun and great scientific discussions we had together. I would also like to thank the National Science Foundation-Research Training Grant for the ability to have a dual mentor graduate experience, even though it was for a short period of time (of course the money is also appreciated). Finally, I would like to thank my family for all their support over the last 6 ½ years. I would especially like to thank my wife, Rasika. Day in and day out she was there making sure all of this was completed and on time. I love you, Olga KlinkovichKuselia.
xiii
Chapter 1
Introduction
1
Microbial Diversity at Extreme Temperatures Microorganisms have been isolated from an incredible diversity of environmental samples from as far north as the Arctic to as far south as the Antarctic, up to 41 km above the Earth’s surface in the cloud layers of the stratosphere, two kilometers below the surface in the gold mines of South Africa, and greater than 500 m below the ocean floor (5, 25, 39, 64, 70). Microorganisms have also been isolated from what humans consider the most “extreme” conditions. These environments include temperatures from around -20C to over 100C, pH ranges from 0.5 to 12, pressures greater than 120 MPa, and all ranges of salinity (17, 28, 31, 35, 37). Initially the remoteness of these “extreme” environments and difficulties in cultivating these unique organisms significantly slowed extremophilic research. Recently, however, easier access to remote sites and advances in culturing techniques have assisted this field of research. Although organisms have been isolated from a wide range of “extremes”, thermophiles, organisms that grow at high temperatures, are perhaps the most studied. Thermophilic organisms have been found in many exotic natural environments such as the thermal vents or black smokers found on the ocean floor and terrestrial hot springs, which can be found on six of the seven continents (51, 63). They have also been isolated from several man-made environments such as hot water pipes, compost piles, and sewage treatment plants (9, 67). However, they are probably best known as the source of one of the most important enzymes commercialized in the last century, the thermostable DNA polymerase Taq from Thermus aquaticus (55). Thermophiles can be found in all domains of life (43, 62) with many near the base of the tree of life, leading some scientists to speculate that life evolved on this planet in a hot environment (22). 2
However, the most abundant environments on the Earth today, and perhaps the Solar System, are cold habitats. Over eighty percent of the Earth’s surface is permanently cold (below 5C) including the Arctic and Antarctic (roughly 15%), most of the volume of the world’s oceans, underground caves, cold springs, alpine regions, permafrost, and glacial ice. Psychrophiles have been isolated from all of these locations as well as transiently cold environments such as seasonally frozen lakes and winter soils. They have even been found in man-made habitats such as refrigerators and cooling vents (6, 13, 15, 34, 40, 45, 48, 49, 50, 56, 71). In 1887 Forester was the first to call attention to the growth of microorganisms at low temperatures by using fish to isolate bacteria that grew at 0C (23). Since then, numerous organisms, both prokaryotic and eukaryotic, have been isolated from cold habitats (21). Evolution has allowed these cold-adapted organisms not to merely survive, but to thrive in the harsh and restrictive environment of cold temperatures. It is expected by most that to show ‘complete’ adaptation to the cold, psychrophiles should have enzymes with catalytic rates on par with those of their mesophilic homologues, but only a few such enzymes have been characterized. Although recently, a small number of microorganisms with doubling times as fast as 30 minutes at 4C have been isolated and are expected to have enzymatic activities equivalent to mesophilic or thermophilic species at their optimal temperature (11). One question often asked is ‘What is the definition of a psychrophile?’ The strictest definition was given by Morita and states that a psychrophile is a microorganism with a growth optimum below 15C that does not grow above 20C (41). However, this definition is problematic for three primary reasons. First, as Neidhardt and others have
3
pointed out the definition is an arbitrary selection of limits rather than any fundamental principle relevant to the growth of microorganisms (42). Second, it does not apply to the numerous eukaryotes (fish, worms, sponges, etc.) that live in the same coldenvironments. Third, microorganisms act not only as thermodynamic units, increasing activity rates as temperature increases, but also as biological units, regulating cellular processes in conjunction with temperature fluxes. Meaning that even though an organism may grow faster at higher temperature (thermodynamic unit) the cell is under more stress at these temperatures (biological unit) as evidenced by changes in physiology (19). In our efforts to communicate, scientists often impose strict restrictions that Nature does not create or recognize. So, to avoid this difficulty, Neidhardt and others have defined a psychrophile as an organism that is capable of growing at 5C or below, a mesophile as an organisms that has an optimum around 37C, and a thermophile which has an optimum above a mesophile. For the remainder of this thesis these definitions will be used to describe psychrophiles, mesophiles and thermophiles.
Adaptations of Microorganisms to Low Temperature To compensate for the negative effects of cold temperatures, organisms undergo several physiological adaptations such as: regulating the fluidity of their membranes, synthesizing temperature-related chaperones, producing antifreeze molecules, and/or altering structural proteins. Organisms will alter the degree of saturation in the fatty acids to increase or decrease membrane fluidity. For thermophiles, this means an increase in saturation, which results in a decrease in fluidity. Certain thermophiles have 4
also been shown to alter the types of lipids found in the membrane, such as substituting archaeol lipids for macrocyclic archaeol lipids (32). Psychrophiles adapt by increasing membrane fluidity through an increase in the number of branched-chain or unsaturated fatty acids and/or a shortening of the length of the fatty-acyl chains (47, 57). Molecular chaperones also aid in the adaptation to extremes of temperature. Cold and heat-shock responses have been observed in psychrophiles and thermophiles, respectively. These molecules both aid in the refolding of proteins and affect the levels of protein synthesis (69). Psychrophiles and thermophiles may also use cryoprotectors such as trehalose, which, has been shown to be upregulated in response to many environmental stresses. Its mode of action in response to cold-shock or freezing temperature is currently unknown but it is thought to stabilize certain cell proteins and/or lipid membranes. For psychrophiles adaptation to cold temperatures usually means surviving at temperatures where water freezes. Therefore, to reduce the damage caused by forming ice crystals they may also use one of four categories of antifreeze proteins. Antifreeze proteins act by binding seed ice crystals thereby inhibiting their growth. Crystal structures of some of these molecules have shown that there is a high degree of complimentarity between the binding face of the cryoprotector and the surface of the ice making the bond between the two virtually irreversible (4, 44). Structural proteins are also affected by temperature. Studies on the effects of temperature on microtubule integrity in Antarctic fish and algae have shown that they are more likely to be stable than their homeothermic relatives (16). This is thought to occur via alterations that stabilize the tubule monomers in a conformation that promotes
5
polymerization and through reductions in the dynamic instability of microtubules by slowing down the conformational change in the tubulin dimer preceding depolymerization.
The Problem of Maintaining Enzyme Activity at Low Temperatures Microbes are generally subject to the temperature of their environment and as a consequence must find ways to adapt to the limitation placed on them by extremes of temperature. In order to function properly at the lower end of the temperature scale, organisms have made certain adjustments over the course of evolution. In addition to a reduction in reaction rates at lower temperatures other adjustments include: increase in the solubility of gases, reduction in the solubility of salts, changes in the viscosity of water, reduction in membrane fluidity, alterations in protein-protein interactions, and a decrease in the pH (19). Enzymes must overcome at least two obstacles in order to maintain activity at low temperatures. One problem is overcoming cold-denaturation. This process occurs at low temperatures since as the temperature decreases the water molecules surrounding the protein surface become more ordered and thereby less associated with the protein eventually resulting in pushing the system equilibrium toward the unfolded state. In theory, this phenomenon affects cold-active enzymes more than mesophilic or thermophilic enzymes because as water molecules are removed from the protein surface the more inherent hydrophobic nature of mesophilic and thermophilic proteins keeps their structures intact while the less hydrophobic cold-active enzymes become less ordered and 6
unfold (20). The second problem for enzymes at low temperatures is slower reaction rates. According to the Boltzman equation, reaction rates increase with increasing temperature and decrease 2-3 fold for every 10C decrease. Therefore, if cold-active enzymes are to have activities on par with their mesophilic counterparts they must have developed structural changes to overcome these thermodynamic barriers. Another problem is that enzymes must undergo small protein motions (‘breathing’) during catalysis (46). At colder temperatures, these movements are impeded and could possibly lead to inactivity. Therefore cold-active enzymes must have some structural adaptations to maintain the level of ‘breathing’ necessary for catalysis. To overcome the negative impact of the cold, these changes must enhance the catalytic efficiencies of the enzymes either through increasing kcat, decreasing the Km, or some combination of the two.
Enzyme Activity at Lower Temperatures Beyond cellular adaptations to life in cold temperatures, proteins (through DNA mutations) have also fashioned their own set of thermal adaptations. Unlocking the properties that set an enzyme’s ‘thermostat’ could prove to be financially as well as intellectually rewarding and scientists have struggled for decades to decipher the clues to thermal adaptation. To date, four main strategies have been suggested for activity at cold temperatures: altering production levels of certain enzymes, expressing isotypes specific to certain temperatures, producing enzymes that are essentially temperature independent, and increasing an enzyme’s catalytic potential. The first strategy suggests that the lowered activation rate for cold-active enzymes could be overcome by increasing the
7
concentration of the enzyme. However, this is energetically unfavorable for an organism and has only been reported in some species of fish and suggested for certain bacteria (29, 30). The second strategy is only helpful when there are multiple copies of a gene present and is employed by fish and nematodes during seasonal changes (27, 61). The third strategy basically suggests the evolution of ‘perfect’ enzymes. These diffusion-limited enzymes have been reported in a few cases such as the triosephosphate isomerase from Vibrio marinus (3), but on the whole these enzymes are rare. The fourth strategy is based on the theory for thermal adaptation which states that cold-active enzymes must be more flexible while thermophilic enzymes must be more rigid than mesophiles in order to maintain the proper level of ‘breathing’ during catalysis (46). Several suggestions have been made about how enzymes could alter their flexibility at different temperatures. For cold-active enzymes these suggestions include altering specific amino acid composition; changing the overall charge; decreasing the hydrophobicity in the core of the enzyme or decreasing the number of hydrogen bonds, salt bridges, or bound ions (18, 24, 52). Although the idea of a gradient of flexibility has been shown to be true for some extremophilic enzymes, there are others where it has been proven incorrect (72).
Adaptations to Cold-Temperatures Based on Structure Analysis Many different alterations in cold-active enzymes have been suggested to account for their increased activity at low temperatures. Currently there are only 10 determined structures of cold active enzymes and they include: -amylase and xylanase from Pseudoalteromonas haloplanktis (1, 68), citrate synthase from Arthrobacter strain DS2-
8
3R (53), malate dehydrogenase from Aquaspirillium arcticum (36), alkaline Ca2+-Zn2+ protease from Pseudomonas sp. TACII18 (2), alkaline phosphatase from Pandalus borealis (Arctic shrimp) (14), anionic trypsins from Salmo salar (North Atlantic salmon) (60) and Oncorhynchus keta (chum salmon) (66), elastase from Salmo salar, and pepsin from Gadus morhua (Atlantic cod) (33). Based on analysis of the solved structures of cold-active enzymes and comparisons to the solved structures of mesophilic or thermophilic enzymes, three main proposals for adaptations that enhance enzyme activity at low temperatures have emerged. The first suggests that the exposure of hydrophobic residues increases compared to those in a mesophilic homologue, which is seen in the -amylase, citrate synthase, and anionic trypsin from North Atlantic salmon. The second suggests that the size of or access to the active site is greater. This has been seen in -amylase, xylanase, citrate synthase, alkaline metalloprotease and both anionic trypsins from salmon. The third adaptation involves a modification of the electrostatic potential of the enzyme. This has been noted in the malate dehydrogenase and anionic trypsins, but is most striking in the shrimp alkaline phosphatase where the protein surface is predominantly negatively charged while the active site is the only clearly positive charged area of the surface. The structures of the remaining two enzymes do not offer many suggestions about the structural features that increase their activity at low temperatures. The structure of the pepsin from Atlantic cod is similar to mammalian pepsins, but when compared to porcine pepsin, it was observed that the cold-active pepsin had a similar amount of disulfide bonds, hydrogen bonds, aromatic interactions, electrostatic interactions, and average hydrophobicity while some surface loops were shorter in the cold-active pepsin.
9
However, the authors cautioned that these are mere suppositions as the fish pepsin structure was solved without knowledge of the primary sequence of the enzyme. When the salmon elastase was compared to its porcine homologue, both structures showed very little difference, however, the salmon enzyme was less stable at lower pH values and temperatures than the porcine enzyme (8). The few differences were (a) one amino acid deletion in the salmon enzyme (b) a change from glutamate in the porcine structure to asparagine in the salmon structure (c) a change at the calcium binding site of an aspartic acid in pig to glutamic acid in salmon. In summary, identifying the structural features that confer cold-activity has been extremely difficult due to a lack of not only solved three-dimensional structures but also to a lack of characterized cold-active enzymes. The above studies offer an initial guide to understanding the structural requirements necessary for cold-activity, but much work remains before patterns can be discovered if they exist.
Limitations of Current Knowledge about Cold-Active Enzymes Despite the suggestions offered to explain the adaptation to cold-activity, many of the ideas regarding the alterations necessary for cold-activity have come from pairwise comparisons of mesophilic and thermophilic structures. Those that do involve coldactive enzymes usually compare primary sequences due to the dearth of information, both structural and enzymatic, available for these enzymes. To further complicate the matter, when comparisons are made they are almost always done with distantly related organisms. For example, one of the most well studied cold-active enzymes, the 10
amylase from Pseudoalteromonas haloplanktis, was compared to its porcine pancreatic homologue. Although these two enzymes share 66% sequence similarity, the phylogenetic distance between the two host organisms makes it difficult to confidently discern between mutations resulting from temperature adaptations and ones arising through genetic drift (58). Unfortunately, the comparison of enzymes from phylogenetically unrelated organisms is a common trend. Often the enzyme is compared to another from an organism in an entirely different Domain on the Tree of Life (e.g. Bacteria and Eukarya). To minimize this problem in my work I have selected a small group of enzymes from prokaryotic species to study, which are all members of the second family of glycosyl hydrolases.
Glycosyl Hydrolases Glycosyl hydrolases can cleave the glycosidic bond between two or more carbohydrate moieties or between a carbohydrate and another moiety (such as a nitrophenol group). They are found throughout nature especially at several key physiological reactions necessary for life: turnover of cell surface carbohydrates, hydrolysis of storage polysaccharides, etc. Further, genetic deficiencies of glycosyl hydrolases, such as lactose intolerance, are one of the most common disorders in humans (59). Over the years, there have been several attempts to categorize these enzymes. The simplest classification is based on substrate or product specificity and is the basis of the recommendations of the International Union of Biochemistry and Molecular Biology (IUBMB) (38). Under this system, each enzyme is categorized by an EC number, for 11
example EC 3.2.1.23, for -galactosidases. The EC number describes certain classes and subclasses in its first three numbers and the substrate specificity in the final number. This system is valuable for its simplicity and extensive application, but its basis on substrate or product specificity does not accommodate all enzymes, especially those with broad substrate specificities. A second system that has been proposed is based on the mechanism of action. In the case of glycosyl hydrolases, they function in one of two general mechanisms: retention or inversion, referring to the preference for certain glycosidic bonds. For the retention mechanism, an enzyme that hydrolyzes a particular bond (axial or equatorial) will produce a product with an identical bond. Inversion refers to the alteration of glycosidic bond type (i.e. equatorial to axial or vice versa). In both cases, there are two residues of importance in the enzyme, a nucleophile and a proton donor, both of which are usually an aspartic or glutamic acid residue. For this system, knowing the stereochemistry of the enzymatic reaction is essential. Further, as in the case of glycosyl hydrolases, there are only two possible outcomes, which make this a somewhat limited form of classification. However, it does provide useful information on the mechanics of a reaction. Yet another classification system suggested for glycosyl hydrolases is based on its action on a polysaccharide. In this system, enzymes are classified as either ‘endo’ or ‘exo’ based on whether they attack somewhere within the polysaccharide or at one of the ends. As with the other systems, the power of this method resides in its simplicity. However, distinctions between ‘exo’ and ‘endo’ can be quite difficult to measure.
12
In 1991, Bernard Henrissat outlined a classification for glycosyl hydrolases based on sequence similarities. Since then, this classification system has grown to become the standard method for categorizing glycosyl hydrolases (26). This method incorporates about 100 families organized by hydrophobicity plots, amino acid sequence similarities, and sometimes by reaction mechanism. As a result of the dramatic increase in glycosyl hydrolase structures that have been solved over the years, the classification system now also organizes members into eight clans based on structural similarities. The family two glycosyl hydrolases currently consists of around 456 members, and is made up of -galactosidases, - glucuronidases, and -mannosidases. Family 2 is characterized by having a glutamic acid residue as the acid/base catalyst and at the nucleophile site. They also contain a highly conserved region 60 residues toward the Nterminus from the general acid/base catalyst. Structurally, they are placed in the GH-A clan which all degrade beta-1,4 (or 1,3) linked carbohydrates. They share the same overall fold (due to similar catalytic mechanism) and yet only three completely conserved residues are found within the clan. The enzymes of this group have been isolated from host organisms that range over the entire Domains of Archaea, Eukarya and Bacteria. One of the most well studied members of this family is the -galactosidase from Escherichia coli (LacZ). This -galactosidase is the first product of the lac operon, and carries out three primary functions: the hydrolysis of lactose into its component sugars (glucose and galactose), the formation of allolactose, the natural inducer of the lac operon, and the cleavage of allolactose into galactose and glucose. The -galactosidase from E. coli has been studied in depth and has been widely used in molecular biology as a reporter molecule.
13
Lactose Intolerance Lactose is the primary sugar in mammalian milk and constitutes 7% of human milk, roughly 5% of whole cows milk, and 70% by weight of the whey solids of milk. Further, the food industry has made use of several of the characteristics of lactose using it in several non-dairy based products like breads, cereals, salad dressings, cake mixes, and even in formulating prescription and over-the-counter drugs. Despite the wide spread use of lactose in our foods and medicines, it is estimated that up to 90% of all people will experience some form of lactose intolerance during their lifetime. The decline of lactase (-galactosidase) can appear as early as 1 (African or Thai populations) or as late as 15 years old (Scandinavian or Northern European populations) in humans (12). The great variability in the age of onset for lactose intolerance has led many researchers to postulate that dietary habits play a major role in the decline of lactase activity. It has been suggested that increases of lactose in the diet can help combat the natural decline in lactase activity seen post-weaning. Animal studies have shown that if rats are regularly fed a diet with increased levels of lactose an increase in lactase activity is observed. Unfortunately, this roughly two fold increase in activity is still much smaller than the ten fold decrease seen after weaning (12). However, it has been observed that some human populations (mostly Northern Europeans) have the genetically predetermined ability to digest lactose into adulthood. Interestingly, a recent study looked at the variation in genes encoding the six most important milk proteins in cows and found that the highest levels of variation were coincident with human populations carrying the lactose persistence mutation and European Neolithic cattle farming sites. The authors suggest that since the Neolithic there has been gene-culture coevolution
14
between domestic cattle and humans driven by the advantages of milk consumption. This led to the maintenance of large herds as well as the selection and maintenance of mutations that increased milk production in cattle and lactose digestion in humans (7). Those who are lactose intolerant can suffer from a variety of conditions such as impaired digestion or malabsorption of lactose. There is a range of impaired digestion from adult deficiency where only partial lactase activity is lost to congenital deficiency where there is no lactase activity. It also includes secondary lactase deficiency where the enzyme activity is lost due to disease, infection, or severe malnutrition. Malabsorption results when lactose is not hydrolyzed in the small intestine, which results in large amounts entering the colon triggering an increase of water in the colon. The natural flora of the colon can then ferment the lactose resulting in the production of H2, CH4, and CO2. These gases and the increase in water lead to the characteristic signs and symptoms of lactose intolerance: watery acid diarrhea, abdominal distention, pain, and flatulence (54). The commonality of lactose intolerance has led to the need to produce low lactose products for the general public. One way to accomplish this is to hydrolyze the lactose with an enzyme. Currently, the two most common enzymes used in industry are the galactosidases from Kluyveromyces lactis (10) and Aspergillus oryzae (65). Both of these enzymes are mesophilic, which means that the temperature of the milk must be raised from 4C up to 30C for them to be active. However, a -galactosidase with optimal activity at lower temperatures would avoid this problem thereby saving energy and money. Further, if added at the factory, the enzyme would be active during refrigerated shipping and storage before the milk is consumed. Compared to the short time the milk is treated with the current enzymes at the factory, the cold-active enzyme
15
would have more time to remove the lactose. Therefore, the cold-active enzyme would not necessarily need to be as active as the mesophilic ones due to the increased time it would have to hydrolyze the lactose.
Thesis Organization The material in this thesis is organized into seven chapters. The second chapter was accepted for publication in the Journal of Bacteriology and printed in the September 2003 issue (Vol. 185). It is presented here with some additional data from its printed form. In Chapter two, I present the characterization of the cold-active -galactosidase (BgaS) from the Arthrobacter isolate SB, and compare its properties to other cold-active -galactosidases from the second family of glycosyl hydrolases including its mesophilic homologue, the LacZ enzyme from Escherichia coli. Current theories regarding adaptation to activity at cold temperatures are also discussed and tested on the BgaS enzyme. Interestingly, I found that many proposed trends, including overall amino acid composition changes, disappear when using averages for several proteins or comparing evolutionarily related enzymes. This finding led me to hypothesize that answers to the questions about mechanisms that allow enzymes to remain active and stable while adapted to low temperatures will be found in subtle, synergistic, and cooperative intramolecular interactions. In Chapter three, I present the results of a directed mutagenesis study targeted at a region of the BgaS enzyme that encodes the region similar to the mobile loop in domain five of the LacZ enzyme. This study was based on a paper published by the Huber group 16
at the University of Calgary where they found that a single alteration (G794D) in the mobile loop resulted in a five-fold increase in kcat for the LacZ enzyme when lactose was the substrate. However, when similar alterations were made in the BgaS enzyme a loss of activity was observed. This showed that this area of BgaS was also important for activity and provided a platform for selecting mutants with activity restored. In Chapter four, I mutagenized the gene containing the loss of function mutation created in Chapter three and screened transformants for ones with restored galactosidase activity. This mutagenesis showed that only two new alterations were necessary to restore activity to the loss of function mutant. Further, when placed in a wild type background these two mutations increased the catalytic efficiency three fold. This increase in activity was accomplished through a decrease in calorimetric enthalpy (increased flexibility) without a significant change in thermostability. These two traits (flexibility and stability) are thought by many to be linked traits in cold-active enzymes; however, the data from this chapter argues otherwise. In Chapter five, I continue the use of a directed mutagenesis approach to study the activity and thermostability of a particular region of the BgaS enzyme. In this chapter, I study the C-terminal portion of the BgaS enzyme, focusing particularly on the Trp-1033 and Cys-1028 residues. Alterations at the Trp-1033 residue resulted in a loss of activity as did certain alterations of the Cys-1028 residue; however, replacement with either glycine or serine and residue 1028 lead to an enzyme that retained activity and had a 15C increase in thermal optimum, compared to wild type. Similar increases in thermal optima were also seen when these mutations were placed in the bgaS7 background and
17
into a gene encoding a closely related -galactosidase from Arthrobacter psychrolactophilus. In Chapter six, I report the results of a directed evolution experiment, which resulted in a more thermostable mutant of the BgaS enzyme that has an increase in catalytic efficiency compared to BgaS and BgaS7. This increase in activity and stability is achieved through one additional amino acid alteration to the BgaS7 enzyme, further suggesting that few modifications are necessary to alter the activity and thermal properties of an enzyme. This new mutant also has increased lactose hydrolysis in milk compared to BgaS and BgaS7, suggesting it might be viable alternative for use by the dairy industry.
18
References 1.
Aghajari, N., G. Feller, C. Gerday, and R. Haser. 1998. Crystal structures of
the psychrophilic alpha-amylase from Alteromonas haloplanctis in its native form and complexed with an inhibitor. Protein Sci. 7:564-572. 2.
Aghajari, N., F. Van Petegem, V. Villeret, J.-P. Chessa, C. Gerday, R. Haser,
and J. Van Beeumen. 2003. Crystal structures of a psychrophilic metalloprotease reveal new insights into catalysis by cold-adapted proteases. Proteins 50:636-647. 3.
Alvarez, M., J. P. Zeelen, V. Mainfroid, F. Rentier-Delrue, J. A. Martial, L.
Wyns, R. K. Wierenga, and D. Maes. 1998. Triose-phosphate isomerase (TIM) of the psychrophilic bacterium Vibrio marinus. Kinetic and structural properties. J. Biol. Chem. 273:2199-21206. 4.
Antson, A. A., D. J. Smith, D. I. Roper, S. Lewis, L. S. Caves, C. S. Verma, S.
L. Buckley, P. J. Lillford, and R. E. Hubbard. 2001. Understanding the mechanism of ice binding by type III antifreeze proteins. J. Mol. Bio. 305:875-889. 5.
Bale, S. J., K. Goodman, P. A. Rochelle, J. R. Marchesi, J. C. Fry, A. J.
Weightman, and R. J. Parkes. 1997. Desulfovibrio produndus sp. nov., a novel barophilic sulfate-reducing bacterium from deep sediment layers in the Japan Sea. Int. J. Syst. Bacterio. 47:515-521. 6.
Beja, O., M. T. Suzuki, J. F. Heidelberg, W. C. Nelson, C. M. Preston, T.
Hamada, J. A. Eisen, C. M. Fraser, and E. F. DeLong. 2002. Unsuspected diversity among marine aerobic anoxygenic phototrophs. Nature 415:630-633. 7.
Beja-Pereira, A., G. Luikart, P. R. England, D. G. Bradley, O. C. Jann, G.
Bertorelle, A. T. Chamberlain, T. P. Nunes, S. Metodiev, N. Ferrand, and G.
19
Erhardt. 2004. Gene-culture coevolution between cattle milk protein genes and human lactase genes. Nature Genetics 35:311-313. 8.
Berglund, G. I. 1995. Structure of native pancreatic elastase from North Atlantic
salmon at 1.61 A resolution. Acta. Crystallogr. D. Biol. Crystallogr. 51:925-937. 9.
Chen, M. 1983. Adaptation of mesophilic anaerobic sewage fermentor
populations to thermophilic temperatures. Appl. Environ. Microbiol. 45:1271-1276. 10.
Coenen, T. M., A. M. Bertens, S. C. de Hoog, and C. M. Verspeek-Rip. 2000.
Safety evaluation of a lactase enzyme preparation derived from Kluyveromyces lactis. Food Chem. Toxicol. 38:671-677. 11.
Corsaro, M. M., R. Lanzetta, E. Parrilli, M. Parrilli, M. L. Tutino, and S.
Ummarino. 2004. Influence of growth temperature on lipid and phosphate contents of surface polysaccharides from the antarctic bacterium Pseudoalteromonas haloplanktis TAC125. J Bacteriol. 186:29-34. 12.
Dahlquist, A. 1983. Digestion of Lactose, p. 11-16. In J. Delmont (ed.), Milk
Intolerances and Rejection. Karger, NY, 13.
Dalton, R. 2002. Drillers dig deep for microbes under the sea floor. Nature
415:566. 14.
de Backer, M., S. McSweeney, H. B. Rasmussen, B. W. Riise, P. Lindley, and
E. Hough. 2002. The 1.9 A crystal structure of heat-labile shrimp alkaline phosphatase. J. Mol. Bio. 318:1265-1274. 15.
Demming, J. W. 2002. Psychrophiles and polar regions. Curr. Opin. Microbiol.
5:301-309.
20
16.
Detrich, H. W., S. K. Parker, R. C. J. Williams, E. Nogales, and K. H.
Downing. 2000. Cold-adaptation of microtubule assembly and dynamics. Structural interpretation of primary sequence changes present in the alpha- and beta-tubulins of Antarctic fishes. J. Biol. Chem. 275:37038-37047. 17.
Dopson, M., C. Baker-Austin, A. Hind, J. P. Bowman, and P. L. Bond. 2004.
Characterization of Ferroplasma isolates and Ferroplasma acidarmanus sp. nov., extreme acidophiles from acid mine drainage and industrial bioleach environments. Appl. Environ. Microbiol. 70:2079-2088. 18.
Feller, G. 2003. Molecular adaptations to cold in psychrophilic enzymes. Cell.
Mol. Life Sci. 60:648-662. 19.
Feller, G., and C. Gerday. 2003. Psychrophilic enyzmes: hot topics in cold
adaptation. Nature Rev. Microbiol. 1:200-208. 20.
Fields, P. A. 2001. Protein function at thermal extremes: balancing stability and
flexibility. Comp. Biochem. Physiol. Pt. A 129:417-431. 21.
Fields, P. A., and G. N. Somero. 1998. Hot spots in cold adaptation: localized
increases in conformational flexibility in lactate dehydrogenase A4 orthologs of Antarctic notothenoid fishes. Proc. Natl. Acad. Sci. U.S.A. 95:11476-81. 22.
Fitz-Gibbon, S. T., and C. H. House. 1999. Whole genome-based phylogenetic
analysis of free-living microorganisms. Nucleic Acids Res. 27:4218-22. 23.
Forster, J. 1887. Ueber einige Eigenschaften leuchtender Bakterien. Centr.
Bakteriol. Parasitenk. 2:337-340.
21
24.
Georlette, D., V. Blaise, T. Collins, S. D'Amico, E. Gratia, A. Hoyoux, J.-C.
Marx, G. Sonan, G. Feller, and C. Gerday. 2004. Some like it cold: biocatalysis at low temperatures. FEMS Microbiol. Rev. 28:25-42. 25.
Groudieva, T., R. Grote, and G. Antranikian. 2003. Psychromonas arctica sp.
nov., a novel psychrotoerant, biofilm-forming bacterium isolated from Spitzbergen. Int. J. Syst. Evol. Microbiol. 53:539-545. 26.
Henrissat, B., and G. Davies. 1997. Structural and sequence-based classification
of glycoside hydrolases. Curr. Opin. Struct. Biol. 7:637-644. 27.
Hochachka, P. W., and G. N. Somero. 1984. Temperature Adaptation, p. 355-
449. In P. W. a. S. Hochachka, G.N. (ed.), Biochemical Adaptations. Princeton University Press, Princeton, NJ. 28.
Hozzein, W. N., W.-J. Li, M. I. A. Ali, O. Hammouda, A. S. Mousa, L.-H. Xu,
and C.-L. Jiang. 2004. Nocardiopsis alkaliphila sp. nov., a novel alkaliphilic actinomycete isolated from desert soil in Egypt. Int. J. Sys. Evol. Microbiol. 54:247-252. 29.
Huston, A. L., B. B. Krieger-Brockett, and J. W. Deming. 2000. Remarkably
low temperature optima for extracellular enzyme activity from Arctic bacteria and sea ice. Environ Microbiol. 2:383-388. 30.
Johnston, I. A. 1990. Cold adaptation in marine organisms. Philos. Trans. R. Soc.
Lond. B. Biol. Sci. 326:655-667. 31.
Junge, K., C. Krembs, J. Demming, A. Stierle, and H. Eicken. 2001. A
microscopic approach to investigate bacteria under in situ conditions in sea-ice samples. Ann. Glaciol. 33:304-310.
22
32.
Kaneshiro, S. M., and D. S. Clark. 1995. Pressure effects on the composition
and thermal behavior of lipids from the deep-sea thermophile Methanococcus jannashii. J. Bacteriol. 177:3668-3672. 33.
Karlsen, S., E. Hough, and R. L. Olsen. 1998. Structure and proposed amino-
acid sequence of a pepsin from atlantic cod (Gadus morhua). Acta Crystallogr D Biol Crystallogr. 54:32-46. 34.
Karr, E. A., W. M. Sattley, D. O. Jung, M. T. Madigan, and L. A.
Achenbach. 2003. Remarkable diversity of phototrophic purple bacteria in a permanently frozen Antarctic lake. Appl. Environ. Microbiol. 69:4910-4914. 35.
Kashefi, K., and D. Lovley. 2003. Extending the upper temperature limit for life.
Science 301:934. 36.
Kim, S. Y., K. Y. Hwang, S. H. Kim, H. C. Sung, Y. S. Han, and Y. Cho.
1999. Structural basis for cold adaptation. Sequence, biochemical properties, and crystal structure of malate dehydrogenase from a psychrophile Aquaspirillium arcticum. J. Biol. Chem. 274:11761-11767. 37.
Lauro, F. M., G. Bertoloni, A. Obraztsova, C. Kata, B. M. Tebo, and D. H.
Bartlett. 2003. Pressure effects on Clostridium strains isolated from a cold deep-sea environment. Extremophiles 8:169-173. 38.
Liebecq, C. 1997. IUPAC-IUBMB Joint Commission on Biochemical
Nomenclature (JCBN) and Nomenclature Committee of IUBMB (NC-IUBMB). Eur. J. Biochem. 247:733-739. 39.
McCammon, S. A., B. H. Innes, J. P. Bowman, P. D. Franzmann, S. J.
Dobson, J. H. Holloway, J. H. Skerratt, P. D. Nichols, and L. M. Rankin. 1998.
23
Flavobacterium hibernum sp. nov., a lactose-utilizing bacterium from a freshwarer Antarctic lake. Int. J. Sys. Bacteriol. 48:1405-1412. 40.
Miteva, V. I., P. P. Sheridan, and J. E. Brenchley. 2004. Phylogenetic and
physiological diversity of microorganisms isolated from a deep greenland glacier ice core. Appl. Environ. Microbiol. 70:202-213. 41.
Morita, R. Y. 1975. Psychrophilic bacteria. Bacteriol. Rev. 39:144-167.
42.
Neidhardt, F. C., J. L. Ingraham, and M. Schaechter. 1990. Physiology of the
bacterial cell: a molecular approach. Sinauer Associates, Inc.: Sunderland., 43.
Norris, T. B., J. M. Wraith, R. W. Castenholz, and T. R. McDermott. 2002.
Related Articles, Links Abstract Soil microbial community structure across a thermal gradient following a geothermal heating event. Appl Environ Microbiol 68:6300-9. 44.
Phadtare, S. 2004. Recent developments in bacterial cold-shock response. Curr.
Issues Mol. Biol. 6:125-136. 45.
Radax, C., C. Gruber, and H. Stan-Lotter. 2001. Novel haloarchaeal 16S
rRNA gene sequences from Alpine Permo-Triassic rock salt. Extremophiles 5:221-228. 46.
Rasmussen, B. F., A. M. Stock, D. Ringe, and G. A. Petsko. 1992. Crystalline
ribonuclease A loses function below the dynamical transition at 220 K. Nature 357:423424. 47.
Reizer, J., N. Grossowicz, and Y. Barenholz. 1985. The effect of growth
temperature on the thermotropic behavior of the membranes of a thermophilic Bacillus. Composition-structure-function relationships. Biochim. Biophys. Acta 815:268-280.
24
48.
Rivkina, E. M., E. I. Friedmann, C. P. McKay, and D. A. Gilichinsky. 2000.
Metabolic activity of permafrost bacteria below the freezing point. Appl. Environ. Microbio. 66:3230-3233. 49.
Rudi, K., T. Maugesten, S. E. Hannevik, and H. Nissen. 2004. Explorative
multivariate analyses of 16S rRNA gene data from microbial communities in modifiedatmoshpere-packed salmon and coalfish. Appl. Environ. Microbiol. 70:5010-5018. 50.
Rudolph, C., G. Warner, and R. Huber. 2001. Natural communities of novel
archaea and bacteria growing in cold sulfurous springs with a string-of-pearls-like morphology. Appl. Environ. Microbiol. 67:2336-2344. 51.
Ruff-Roberts, A. L., J. G. Kuenen, and D. M. Ward. 1994. Distribution of
cultivated and uncultivated cyanobacterial and Chloroflexus-like bacteria in hot spring microbial mats. Appl. Environ. Microbiol. 60:697-704. 52.
Russell, N. J. 2000. Toward a molecular understanding of cold activity of
enzymes from psychrophiles. Extremophiles 4:83-90. 53.
Russell, R. J., U. Gerike, M. J. Danson, D. W. Hough, and G. L. Taylor. 1998.
Structural adaptations of the cold-active citrate synthase from an Antarctic bacterium. Structure 6:351-361. 54.
Saavedra, J. M., and J. A. Perman. 1989. Current concepts in lactose
malabsorption and intolerance. Annu. Rev. Nutr. 9:475-502. 55.
Sato, S., C. A. Hutchinson III, and J. L. Harris. 1977. A thermostable
sequence-specific endonuclease from Thermus aquaticus. Proc. Natl. Acad. Sci. USA 74:542-6.
25
56.
Schabereiter-Gurtner, C., C. Saiz-Jimenez, G. Pinar, W. Lubitz, and S.
Rolleke. 2002. Altamira cave Paleolithic paintings harbor partly unknown bacterial communities. FEMS Microbiol. Lett. 211:7-11. 57.
Sheridan, P. P., J. Loveland-Curtze, V. I. Miteva, and J. E. Brenchley. 2003.
Rhodoglobus vestalii gen. nov., sp. nov., a novel psychrophilic organism isolated from an Antarctic Dry Valley lake. Int. J. Syst. Evol. Microbiol. 53:985-994. 58.
Sheridan, P. P., N. Panasik Jr., J. M. Coombs, and J. E. Brenchley. 2000.
Approaches for deciphering the structural basis of low temperature enzyme activity. Biochim. Biophys. Acta 1543:417-433. 59.
Sibley, E. 2004. Genetic variation and lactose intolerance: detection methods and
clinical implications. Am. J. Pharmacogenomics 4:239-245. 60.
Smalas, A. O., E. S. Helmstad, A. Hordvik, and N. P. Willassen. 1994. Cold
adaption of enzymes: structural comparison between salmon and bovine trypsins. Proteins 20:149-166. 61.
Somero, G. N. 1995. Proteins and temperature. Annu. Rev. Physiol. 57:43-68.
62.
Sutherland, L. A., W. M. Wong, and R. N. Nazar. 1989. Sequence and putative
regulatory elements in a 5S rRNA gene from a eukaryotic thermophile, Thermomyces lanuginosus. Nucleic Acids Res. 17:10504. 63.
Takai, K., and K. Horikoshi. 1999. Genetic diversity of archaea in deep-sea
hydrothermal vent environments. Genetics 152:1285-1297. 64.
Takai, K., D. P. Moser, M. DeFlaun, T. C. Onstott, and J. K. Fredrickson.
2001. Archaeal diversity in waters from deep South African gold mines. Appl. Environ. Microbiol. 67:5750-5760.
26
65.
Tosa, T., and T. Shibatani. 1995. Industrial application of immobilized
biocatalysts in Japan. Ann N Y Acad Sci. 750:364-75. 66.
Toyota, E., K. K. Ng, S. Kuninaga, H. Sekizaki, K. Itoh, K. Tanizawa, and M.
N. James. 1994. Crystal structure and nucleotide sequence of an anionic trypsin from chum salmon (Oncorhynchus keta) in comparison with Atlantic salmon (Salmo salar) and bovine trypsin. J. Mol. Biol. 324:391-397. 67.
Ueda, K., M. Ohno, K. Yamamoto, H. Nara, Y. Mori, M. Shimada, M.
Hayashi, H. Oida, Y. Terashima, M. Nagata, and T. Beppu. 2001. Distribution and diversity of symbiotic thermophiles, Symbiobacterium thermophilum and related bacteria, in natural environments. Appl. Environ. Microbiol. 67:3779-3784. 68.
Van Petegem, F., T. Collins, M.-A. Meuwis, C. Gerday, G. Feller, and J. Van
Beeumen. 2003. The structure of a cold-adapted family 8 xylanase at 1.3 A resolution. J. Biol. Chem. 278:7531-7539. 69.
Veinger, L., S. Diamant, J. Buchner, and P. Goloubinoff. 1998. The small
heat-shock protein IbpB from Escherichia coli stabilizes stress-denatured proteins for subsequent refolding by a multichaperone network. J. Biol. Chem. 1998:11032-11037. 70.
Wainwright, M., N. C. Wickramasinghe, J. V. Narlikar, and P. Rajaratnam.
2003. Microorganisms cultured from stratospheric air samples obtained at 41 km. FEMS Microbiol. Lett. 218:161-165. 71.
Yakimov, M. M., L. Giuliano, G. Gentile, E. Crisafi, T. N. Chernikova, W. R.
Abraham, H. Lunsdorf, K. N. Rimmis, and P. N. Golyshin. 2003. Oleispira antarctica gen. nov. sp. nov., a novel hydrocarbonoclastic marine bacterium isolated from Antarctic costal sea water. Int. J. Syst. Evol. Microbiol. 53:779-85.
27
72.
Zartler, E. R., F. E. Jenney, M. Terrell, M. K. Eidsness, M. W. W. Adams,
and J. H. Prestegard. 2001. Structural basis for thermostability in aporubredoxins from Pyrococcus furiosus and Clostridium pasteurianum. Biochemistry 40:7279-7290.
28
Chapter 2
Biochemical Characterization of a -galactosidase with a Low Temperature Optimum Obtained from an Antarctic Arthrobacter Isolate
29
Abstract A psychrophilic Gram positive isolate was obtained from Antarctic Dry Valley soil. It utilized lactose, had a rod-coccus cycle, and contained lysine as the diamino acid in its cell wall. Consistent with these physiological traits, the 16S rDNA sequence showed that it was phylogenetically related to other Arthrobacter species. A gene (bgaS) encoding a family 2 -galactosidase was cloned from this organism into an Escherichia coli host. Preliminary results showed that the enzyme was cold-active (optimal activity at 15C and 60% activity remaining at 0C) and heat-labile (inactivated within 10 minutes at 37°C). To enable rapid purification, vectors were constructed adding histidine residues to the BgaS enzyme and its E. coli LacZ counterpart, which was purified for comparison. The His-tag additions reduced the specific activities of both -galactosidases, but did not alter the other characteristics of the enzymes. Kinetic studies using ONPG (onitrophenyl--D-galactopyranoside) showed that BgaS with and without a His-tag had greater catalytic activity at and below 20°C than the comparable LacZ -galactosidases. The BgaS heat-lability was investigated by ultracentrifugation where the active enzyme was a homo-tetramer at 4°C but dissociated into inactive monomers at 25C. Comparisons of family 2 -galactosidase amino acid compositions and modeling studies with the LacZ structure did not mimic suggested trends for conferring enzyme flexibility at low temperatures, consistent with the changes affecting thermal adaptation being localized and subtle. Mutant studies of the BgaS enzyme should aid in the understanding of such specific, localized changes affecting enzyme thermal properties.
30
Introduction Glycosyl hydrolases (EC 3.2.1 to 3.2.3) cleave the glycosidic bond between two or more carbohydrates or between a carbohydrate and another moiety. Traditionally, glycosyl hydrolases were classified based on functional similarity. More recently, however, Henrissat and his coworkers have organized these enzymes into roughly 100 glycosyl hydrolase families characterized by hydrophobicity plots, amino acid sequence similarities, and reaction mechanisms (10, 11, 12). This system also identifies possible common structural domains thereby defining evolutionary connections and suggesting reaction mechanisms for the glycosyl hydrolases. Based on these criteria, the once unified group of enzymes that exhibit -galactosidase activity (EC 3.2.1.23) is now subdivided into four different families: 1, 2, 35, and 42. Of these, the best studied is family 2 which includes the well characterized galactosidase from Escherichia coli that is encoded by the lacZ gene. Although there is considerable information about the regulation (1), biochemistry (19, 24, 36, 49), reaction mechanism (18, 47), and structure (16) of this LacZ -galactosidase, few other galactosidases within this family have been characterized biochemically (4, 7, 13, 14, 15, 27, 28, 45) while most examples exist only as a published sequence. Because of the emphasis on the E. coli LacZ enzyme, opportunities to learn from differences in galactosidases from other sources may have been overlooked. Studying these new galactosidases can provide insight into the evolution of their genes, suggest structural relationships, yield enzymes with academically and industrially valuable properties, and illuminate the underlying features responsible for thermal adaptation. Further, the characterization of other -galactosidases offers the advantage of examining enzymes 31
with unique biochemical and structural properties while having a characterized model for comparison. Because of our interest in studying cold-active enzymes, members of the Brenchley laboratory have isolated several psychrophilic prokaryotes, studied enzyme properties at low temperatures, and examined the mechanisms proposed for conferring cold-activity. As part of our objective of studying cold-active -galactosidases, we initially isolated psychrophiles from whey-treated fields in central Pennsylvania but now we have isolates from almost every type of cold environment on Earth. One of these isolates, SB, was obtained from a soil sample provided by Dr. L. E. Casida at Penn State University. The sample had been stored frozen since its collection from the Antarctic Dry Valley region by Dr. Benoit in the late 1960's. The organism was isolated in the early 1990’s by Ann Auman, an undergraduate working in the Brenchley laboratory at that time, and a gene encoding a -galactosidase (later designated bgaS) was cloned from this organism by Kevin Gutshall. Here I report on the biochemical characterization of BgaS and compare it with other enzymes. BgaS appears to be one of the most cold-active enzymes characterized to date with an optimal activity near 15C. It maintains at least 60% of its activity at 0C and loses all activity at 37C in less than ten minutes. Comparisons with purified E. coli galactosidase using ONPG or lactose as the substrate show that BgaS has a higher catalytic efficiency at 20C and below. To my knowledge, this is the first study to determine the catalytic efficiency of an enzyme using lactose as the substrate at temperatures below 25C. The unique cold-activity and heat-lability of BgaS is of special interest for comparisons and modeling with other family 2 -galactosidases to 32
discern specific regions and alterations that may confer these traits. The attributes of BgaS also make it a candidate for use in the industrial removal of lactose or as a reporter enzyme for psychrophilic genetic systems.
33
Material and Methods Amplification of SB 16S rRNA and cloning of the lacZ -galactosidase gene. Genomic DNA was obtained from isolate SB using the Puregene Isolation Kit (Gentra, Minneapolis, Minn.) with a modification of the Gram negative protocol of heating the sample at 80°C for 15 minutes. The 16S rRNA gene was amplified from chromosomal DNA by PCR with Ready-To-Go-Beads (Amersham, Piscataway, NJ) and universal primers 8F and 1492R (32, 46). The product was sequenced at the Penn State Nucleic Acid Sequencing Facility with an ABI model 370 sequencer. The lacZ gene was obtained from E. coli strain ATCC 23848 genomic DNA obtained using the Puregene Isolation Kit with a modification of the Gram negative protocol of heating the sample at 80°C for 15 minutes. The lacZ and lacY genes were amplified from chromosomal DNA using the enzyme Pfu DNA polymerase and the following primers: 5’–ATGATTACGGATTCACTGGCC – 3’ and 5’– TTAAGCGACTTCATTCACCTG–3’. Amplified product was blunt-end cloned into p18 and the lacZ gene was amplified using the enzyme Pfu DNA polymerase and the following primers: 5’–ATGATTACGGATTCACTGGCC–3’ and 5’– TTATTATTATTTTTGACACCA–3’. The amplified lacZ gene was then blunt-end ligated into p18. Constructs were subjected to restriction digests to demonstrate that they yielded the patterns expected for the E. coli lacZ gene. Phylogenetic analysis of 16S rRNA and -galactosidase genes. The Isolate SB double-stranded 16S rRNA gene sequence was compared with those from the Ribosomal Database Project (http://rdp.cme.msu.edu/html) and the NCBI database (http://www.ncbi.nlm.nih.gov) (22, 23), and was aligned using the Clustal W program 34
found in the BioEdit platform (Version 5.0.6; Department of Microbiology, North Carolina State University [http://www.mbio.ncsu.edu/BioEdit/bioedit.html]). The alignment was used in maximum parsimony, maximum likelihood, and distance analyses utilizing the PAUP package (version 4.0b10; School of Computational Sciences and Informational Technology, Florida State University [http://paup.csit.fsu.edu]). The sequence data were analyzed using the maximum parsimony method (heuristic search), the maximum likelihood method, and the distance method (neighbor joining algorithm and Jukes-Cantor model) with 1,000 bootstrap replicates being performed for this method. The initial distance analysis used the neighbor joining algorithm and an uncorrected “p” distance measure using the PAUP program. The results with distance trees were compared using the Jukes-Cantor, F81, F84, Kimura 2-parameter, Kimura 3parameter, Tamura-Nei, Tajima-Nei, and HKY85 models. Trees generated by all three methods were congruent. A distance matrix was generated using the same alignment by the PAUP program, using the Jukes-Cantor model. The BioEdit alignment of the bgaS gene sequence was analyzed utilizing the PAUP package and methods described for the 16S rRNA genes. Trees generated by all methods were congruent, with only minor variations. Enzyme purification. The enzyme used for determining the N-terminal amino acid sequence and oligomeric state was purified from E. coli DH5 cells carrying a pET22b (+) construct of bgaS (method I). Cells were grown at 37°C for five hours in LB containing ampicillin, and then transferred to 18°C, induced with 0.1 mM IPTG (final concentration), and incubated an additional 16 hours. The cells were harvested by centrifugation, resuspended in Z-buffer without -mercaptoethanol (designated as
35
modified Z buffer and containing: 60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4) (25), and disrupted by passage through a French pressure cell (18,000 lb/in2). Ammonium sulfate was added to 25% saturation, the precipitate removed by centrifugation, ammonium sulfate added to 60%, and the precipitate collected. The resuspended precipitate was applied to an affinity column containing p-aminophenyl D-thiogalactopyranoside (Sigma). BgaS was eluted from the column with modified Z buffer containing 300 mM NaCl and fractions with -galactosidase activity collected. Enzyme preparations were dialyzed and stored at 5°C in modified Z buffer. The enzyme used for other biochemical characterizations was purified from E. coli MC1061 (DE3) cells containing a pET28a(+) vector (Stratagene Cloning Systems, La Jolla, CA) construct containing either the bgaS or lacZ gene inserted to create an Nterminal 6X-Histidine fusion with their protein (method II). An E. coli transformant containing either construct was grown and disrupted as described above. Following centrifugation, the supernatant was mixed with an equal volume of ice-cold column wash buffer (modified Z Buffer, 300 mM NaCl, 5 mM imidazole, pH 7.0), and loaded onto a TALON SuperFlow column (ClonTech, Palo Alto, CA). The column was washed with 8 column volumes of buffer, and protein eluted with elution buffer (modified Z-buffer, 300 mM NaCl, 150 mM imidazole). The eluted enzyme fractions containing either H-BgaS or H-LacZ were dialyzed against 3 liters of modified Z -buffer and stored at 5°C. Thrombin treatment. To prevent heat inactivation while removing the His-tag from H-BgaS, the enzyme was incubated with 0.005 U thrombin (Novagen, Madison, WI) at 4°C, rather than the recommended 20 or 37C, for 48 hours. The reaction was monitored by measuring the hydrolysis of the 48 kDa test protein into cleaved
36
polypeptides by polyacrylamide gel electrophoresis. The His-tag and thrombin were separated from the BgaS enzyme by passage through a G-200 Sephadex column. The resulting BgaS enzyme was used for kinetic studies. Oligomeric state determinations. Sedimentation coefficients were obtained during ultracentrifugation for 1.5 hours in an Optima XL-A analytic ultracentrifuge (Beckman) using an absorbance optical system consisting of a xenon flash lamp scanning at 280 nm. Each centrifugation was performed using a 1 mg/ml sample of purified BgaS in a double sector cell at 208,000 xg at either 4 or 25C scanning every 5 minutes at 25C and every 2 minutes at 4C. Scanning at each temperature resulted in a pattern that was indicative of a single species. Molecular weights of the species were determined by using the following formula: M = RTs / (D*(1-2). The diffusion coefficient (D) was estimated by solving the following equation: D = kT / 6r. Biochemical characterization. All protein concentrations were measured using the bicinchoninic acid method (48) using bovine serum albumin (Promega) as a standard. The thermodependency of enzyme activity was determined by incubating the enzyme in modified Z Buffer containing 2.2 mM ONPG (o-nitrophenyl--D-galactopyranoside) for five minutes at temperatures ranging from 0 to 40C for BgaS and 0 to 65C for E. coli LacZ. Reactions were stopped by the addition of 1 M Na2CO3 and hydrolysis of the nitrophenyl group was detected spectroscopically at 420 nm. Since the assay conditions can affect the ratio of active to heat-inactivated enzyme, especially at high temperatures, all conditions were carefully standardized and enzyme addition was used to initiate the reactions. The thermodependency of activity results were highly reproducible using these methods. The thermostability of BgaS was determined by incubating the enzyme at 15, 37
30, and 37C removing aliquots for up to 120 minutes. The enzyme was then immediately assayed for ONPG activity at 15C in the same manner as the thermodependency of activity assays. Small molecule assays were performed in the same manner as those for the thermodependence of activity with the addition of 2.5 mM ethanol, 0.5 mM DTT, 0.5 mM DTE, 50 mM beta-mercaptoethanol (-ME), and 50 mM 4-mercapto-1-butanol to Z-buffer. The optimal pH values were determined by assaying with 2.2 mM ONPG for 5 minutes at 15C in buffers ranging in pH from 4.0 to 10.0 in increments of 0.5 pH units. The buffers used were 0.1 M sodium acetate-acetic acid for pH 4.0 to 6.0, 0.1 M phosphate for pH 6.0 to 8.0, and 0.1 M potassium chloride-boric acid for pH 8.0 to 10.0. Requirements for metal ions were tested by incubating the enzyme in 20 mM phosphate buffer containing 100 mM EDTA for 1.5 hours at 0C. The enzyme was then loaded onto a Sephadex G25 (Sigma) column and eluted with 20 mM phosphate buffer. Fractions containing protein were pooled and assayed for activity in 20 mM phosphate buffer containing varying concentrations of MgCl2, MnCl2, CaCl2, CoCl2, CuCl2, NaCl, and KCl. Substrate specificity was tested by incubating the enzyme at 15C for 5 minutes in modified Z-buffer containing 2.2 mM (final concentration) of various nitrophenyl substrates. Substrates tested were ONPG, p-nitrophenyl--D-galactoside (PNPG), onitrophenyl--D-fucopyranoside, p-nitrophenyl--D-mannoside, o-nitrophenyl--Dglucoside, p-nitrophenyl--D-xyloside, p-nitrophenyl--D-cellobioside, p-nitrophenyl-D-arabinoside,
p-nitrophenyl--D-lactoside, p-nitrophenyl--D-galacturonide, p-
nitrophenyl--D-glucuronide, and p-nitrophenyl--D-galactoside (Sigma). 38
Kinetic assays for BgaS were performed at 5, 10, 15, and 20C in modified Zbuffer with varying concentrations of ONPG and at 5 and 15 C in modified Z-buffer (plus hexokinase, glucose-6-phosphate dehydrogenase and NADP) with varying concentrations of lactose. Kinetic assays for LacZ were performed at 20C with ONPG as the substrate. The Ki values were determined using varying concentrations of the inhibitors D-galactose, D-galactal, and lactose with ONPG as the substrate. For kinetics with ONPG, hydrolysis of the nitrophenyl group was detected at 420 nm. For kinetics with lactose, production of NADPH, created through the coupled assay of hexokinase and glucose-6-phosphate dehydrogenase (Sigma), was detected at 340 nm using a Genesys2 spectrophotometer (Spectronic Instruments, Inc., Rochester, NY). Kinetic and Ki values were calculated by using the analysis program EnzymeKinetics V1.5 (42) and verified using the Windows Non-Lin program (17). Cysteine titrations were performed by incubating native BgaS enzyme in titration buffer (150 mM phosphate buffer containing 2 mM dithiobisnitrobenzoic acid [DTNB]). Reactions were scanned in a Genesys2 spectrophotometer at 412 nm at 5 minute intervals. The total number of cysteines was determined by unfolding the protein in titration buffer containing 8 M urea (final concentration). Reactions were then assayed in the same manner as the folded protein.
39
Results Isolate characterization. To examine the phylogenetic position of the isolate SB, I amplified and sequenced the 16S rRNA gene (Figure 2.1). Analysis of the sequence showed that it clustered with other organisms isolated from cold environments: Siberian soil (Arthrobacter species S1) and a cold desert in the Spiti Valley (Arthrobacter species Kaza-36). These three isolates formed a well-supported cluster with Arthrobacter sulfonivorans, which was recently isolated from root soil (3). A. sulfonivorans grows at 5C and has optimal growth at 20-25°C, so it would also be considered a psychrophile according to the definition of Neidhardt (29). The Jukes-Cantor evolutionary distance matrix indicated that isolate SB could be a strain of A. sulfonivorans (distance of 1.13%). The evolutionary distances were greater between isolate SB and A. nicotinovorans, A. oxydans, and A. polychromogenes (1.99%, 1.40%, and 1.48% respectively). All other distances from characterized strains were found to be larger than 2%. Gene sequence and phylogenetic relationship among the family 2 enzymes. The sequence of bgaS was analyzed and found to encode a 1,053 amino acid protein with a predicted weight around 114 kDa. The fragment had a high mole % G+C content (67%), which is typical for Arthrobacter species.
40
Figure 2.1. Rectangular phylogram derived from a maximum parsimony, maximum likelihood, and distance methods search of 16S rRNA gene sequence data with 1,000 bootstrap replicates for 43 taxa each comprising 1,613 nucleotide positions. The tree was rooted using the sequences of Arthrobacter agilis, Arthrobacter flavus, Arthrobacter methylotrophus, Arthrobacter sp. IC044, Arthrobacter sp. MB8-13, Arthrobacter sp. S23H2, and Arthrobacter agilis strain LV7 as the outgroup. Bolded organism names are known psychrophiles. Accession number for the 16S rRNA gene sequence of all organisms is in parentheses.
41
42
A comparison of the bgaS sequence with those from the NCBI database showed that it was most closely related to two lacZ-like genes, one from an Antarctic Arthrobacter sp. C2-2 (71% similar) and the other from Arthrobacter psychrolactophilus (66% similar) (Figure 2.2). Although biochemical data are not available for the -galactosidase from Arthrobacter sp. C2-2, it is interesting that the closely related enzyme from A. psychrolactophilus has a temperature optimum around 40C and is quite stable at 37C (44). Alignment with protein sequences from the family 2 -galactosidases showed that the two glutamic acid residues (461 and 537) involved in catalysis in the E. coli LacZ enzyme were conserved in BgaS at sites 447 and 526. The alignments also showed that the conserved region 60 residues toward the N-terminus from the general acid/base catalyst, typical of members of the family 2 glycosyl hydrolases, was also conserved in BgaS. The combination of the phylogenetic analysis and conservation of important residues established that BgaS is a member of the family 2 glycosyl hydrolases. Determination of pH range and substrate specificity. The initial assays followed procedures used for the E. coli LacZ enzyme so I examined these conditions to determine if they were optimal for the BgaS enzyme. The activity was measured in a variety of buffers with pH values from 4.0 to 10.0 and activity was found from pH 6.0 to 9.5 with the greatest activity at pH 7.0 and 50% activity around pH 6.7 and 8.5. This optimum was similar to the pH 7.2 optimum found for the E. coli LacZ enzyme (43).
43
Figure 2.2. Rectangular phylogram derived from a maximum parsimony, maximum likelihood, and distance methods search of family 2 -galactosidase gene sequences with 1,000 bootstrap replicates for 46 taxa each containing 4,449 nucleotide positions. The tree was rooted using the sequences of Arabidopsis thaliana and Oryza sativa as the outgroup. Gene sequences from organisms shown in bold are known or hypothesized to encode cold-active -galactosidases. Accession number for all the -galactosidase gene sequences are in parenthesis.
44
Arthrobacter sp. C2-2 (AJ457162) Arthrobacter psychrolactophilus (U12334) BgaS 100 Streptomyces coelicolor (AL939116) 100 Xanthomona s axonopodis (NC_003919) Xanthomonas campestris (NC_003902) Thermotoga neapolitana (AF055482) 100 100 Thermotoga maritima I (NC_000853) Thermotoga maritima II (TMU08186) Ba cillus megaterium (AF047824) 100 99 Streptococcus thermop hilus (AF503446) 100 Streptococcus thermop hilus strain A054 (M63636) 100 Streptococcus thermophilus strain SMQ-30 1 (AF389475) 59 100 Streptococcus salivarius (AF389474) 62 Lactoba cillus delbrueckii (M55068) Bifidobacterium bifidum (AJ224434) 100 100 Bifido bacterium lo ngum (NC_004307) 100 Bifidobacterium lon gum strain DJO10A (NZ_AABF01000028) 81 100 Bifido baterium longum strain MB219 (AJ242596) Bifidobacterium infantis (AF192265) 86 Bacillus h alodurans (AP001516) Clostridium acetobutylicum (M35107) 100 Vibrio vu lnificus strain CMCP6, chromoso me I (NC_004459) Shigella flexneri (NC_004337) 100 85 Caldicellu losirup tor lacto aceticus (AJ316560) Kluyveromyces lactis (YSKLAC4A) 100 Staphylococcus carnosus (AY099473) 100 82 Staphyloco ccus xylosus (Y14599) 100 Clostridium perfringens (AP003188) Actinobacillus pleuropneumoniae (U62625) 95 Psychromonas marina (AB025433) Vib rio cholerae (AF073995) 97 100 Vib rio vulnificus strain CMCP6, chromosome II (NC_004460) Vibrio vulnificus strain ATCC 29307 (AY028965) 100 100 Vib rio vulnificus strain 672 (AF305636) 100 Pseud oalteromonas haloplanktis (AJ131635) 97 Escherichia coli O157:H7 (AP00 2551) Yersinia pestis (AJ414149) 100 Enterobacter cloacae (D42077) Klebsiella pneumoniae (M11441) 100 Oenococcus oeni (NZ_AAAZ01000024) 100 97 Lactococcus lactis strain NCDO205 4 (AF082008) 100 Lactococcus la ctis strain ATCC7962 (X80037) Lactococcus lactis strain IL1403 (NC_002662) 100 Arabidopsis thaliana (AY028965) Oryza sativa (AP003683) 100
65
100
0.1 Substitutions/Site
45
The substrate specificity was determined by assaying with several chromogenic substrates. The enzyme had about 84% of the ONPG activity when PNPG was the substrate, but showed less than two percent of the ONPG activity with any of the other substrates tested (Table 2.1).
Table 2.1. Percent activity of purified H-BgaS with various nitrophenyl-derived chromogenic substrates Substrate Activitya o-nitrophenyl-β-D-galactoside 100 % p-nitrophenyl-β-D-galactoside 84.1 % o-nitrophenyl-β-D-fucopyranoside < 1% p-nitrophenyl-β-D-cellobioside < 1% o-nitrophenyl-β-D-glucoside < 1% < 1% o-nitrophenyl--D-galactoside p-nitrophenyl-β-D-mannoside < 1% p-nitrophenyl-β-D-xyloside < 1% p-nitrophenyl-β-D-arabinoside < 1% p-nitrophenyl-β-D-lactoside < 1% p-nitrophenyl-β-D-galacturonide < 1% p-nitrophenyl-β-D-glucuronide < 1% a The values are relative to the 100 percent value observed with ONPG (27.0 U/mg)
Initial characterization. The thermodependency of activity and the thermal lability of BgaS activity were examined using enzyme purified by method I. The enzyme had a temperature optimum between 15 and 20°C (Figure 2.3A) and lost 90% of its activity within 10 minutes at 35°C. These results showed that BgaS was extremely coldactive and heat-labile and was of substantial interest for further biochemical characterization. I found, however, that about 90% of the enzyme produced from the pET22b (+) construct formed inclusion bodies and that the purification procedure yielded enzyme preparations with varying specific activities. Attempts to resolubilize the
46
inclusion bodies were unsuccessful as were experiments using different hosts, the arabinose-inducible vector (pBAD) and the pJL3 plasmid (BRP protein), and varying IPTG concentrations. Thus, a vector carrying the bgaS gene and encoding an N-terminal His-tag was constructed which allowed a more rapid purification and reproducible yield of enzyme activity. However, I noted that the overall specific activity was reduced (25 U/mg versus 100 U/mg at 15C). Because I wanted to compare the BgaS characteristics with those found for the E. coli enzyme, I prepared a similar construct with the lacZ gene as described in the Materials and Methods section. Interestingly, the LacZ specific activities also decreased by 4 fold (60 U/mg versus 250 U/mg at 55C). Comparison of BgaS and LacZ properties. The properties of the BgaS and LacZ enzymes were compared to their His-tagged BgaS (H-BgaS) and LacZ (H-LacZ) counterparts to determine whether other characteristics were altered. The H-BgaS enzyme retained the pH optimum and substrate specificity found for the enzyme purified by method I. The thermodependency of enzyme activity was also measured for both the H-BgaS and the E. coli H-LacZ enzymes (Figures 2.3A and B).
47
Figure 2.3. Influence of temperature on the -galactosidase activities of (A) BgaS (blue) and LacZ (red), (B) H-BgaS (light blue) and H-LacZ (pink), and (C) the relative activities of BgaS (blue), H-BgaS (light blue), LacZ (red) and H-LacZ (pink). The specific activity corresponding to 100% activity was 115 U/mg, 26.9 U/mg, 250.8 U/mg, and 58.5 U/mg for BgaS, H-BgaS, LacZ, and H-LacZ respectively. One unit is defined as the amount of enzyme needed to release 1 mol o-nitrophenol/min.
48
C.
Specific Activity (U/mg) Specific Activity (U/mg)
B.
250 200 150 100 50 0 0
10 20 30 40 50 60 70
0
10
20
30
40
50
60
70
0
10
20
30
40
50
60
70
60 50 40 30 20 10 0 100
Percent Activity
A.
80 60 40 20 0
Temperature (C) 49
In order to determine whether the His-tagged enzymes had the same thermal dependency of activity profile as their non-tagged counterparts, the relative activity of all four enzymes was compared (Figure 2.3C). These results showed that although the Histagged versions had reduced activity, the enzymes maintained their original thermal properties. The comparison of the BgaS and LacZ enzymes also demonstrated that the BgaS enzymes were more active at temperatures at or below 20C than their LacZ counterparts (Figure 2.3A and B). My initial results with purified enzyme and those from the thermodependency of activity studies suggested that the BgaS enzyme was extremely heat labile. Incubation of the H-BgaS enzyme at different temperatures substantiated these results that both forms of the enzymes were inactivated within 10 minutes at 37°C, within 1 hour at 30C, but remained stable at 15C for at least two hours (Figure 2.4). Further, I also attempted to recover activity of the BgaS enzyme after incubating an aliquot at 37 and 35°C for 5 minutes. Each incubation resulted in a loss of activity and was not reversed by continued incubation at 15 or 4°C for 24 hours. Thus, unlike the report of a phosphoglycerate kinase where the catalytic activity was reduced while the thermostability was increased by the introduction of a His-tag (2), my results showed that the thermodependency of activity and thermostability remained the same with the Histagged enzymes even though the activity decreased 4 fold (Figures 2.3 and 2.4).
50
Percent Activity
100 80 60 40 20 0 0
20
40
60
80 100 120
Time (minutes)
Figure 2.4. Thermostability of purified H-BgaS at 15 (triangles), 30 (squares), and 37C (diamonds). Specific activity corresponding to 100% activity was 26.9 U/mg.
Metal requirements. The H-BgaS enzyme has no detectable activity when assayed in any of the “Good’s buffers” (MOPS, CHAPS, MES, etc), and is only active in Z-buffer and Phosphate buffer containing Mg++ or K+. For example, H-BgaS retains its activity when it is dialyzed against (or incubated in) Z-Buffer or Phosphate buffer (containing Mg++ or K+). However, if BgaS is dialyzed against MOPS, CHAPS, PIPES or MES buffers, no activity can be detected when assayed in the same buffer used for dialysis. Also, if the BgaS preparation that was dialyzed against MOPS is then assayed 51
in Z-Buffer, less than 5% of starting activity is seen. However, enzyme dialyzed in ZBuffer does not lose significant activity when subsequently assayed in MOPS, CHAPS, PIPES, or MES. These results indicate that the H-BgaS enzyme has a metal requirement(s) and that the metal(s) is readily lost during dialysis with buffers lacking the ion(s) required for activity. Based on these findings, metal studies were done with HBgaS. To examine possible metal requirements for the H-BgaS, it was treated with varying concentrations of EDTA. Unlike the Pseudoalteromonas haloplanktis galactosidase, which was inhibited by 5 mM EDTA (13), no activity loss was detected until the EDTA concentration reached 100 mM where the enzyme was inactivated after a 1.5 hour treatment. Activity of H-BgaS was relatively unchanged by the addition of Co2+, Cu2+, Ca2+ or Na+ (Table 2.2). However, activity was stimulated by the addition of Mg2+, Mn2+, or K+. The metal requirements were also examined by dialyzing the enzyme against MOPS buffer containing various metals. H-BgaS lost all activity after overnight dialysis against 100 mM MOPS but retained activity when Mg2+ and K+, Mg2+, Mn2+, or K+ were added to the dialysis buffer. These experiments confirmed the requirements for Mg2+, Mn2+, or K+. Small molecule studies. One of the interesting properties observed reproducibly with both purified BgaS and H-BgaS is that the addition of -mercaptoethanol (-ME) to the assay buffer increases the temperature optimum of the enzyme by 5C. I examined this phenomenon further by adding several similar small molecules to the assay buffer and determined their effects on the H-BgaS activity monitored at different temperatures.
52
Table 2.2. Metal studies with purified H-BgaS with EDTA and dialysis Metals Percent recovered from Percent recovered from EDTA treated enzymea dialyzed enzymeb Mg2+ 75 60 2+ Mn 13 20 Co2+ 2 Cu2+ 2 2+ Ca 1.5 Na+ 5 + K 12 10 Mg2+ and K+ 78 MOPS, CHAPS, PIPES
